ID: 1006105763

View in Genome Browser
Species Human (GRCh38)
Location 6:31715391-31715413
Sequence TACCCAAGGCAGCCCCTAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006105763_1006105770 22 Left 1006105763 6:31715391-31715413 CCTGCTAGGGGCTGCCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1006105770 6:31715436-31715458 CACACAGGCCTTCTGCCAGCCGG 0: 1
1: 0
2: 1
3: 39
4: 302
1006105763_1006105768 7 Left 1006105763 6:31715391-31715413 CCTGCTAGGGGCTGCCTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1006105768 6:31715421-31715443 GGCCAGCTAGCTTCTCACACAGG 0: 1
1: 0
2: 2
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006105763 Original CRISPR TACCCAAGGCAGCCCCTAGC AGG (reversed) Exonic
900374378 1:2346833-2346855 TCCCCAGGGCAGACCCCAGCAGG - Intronic
900987459 1:6081459-6081481 AAACCAAGGCAGTCCCCAGCAGG - Intronic
901207670 1:7506094-7506116 TTCCCCAGGCAGCCTCTGGCCGG - Intronic
901323908 1:8355918-8355940 TACCCCAGACAGCCCCCAGAGGG + Intronic
901510384 1:9715489-9715511 CACCCAAGGCAGCCACTGGGAGG - Intronic
905894362 1:41535416-41535438 CACCCAAGGCAGCCCTTTGGAGG + Intronic
906142094 1:43539943-43539965 TACCCAAGGAAGCTCCAACCTGG - Intronic
912697380 1:111851709-111851731 TCCCCAACGCAGCACCTAGCAGG + Intronic
915894124 1:159798080-159798102 TGCACAAGGCTGCCCCCAGCTGG + Intergenic
916088902 1:161291727-161291749 TACCCAAAACATCCCCTAGAGGG - Intergenic
918218519 1:182414855-182414877 TGCCAAAGGCAGCCCCCAGCAGG + Intergenic
918238011 1:182599010-182599032 TACCCAGGGCAGCCCCTTTGTGG - Exonic
920709926 1:208285535-208285557 TAGGGAAAGCAGCCCCTAGCTGG - Intergenic
922540446 1:226414895-226414917 TCCCCACGGCAGCCCCTATGTGG + Intergenic
922662334 1:227441063-227441085 TACCCAGGGCATTCCCTCGCTGG + Intergenic
1065522036 10:26582529-26582551 AACCAAAGGCAGCCCCAATCAGG + Intergenic
1066064634 10:31753137-31753159 GACCCAATGCAGCTCCTAGCAGG - Intergenic
1072896095 10:99368148-99368170 TCCTCAAGGATGCCCCTAGCAGG + Intronic
1075095614 10:119468899-119468921 TACCCAAGGCAGAGCCTGGAAGG + Intergenic
1075787026 10:125057003-125057025 TACACAGGGCAGCCCCCAGCCGG + Intronic
1076378563 10:130009515-130009537 AACCCAAGGCAGCGGCTAGAGGG + Intergenic
1077066806 11:644716-644738 TCCCCAAGGCAGACCCCAGAGGG + Intronic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1077550735 11:3199123-3199145 TTCCCAAGGCAGACCCACGCTGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084608660 11:70187009-70187031 GAGGCAAGGCAGCCCCTAGATGG + Intronic
1088609314 11:111562076-111562098 AACCCATGGCAGCACCTTGCAGG + Intergenic
1088997380 11:115013188-115013210 TTCCCAAGGCACTCCTTAGCAGG - Intergenic
1090644465 11:128756522-128756544 GACACAAGGCAGCCCCTAACAGG + Intronic
1103608445 12:122106025-122106047 TGCCCAGGCCAGCCCCTGGCTGG + Intronic
