ID: 1006111689

View in Genome Browser
Species Human (GRCh38)
Location 6:31750569-31750591
Sequence GACTCACGCCCTGCTCGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006111689_1006111691 23 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111691 6:31750615-31750637 AGCGCATGTGCTTTCTAAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 89
1006111689_1006111694 29 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111694 6:31750621-31750643 TGTGCTTTCTAAAGTGGGGATGG 0: 1
1: 0
2: 1
3: 27
4: 247
1006111689_1006111693 25 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111693 6:31750617-31750639 CGCATGTGCTTTCTAAAGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1006111689_1006111692 24 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111692 6:31750616-31750638 GCGCATGTGCTTTCTAAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006111689 Original CRISPR GACTCACGCCCTGCTCGTAC TGG (reversed) Intronic
900199991 1:1400161-1400183 GTCTCACGCCCTGCCCGTCCTGG + Exonic
910282975 1:85521756-85521778 GGCTCACGTCCTTCTCCTACAGG + Intronic
914207039 1:145541237-145541259 GGCTCACGTCCTTCTCCTACAGG - Intergenic
917863228 1:179168673-179168695 GACTCACCACCTGCTTGTACAGG + Intronic
1068903734 10:62299392-62299414 GACTCACTCCCTTCTCCTACGGG - Intergenic
1069803163 10:71094987-71095009 GACTCACTCCCTTATTGTACTGG - Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG + Intronic
1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG + Intergenic
1090071323 11:123546942-123546964 CACTGAGGCCCTGCTCCTACTGG - Intronic
1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG + Intronic
1132204771 15:99978697-99978719 GACTCCCGCCCTGCTGGTGTTGG + Intronic
1133040750 16:3058805-3058827 GACTCAAGCTCTGCTCCTCCAGG + Exonic
1137556678 16:49474681-49474703 CACTCACCTCCTGCTCTTACTGG - Intergenic
1148646965 17:49224794-49224816 GCCGCACGCCCTGCTCGCCCAGG + Exonic
1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG + Intronic
1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG + Intronic
925125751 2:1454621-1454643 GGCTCACGCTCTGCTCCCACTGG + Intronic
925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG + Intergenic
928336936 2:30406275-30406297 GACTCACACCCTGCAGGTGCCGG - Intergenic
1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG + Intronic
1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG + Intergenic
1179512583 21:41883719-41883741 GAGTCACGCCCTGCTGTAACAGG - Intergenic
1182873634 22:33671053-33671075 GACTCAAGCCCTGGTCGAAGTGG + Intronic
989088314 5:37700039-37700061 GACTCAGGACCTGCTTGTACTGG - Intronic
991963417 5:72067875-72067897 AGCCCACGCCCTGCTCATACAGG - Intergenic
1001382885 5:171315550-171315572 GCCTCACTCCCTGCCCGGACCGG - Intergenic
1004222762 6:13760443-13760465 GACTCACACCCAGGTCGTTCTGG - Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1007851284 6:44804906-44804928 GCCTCACACCTTGCTCTTACAGG + Intergenic
1018978422 6:168582965-168582987 GACTCACGCCAGACTCGTCCAGG + Intronic
1019421691 7:953930-953952 GCCTCACGCCCTTCCCGCACCGG - Intronic
1019964362 7:4486558-4486580 GATTCCCGCCCTGCTCACACCGG + Intergenic
1035792217 8:2317373-2317395 GCCTCACGCCCTGTTCCTCCGGG - Intergenic
1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG + Intergenic
1039419405 8:37423429-37423451 GACTCACACCCAGCTCTTCCAGG + Intergenic
1049685202 8:143936640-143936662 GACTCACCCGCTGCTTGTCCTGG - Intronic
1049988528 9:972672-972694 GACTCACGCCCTCCTACTACTGG + Intergenic
1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG + Intergenic
1057385512 9:94602774-94602796 GACTCACGCCCTCCTAGAAATGG - Intergenic
1200093862 X:153648190-153648212 GGCCCCCGCCCTGGTCGTACAGG - Exonic