ID: 1006105602

View in Genome Browser
Species Human (GRCh38)
Location 6:31714399-31714421
Sequence TGCCAGCTTTACTACCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006105596_1006105602 -4 Left 1006105596 6:31714380-31714402 CCTACCCTGTAATTATCCCTGCC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105590_1006105602 23 Left 1006105590 6:31714353-31714375 CCTTTGATCCCCCCAAGCTTCAA 0: 1
1: 0
2: 1
3: 13
4: 210
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105598_1006105602 -9 Left 1006105598 6:31714385-31714407 CCTGTAATTATCCCTGCCAGCTT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105597_1006105602 -8 Left 1006105597 6:31714384-31714406 CCCTGTAATTATCCCTGCCAGCT 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105594_1006105602 12 Left 1006105594 6:31714364-31714386 CCCAAGCTTCAACATTCCTACCC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105592_1006105602 14 Left 1006105592 6:31714362-31714384 CCCCCAAGCTTCAACATTCCTAC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105593_1006105602 13 Left 1006105593 6:31714363-31714385 CCCCAAGCTTCAACATTCCTACC 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105589_1006105602 24 Left 1006105589 6:31714352-31714374 CCCTTTGATCCCCCCAAGCTTCA 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105591_1006105602 15 Left 1006105591 6:31714361-31714383 CCCCCCAAGCTTCAACATTCCTA 0: 1
1: 1
2: 1
3: 17
4: 250
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data
1006105595_1006105602 11 Left 1006105595 6:31714365-31714387 CCAAGCTTCAACATTCCTACCCT 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006105602 Original CRISPR TGCCAGCTTTACTACCTTGG AGG Intronic
No off target data available for this crispr