ID: 1006111689

View in Genome Browser
Species Human (GRCh38)
Location 6:31750569-31750591
Sequence GACTCACGCCCTGCTCGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006111689_1006111694 29 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111694 6:31750621-31750643 TGTGCTTTCTAAAGTGGGGATGG 0: 1
1: 0
2: 1
3: 27
4: 247
1006111689_1006111693 25 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111693 6:31750617-31750639 CGCATGTGCTTTCTAAAGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1006111689_1006111691 23 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111691 6:31750615-31750637 AGCGCATGTGCTTTCTAAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 89
1006111689_1006111692 24 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111692 6:31750616-31750638 GCGCATGTGCTTTCTAAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006111689 Original CRISPR GACTCACGCCCTGCTCGTAC TGG (reversed) Intronic