1104969910 12:132526591-132526613 TTCCCAAGACAGACCCTTGCCGG - Intronic
1105337505 13:19487306-19487328 TCCCACAGGCTGCCCCTAGCAGG - Intronic
1108527586 13:51299273-51299295 CACCCAAGGCAGCCCTTATGAGG + Intergenic
1108532825 13:51343399-51343421 TCCCCCAGGCATCCCATAGCTGG - Intronic
1110167460 13:72460452-72460474 TCCCCAAGTCAGCCCCAAGTTGG - Intergenic
1113647737 13:112011046-112011068 TGCACATGGCAGCCCCTTGCTGG + Intergenic
1118936250 14:70291385-70291407 TAGGCAGAGCAGCCCCTAGCTGG + Intergenic
1119126384 14:72130987-72131009 TCCCCAAGGCAGAGCCTAGCAGG - Intronic
1121928912 14:97954279-97954301 TACCCTAGGCTGCTTCTAGCTGG - Intronic
1123038831 14:105482203-105482225 CACCCAAGGGAGCACCTGGCTGG - Intergenic
1125318809 15:38459728-38459750 TACCCAAGGGAGCCCATCTCCGG - Intronic
1128133965 15:65249303-65249325 TTCCCCAGGCAGCCCCTGGGCGG + Intronic
1128325114 15:66719267-66719289 TCCCCAAGCCAGACCCTGGCAGG + Intronic
1130399215 15:83533628-83533650 TACCCGAGGCCAACCCTAGCTGG - Intronic
1132668763 16:1094302-1094324 CACCCAACGCAGACCGTAGCTGG - Intronic
1132876430 16:2140764-2140786 TACCCAAGAGAGCCTCTAGGGGG - Intergenic
1135155076 16:20045867-20045889 TGGCCAAGGCAGTCGCTAGCCGG - Intronic
1136902161 16:34051071-34051093 TAGGCAAGGAAGCCCCGAGCCGG - Intergenic
1138659799 16:58510311-58510333 TCCACCAGGCAGCCCCAAGCTGG + Intronic
1139596232 16:67959907-67959929 CACCCAGGGCAGGCCCGAGCAGG - Intronic
1139949212 16:70661019-70661041 GCCCCCAGGCAGCCCCTAGCAGG + Intergenic
1141022883 16:80514175-80514197 TACCCAAGGCAGCTGTTAGGAGG - Intergenic
1144964843 17:19070461-19070483 ATCTCAAGGCAGCCCCCAGCGGG + Intergenic
1144983124 17:19181717-19181739 ATCTCAAGGCAGCCCCCAGCGGG - Intergenic
1144985101 17:19196522-19196544 ATCTCAAGGCAGCCCCCAGCGGG + Intergenic
1145837888 17:27968488-27968510 TTCCCAAAGCAGCACTTAGCAGG + Intergenic
1146127356 17:30239556-30239578 TCTCCATGGGAGCCCCTAGCAGG + Intergenic
1146485679 17:33240664-33240686 TACCCCAGGCAGCCAGGAGCGGG + Intronic
1147198970 17:38786716-38786738 GAGCCAAGGCAGCACCTGGCAGG - Intronic
1148051375 17:44771654-44771676 TACTCACTGCAGCCCCTGGCAGG - Exonic
1148321548 17:46758471-46758493 AACCTAAGGCAGCAGCTAGCTGG - Intergenic
1149485093 17:57036459-57036481 TGGCCAAGGAAGCCCCTTGCAGG + Intergenic
1150280499 17:63927478-63927500 AACCCAGGGCAGCCTCAAGCAGG + Intergenic
1150290113 17:63976243-63976265 TTCCAAAGTCAGCCCCGAGCTGG + Intergenic
1153547100 18:6219262-6219284 GATCCAAGGCAGCCCCTTTCAGG + Intronic
1157220707 18:45826798-45826820 TGCCCAAACCAGCCCCGAGCTGG - Intronic
1158570907 18:58596364-58596386 GAGCCGAGGCAGCCACTAGCAGG + Intronic
1163796961 19:19343375-19343397 GAGCCAAGGCAGCCCAAAGCCGG + Intronic
1164784146 19:30916475-30916497 CACCCAAGGCTGGCCCTCGCAGG - Intergenic
1167088151 19:47324502-47324524 TTTCCAAGGCAGCCCCCATCTGG + Intergenic
