ID: 1006111691

View in Genome Browser
Species Human (GRCh38)
Location 6:31750615-31750637
Sequence AGCGCATGTGCTTTCTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006111688_1006111691 24 Left 1006111688 6:31750568-31750590 CCCAGTACGAGCAGGGCGTGAGT 0: 1
1: 0
2: 0
3: 5
4: 21
Right 1006111691 6:31750615-31750637 AGCGCATGTGCTTTCTAAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 89
1006111689_1006111691 23 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111691 6:31750615-31750637 AGCGCATGTGCTTTCTAAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 89
1006111690_1006111691 -7 Left 1006111690 6:31750599-31750621 CCTAAGTGTTTAGTGCAGCGCAT 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1006111691 6:31750615-31750637 AGCGCATGTGCTTTCTAAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006111691 Original CRISPR AGCGCATGTGCTTTCTAAAG TGG Intronic
902188490 1:14743518-14743540 AGCCCCAGTGCTTTCTAAATTGG + Intronic
903035238 1:20488606-20488628 GGCGCGTGTGCTTCCTGAAGGGG - Intergenic
906369003 1:45236415-45236437 AAAGCTTGTGCTTTCCAAAGTGG - Intronic
907902704 1:58755637-58755659 AGCACCTCTGCTTTCTGAAGAGG + Intergenic
909108527 1:71444314-71444336 AGTGCATTTGCATTCTAATGTGG - Intronic
912621491 1:111164201-111164223 AGCACATCTGCTTTCTCAAAAGG - Intronic
918783529 1:188733175-188733197 AGCGCCTGAGCTCTGTAAAGAGG - Intergenic
921498008 1:215864506-215864528 AGGGCATGATCTGTCTAAAGGGG + Intronic
923084557 1:230693829-230693851 AACTCCTGGGCTTTCTAAAGAGG + Exonic
924430616 1:243993633-243993655 AGAGCAAGTGTTTTGTAAAGGGG + Intergenic
1064531715 10:16317199-16317221 AACACAAGTGCTTTTTAAAGAGG - Intergenic
1068842336 10:61629744-61629766 TGCGCATGACCTGTCTAAAGGGG - Intergenic
1070601152 10:77867263-77867285 GGCACATGTGCATTCTAAAAGGG - Intronic
1070601235 10:77867759-77867781 GGCGCATTTGCATTCTAAAAGGG + Intronic
1071653406 10:87420197-87420219 AGAGAATGAGCTTTTTAAAGAGG + Intergenic
1072559661 10:96559333-96559355 AGCGCATTGGCCTTCTAATGAGG - Intronic
1075408058 10:122207677-122207699 AGAGCATGTCAGTTCTAAAGAGG + Intronic
1078672934 11:13381095-13381117 AGTGTATGTGCTTTGTTAAGGGG - Intronic
1080042506 11:27773959-27773981 AACTCTTCTGCTTTCTAAAGAGG + Intergenic
1081973457 11:47215644-47215666 AGAGAATGAGCTTTCTAAGGAGG - Intronic
1083492179 11:63021170-63021192 AGCGCATGTCCAGTCTGAAGGGG + Intergenic
1085865872 11:80291370-80291392 AGCTCATGAGCTTTCTACAGAGG - Intergenic
1090795625 11:130133510-130133532 AGAGAATATGCTTTGTAAAGTGG + Intronic
1091626168 12:2122588-2122610 GGAGAATGTGCTTTGTAAAGGGG - Intronic
1106029000 13:25982163-25982185 AGAGCAAGTGCTTTCTGAATAGG - Intronic
1112544077 13:100347581-100347603 AGGGCAATTGCTTTATAAAGTGG + Intronic
1113318518 13:109209052-109209074 AGCCCATGTGATTCCTAAACTGG + Intergenic
1113528217 13:110999450-110999472 ATCGCATGTTCTTTCATAAGTGG + Intergenic
1116939372 14:50775116-50775138 AGTGCATGTCCTCTCCAAAGGGG + Intronic
1121956753 14:98220267-98220289 AGCACATGTTCTGTCTAAATGGG + Intergenic
1132932313 16:2464949-2464971 AACACAAATGCTTTCTAAAGTGG - Exonic
1135324337 16:21516727-21516749 AGCTAATGTGCCTTCCAAAGAGG - Intergenic
1135413916 16:22254593-22254615 AGTGCATATGGTTTGTAAAGTGG - Intronic
1136335823 16:29610004-29610026 AGCTAATGTGCCTTCCAAAGAGG - Intergenic
1139614223 16:68079363-68079385 AGAGCTTGAGCTTTCCAAAGTGG + Intergenic
1141371157 16:83487441-83487463 AGCACATGTCCCATCTAAAGGGG - Intronic
1141608748 16:85169853-85169875 AGCGCATGTACTGGCTCAAGCGG + Intergenic
1142010417 16:87711110-87711132 AGCCCATGAGCTCTCTCAAGAGG - Intronic
1142036541 16:87865796-87865818 AGCTAATGTGCCTTCCAAAGAGG - Intronic