925774382 2:7320021-7320043 TTCACAAGGCAACCCCTGGCTGG + Intergenic
925925122 2:8664737-8664759 TAGGCAAGGGAGCCCCCAGCCGG + Intergenic
925977141 2:9149500-9149522 TCTCCAGGGCAGCCCCTGGCTGG + Intergenic
930213249 2:48665470-48665492 TACCCAAAGCAGTGCCTAGAGGG - Intronic
936013568 2:108941515-108941537 TACCCATGGCAGCTGCCAGCTGG - Intronic
940131511 2:150387916-150387938 TACCTGATGCAGCCCCTACCTGG - Intergenic
942151522 2:173080702-173080724 TACCAAAGGCAAGCCTTAGCTGG - Intronic
942332916 2:174847576-174847598 CACCCTATGAAGCCCCTAGCAGG + Intronic
946766355 2:223044586-223044608 TGCCCAAGGCAGCCAGGAGCGGG - Intergenic
947714026 2:232330941-232330963 GACCCCAGGCAGCACCTAGGAGG + Intronic
947733234 2:232442321-232442343 GACCCCAGGCAGCACCTAGGAGG + Intergenic
947872449 2:233446998-233447020 AACCCCAGGAAGCCCCTAGAGGG - Intronic
1170705070 20:18737523-18737545 GACCCAAGGCAGCCCAAGGCAGG - Intronic
1170850368 20:19998823-19998845 TGCCCTAGGCAGCCCCTCCCTGG - Intronic
1171472193 20:25381066-25381088 TGACCCTGGCAGCCCCTAGCCGG + Intronic
1172981217 20:38943359-38943381 TCCTCAAAGCAGCCCCTATCAGG + Intronic
1175332667 20:58175967-58175989 AACCCAAGCCAGCTCCCAGCTGG - Intergenic
1176189285 20:63800317-63800339 CAGCCCAGGCAGCCCCTGGCCGG - Intronic
1176517811 21:7799346-7799368 TGCCCACAGCAGGCCCTAGCTGG + Intergenic
1177594752 21:23224143-23224165 ATCCCAAGGCAGCCCCAAGGTGG + Intergenic
1178651839 21:34429359-34429381 TGCCCACAGCAGGCCCTAGCTGG + Intergenic
1179906777 21:44426785-44426807 TTCTCAAGGGAGCCCCTAGGAGG - Intronic
1180008743 21:45035509-45035531 TACCCAAGGCAGCTCTTCCCTGG + Intergenic
1184236614 22:43186654-43186676 TTCCCAACGCAGCCCTCAGCCGG + Intronic
1184803014 22:46774043-46774065 CACCCAAGCCAGCCCACAGCAGG - Intronic
1184906629 22:47491807-47491829 TAACCAAGGCAGCTCCTAAGTGG + Intergenic
950585346 3:13888281-13888303 TATCCAACTCTGCCCCTAGCTGG - Intergenic
952154319 3:30626558-30626580 CACCCCAGGCAGCCACTTGCCGG - Intronic
960848859 3:122030945-122030967 TCCCCAGGGCAGCCCCTAAATGG + Intergenic
964771084 3:160225297-160225319 TGCCCATGGCAGCCCCGCGCGGG + Intergenic
967403911 3:189095234-189095256 TACCCAAATCTGCCTCTAGCAGG - Intronic
969057320 4:4409962-4409984 TTCCCACGGCAGACCCTGGCTGG - Intronic
971191609 4:24433962-24433984 CACCCACGGAAGACCCTAGCTGG + Intergenic
972256402 4:37360549-37360571 TGACCAAGGCAGCCCCTAGCAGG + Intronic
973560427 4:52130021-52130043 AACCCCAGGCAGGTCCTAGCTGG - Intergenic
973880969 4:55270501-55270523 GAGCCAAGGCAGCCCTGAGCTGG - Intergenic
976381254 4:84401861-84401883 AACCCAAGGCAGCCCCCTTCAGG + Intergenic
986489178 5:8271858-8271880 TAGGCCAGGCAGTCCCTAGCAGG + Intergenic
990968191 5:61472204-61472226 TATTCTAGGCAGCCACTAGCTGG - Intronic
992400241 5:76404292-76404314 TTCCGAGGGCAGCCCCTGGCTGG - Intronic
997370800 5:133358447-133358469 GAGCAAAGGCAGCCCCCAGCAGG + Intronic