1143934872 17:10473263-10473285 AATGCATGTGCCTTCTAAAATGG - Intergenic
1146968975 17:37056874-37056896 ACCGCTTGTGATTTCTTAAGAGG + Intergenic
1151147597 17:72055610-72055632 CAGGCATGTGCTTTCTTAAGTGG - Intergenic
1151753242 17:76054239-76054261 TGAGAATGTGCTTTTTAAAGCGG - Intronic
1152456290 17:80418354-80418376 ACAGCATGTGCATTCAAAAGAGG - Intronic
1153998892 18:10466526-10466548 AATGCATGTGCTTTGTAAATAGG + Intronic
1164823006 19:31264554-31264576 AGCGGATGTCCTGTCTAAAATGG + Intergenic
925987400 2:9227253-9227275 AGGGCATGTGCTCTGTGAAGTGG + Intronic
933897313 2:86823738-86823760 AGCACATGTGGTCTCTCAAGGGG + Intronic
935659532 2:105454163-105454185 GCCGAATGTGCATTCTAAAGGGG - Intergenic
937238388 2:120444216-120444238 AGCCCATGTGCTTTCACCAGTGG - Intergenic
946582594 2:221145809-221145831 TACGCATGTGATTTTTAAAGGGG + Intergenic
1169048344 20:2555904-2555926 AGCGCAGGTACTTTATAAAAGGG + Intronic
1172505669 20:35460473-35460495 AGCACATGCCCTGTCTAAAGGGG + Intronic
1174505143 20:51012800-51012822 GGAGCATGTGCTGCCTAAAGGGG - Intronic
1175668323 20:60879283-60879305 TGCGCATTTGCTTTTTAAACCGG - Intergenic
1177448771 21:21237609-21237631 AGAACATGTGCTTTCATAAGAGG - Intronic
1179555343 21:42171822-42171844 ACCCCAAATGCTTTCTAAAGCGG + Intergenic
1182064387 22:27420273-27420295 AGCTCATACCCTTTCTAAAGGGG - Intergenic
949374349 3:3371236-3371258 TGCTCATCTGCCTTCTAAAGGGG - Intergenic
955753788 3:62207893-62207915 AGCACATGACTTTTCTAAAGAGG + Intronic
958764161 3:98344679-98344701 AGCCCGTGTGCTTTCTAATCAGG + Intergenic
961968008 3:130926056-130926078 AGTCCATTTGCTTTCTCAAGGGG - Intronic
972049917 4:34717576-34717598 GGCGAATGTGCATTCTAAATAGG + Intergenic
974869644 4:67624504-67624526 ACAGCATGTGCTTTCAAAATAGG - Intronic
975790558 4:77945454-77945476 ATCACATGTTCCTTCTAAAGTGG - Intronic
979251951 4:118574885-118574907 GGCCCATGTGTTTTCCAAAGAGG - Intergenic
982423518 4:155227370-155227392 AGAACATGAGCTTTCTGAAGGGG - Intergenic
982444140 4:155470620-155470642 AGAGCATATGCTTACTCAAGGGG + Intergenic
984336420 4:178397764-178397786 AGAGCATGTACTTTCTTATGAGG + Intergenic
985006819 4:185542504-185542526 AGCAAATGTGCCTTCTTAAGAGG - Intergenic
986303270 5:6495331-6495353 ATGGAATTTGCTTTCTAAAGGGG + Intergenic
991480134 5:67069054-67069076 AAAGCATGAGCATTCTAAAGTGG + Intronic
992181146 5:74199716-74199738 AGAGCATGGGCTTTCTCCAGAGG + Intergenic
997865439 5:137458733-137458755 AGCACATGTGTTTTCTCAAAGGG - Intronic
997918833 5:137957640-137957662 TGTGCATGTGCTTTGTAGAGTGG - Intronic
999124585 5:149237849-149237871 AGCTCATGTCCTGTCTATAGGGG - Intronic
1001096175 5:168777214-168777236 AGCATATGTCCTATCTAAAGGGG - Intronic
1006111691 6:31750615-31750637 AGCGCATGTGCTTTCTAAAGTGG + Intronic
1011860559 6:91750036-91750058 GCCACATGTGCTTTGTAAAGAGG + Intergenic
1018283312 6:162211072-162211094 AAAGCTTGTGCTTTCTAATGAGG - Intronic
1024139852 7:46451338-46451360 AGAGCATGAGCTTTCTATAAAGG + Intergenic
1027999936 7:85480929-85480951 AGCACATGTGGGTGCTAAAGGGG + Intergenic
1034492443 7:151400889-151400911 AGTGCACGTGCTCTCTACAGGGG - Intronic
1034528637 7:151681976-151681998 ACCCCATGTGCTTCCTAAGGTGG + Intronic
1038114646 8:24539690-24539712 AGCAAATGATCTTTCTAAAGTGG - Intergenic
1041200117 8:55445635-55445657 AGAGCATGTGCTGTCTAGGGCGG + Intronic
1048533490 8:135271915-135271937 AGCGGATGTGCATGGTAAAGTGG - Intergenic
1058697024 9:107567511-107567533 AGCCCATGAACTTTCTAATGGGG - Intergenic
1186770919 X:12817351-12817373 ATGGCATGTGCTTTGAAAAGAGG + Intronic
1190468858 X:50755255-50755277 AGCACTTGTGGTTTCTATAGCGG - Intronic
1195011096 X:100732770-100732792 TGCTCACGTGCTTTCTAAAAGGG - Intergenic