998980005 5:147691556-147691578 TACCCAAGGCTGCACAAAGCTGG + Intronic
1006105763 6:31715391-31715413 TACCCAAGGCAGCCCCTAGCAGG - Exonic
1012830602 6:104199883-104199905 TAGCCAAGGCCTCACCTAGCAGG + Intergenic
1013368028 6:109449479-109449501 TACCTAAGGCAGCCCCGCTCAGG + Exonic
1015838068 6:137444082-137444104 TACCCAAGTCAGCCACTTGGAGG - Intergenic
1018637159 6:165872756-165872778 TACTCAAAGCAGCCCTTTGCTGG + Intronic
1018969343 6:168515491-168515513 TTTCAAAGGCAGCCCCCAGCAGG - Intronic
1019073858 6:169371173-169371195 TACCCAAGGCAGCACCTTGGAGG - Intergenic
1019645314 7:2125748-2125770 GACCCCAGGAAGCCCTTAGCTGG - Intronic
1020012775 7:4815693-4815715 TCCACAGTGCAGCCCCTAGCTGG + Intronic
1020705425 7:11537978-11538000 TACACAAGGATGGCCCTAGCCGG + Intronic
1021426924 7:20510876-20510898 TACCCCAGTCAGCCCCTCTCGGG + Intergenic
1021846480 7:24768062-24768084 GTCCCAAGGCTGCCCCCAGCTGG + Intergenic
1023122938 7:36927620-36927642 TACACAAGGCAGCCCAGAACTGG + Intronic
1024306200 7:47931523-47931545 TAGCCAAGACAGCGCCCAGCTGG + Intronic
1026087016 7:67270938-67270960 CCCCCAAGGCAGCCCTCAGCAGG - Intergenic
1026690085 7:72543760-72543782 CCCCCAAGGCAGCCCTCAGCAGG + Intergenic
1032138804 7:129307753-129307775 GACCCATGGCAGGTCCTAGCTGG + Intronic
1032170309 7:129578927-129578949 TGGCCGAGGCAGCCCCTAGGCGG + Intergenic
1034052154 7:147995155-147995177 TCACAAAGGCAGCCCCTACCAGG + Intronic
1034386641 7:150746019-150746041 TCCCCAAGGCAGGCCCCAGCCGG + Intronic
1034443434 7:151099705-151099727 TCCCGAGGGAAGCCCCTAGCAGG - Intronic
1041464071 8:58141796-58141818 TCCCCATGGCAGCCCGTAGCGGG + Intronic
1042165843 8:65945241-65945263 TACTCATGGCAGCCCAAAGCAGG - Intergenic
1043243030 8:77960396-77960418 TACCCATTGCAGCAACTAGCAGG + Intergenic
1047498581 8:125426068-125426090 TACCCATGCCAGCTCCTGGCAGG - Intergenic
1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG + Intergenic
1049276637 8:141723395-141723417 TGCCCCAGGCAGCCCCAAGCAGG + Intergenic
1051667047 9:19475417-19475439 AACCCAATGCAACCCCTAACAGG + Intergenic
1053143515 9:35696850-35696872 TACCCGAGGCAGCCTCAAGTTGG + Intergenic
1053723770 9:40975467-40975489 CACCAAAGCCAGCCCCCAGCAGG - Intergenic
1054342189 9:63876532-63876554 CACCAAAGCCAGCCCCCAGCAGG + Intergenic
1057142329 9:92735011-92735033 TAGCCAGGGCAGCCCCTTGGGGG - Intronic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1060230231 9:121820519-121820541 GACCCCAGGCAGCCCCGAGCGGG + Intergenic
1187313604 X:18170726-18170748 TACCCCTGGCAGTCCATAGCAGG + Intronic
1188985459 X:36764804-36764826 AACCTAAGGCAGGCCCCAGCAGG - Intergenic
1192698431 X:73443251-73443273 TACCCAAGGCAGACACTATTAGG - Intergenic
1194207806 X:91032665-91032687 CACACAAGGCAGCCCTTAGTGGG - Intergenic
1201372744 Y:13282935-13282957 TAGCCAAAGCAGCGCGTAGCAGG + Intronic