ID: 1006111692

View in Genome Browser
Species Human (GRCh38)
Location 6:31750616-31750638
Sequence GCGCATGTGCTTTCTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006111688_1006111692 25 Left 1006111688 6:31750568-31750590 CCCAGTACGAGCAGGGCGTGAGT 0: 1
1: 0
2: 0
3: 5
4: 21
Right 1006111692 6:31750616-31750638 GCGCATGTGCTTTCTAAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73
1006111689_1006111692 24 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111692 6:31750616-31750638 GCGCATGTGCTTTCTAAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73
1006111690_1006111692 -6 Left 1006111690 6:31750599-31750621 CCTAAGTGTTTAGTGCAGCGCAT 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1006111692 6:31750616-31750638 GCGCATGTGCTTTCTAAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006111692 Original CRISPR GCGCATGTGCTTTCTAAAGT GGG Intronic
903035237 1:20488605-20488627 GCGCGTGTGCTTCCTGAAGGGGG - Intergenic
907917627 1:58885424-58885446 ACACAGGTGCTTTCTAGAGTTGG - Intergenic
909108526 1:71444313-71444335 GTGCATTTGCATTCTAATGTGGG - Intronic
909784134 1:79588715-79588737 GCGCATGTCCTTTCTCAACCTGG + Intergenic
913372786 1:118119035-118119057 GGGCTTGTGCTTACTAATGTAGG - Intronic
914414676 1:147468900-147468922 GCCAGTGTGCTTTTTAAAGTAGG - Intergenic
915630405 1:157149825-157149847 GTGTATGTGCTTTCTCTAGTAGG - Intergenic
916555037 1:165887117-165887139 GCACATGTGGCTTCTAAAGGTGG + Intronic
917011923 1:170484279-170484301 GCACAAGTGCTTTATAAAGAAGG - Intergenic
917219184 1:172709393-172709415 GCCCATGTGCTTTGTAAATCAGG - Intergenic
1065648455 10:27862069-27862091 GCACATTTGATTTCTAACGTTGG + Intronic
1065903582 10:30228895-30228917 GGGCATGTGCTTACTCAACTTGG - Intergenic
1066587909 10:36958257-36958279 GTGCAAGTGCTTTTTAAACTGGG + Intergenic
1070601151 10:77867262-77867284 GCACATGTGCATTCTAAAAGGGG - Intronic
1070601236 10:77867760-77867782 GCGCATTTGCATTCTAAAAGGGG + Intronic
1074500480 10:114019130-114019152 GCACATTTGCTTTATGAAGTTGG + Intergenic
1078409654 11:11103669-11103691 GAGCATAGGCTTTCTAAAGAAGG + Intergenic
1085900196 11:80689716-80689738 GTGCAAGTGCTTTTTAAACTGGG - Intergenic
1087274095 11:96143151-96143173 GGGTGTGTGTTTTCTAAAGTTGG + Intronic
1089983997 11:122795955-122795977 CTGCATGTGCTTTATAAAATAGG - Intronic
1091626167 12:2122587-2122609 GAGAATGTGCTTTGTAAAGGGGG - Intronic
1101217413 12:102597828-102597850 GTGAATGTGCTTTGTAAACTAGG - Intergenic
1109826903 13:67733423-67733445 GTGCATTTGATTTTTAAAGTTGG + Intergenic
1113419911 13:110163189-110163211 GCCCATGTGGTTTCCTAAGTGGG - Intronic
1113528218 13:110999451-110999473 TCGCATGTTCTTTCATAAGTGGG + Intergenic
1120773157 14:88403675-88403697 GTGTATGTGCAATCTAAAGTGGG + Intronic
1138256666 16:55570280-55570302 GTGCATGTGTTTTTAAAAGTTGG + Intronic
1148667511 17:49385906-49385928 GTGCCTGTGCTTGCTAAATTAGG + Intronic
1149775547 17:59354120-59354142 AGGCAGCTGCTTTCTAAAGTTGG + Intronic
1151753241 17:76054238-76054260 GAGAATGTGCTTTTTAAAGCGGG - Intronic
1158730878 18:60021047-60021069 GGGCAAGTGCATTCTAAAGATGG - Intergenic
1159058986 18:63494814-63494836 GCGCATGGGATTTTTAAGGTAGG + Intronic
1164823007 19:31264555-31264577 GCGGATGTCCTGTCTAAAATGGG + Intergenic
925987401 2:9227254-9227276 GGGCATGTGCTCTGTGAAGTGGG + Intronic
936129084 2:109818713-109818735 TCACCTGTGCTTTTTAAAGTAGG + Intronic
936215613 2:110552772-110552794 TCACCTGTGCTTTTTAAAGTAGG - Intronic
936424750 2:112407345-112407367 TCACCTGTGCTTTTTAAAGTAGG - Intronic
937238387 2:120444215-120444237 GCCCATGTGCTTTCACCAGTGGG - Intergenic
942532540 2:176927405-176927427 GGGAATGTGCTTTGTAAATTGGG - Intergenic
944371647 2:198990882-198990904 GCTCATGTGCTTTCTGAAACAGG + Intergenic
946644538 2:221818688-221818710 GTGAATGTGCTTTCTAGAGTTGG + Intergenic
1169317311 20:4603295-4603317 GTGCATGCGTTTTCTAAAGGTGG + Intergenic
1170333137 20:15237583-15237605 GTGCACGTGCTTTCTATAGGAGG + Intronic
1173512630 20:43642196-43642218 GCACCTGTTCTTTCTAATGTAGG + Intronic
1175668322 20:60879282-60879304 GCGCATTTGCTTTTTAAACCGGG - Intergenic
1177128277 21:17223838-17223860 AGACATGTTCTTTCTAAAGTGGG - Intergenic
1181733976 22:24867719-24867741 GACCATTTGCTTTCTAAAGCAGG - Intronic
956287944 3:67630147-67630169 TCACATTTGCTTTATAAAGTAGG - Intronic
957194883 3:77054839-77054861 GCCCATCTGCTTTCAAATGTTGG - Intronic
957549666 3:81687383-81687405 TTCCATGTGCTTTCAAAAGTTGG - Intronic
959758768 3:109931435-109931457 TGGCATTTGCTTTCTGAAGTGGG + Intergenic
961441550 3:126956343-126956365 GCTCATTTGTTTTCTTAAGTGGG - Intronic
978238810 4:106491783-106491805 GCCCAACTGCTTTTTAAAGTGGG - Intergenic
979082269 4:116359568-116359590 GCTCAGCTGCTTTCCAAAGTTGG - Intergenic
979251950 4:118574884-118574906 GCCCATGTGTTTTCCAAAGAGGG - Intergenic
986782948 5:11083996-11084018 GTGAATGTGATTTCTAATGTAGG - Intronic
987072001 5:14346522-14346544 GCACTTGTGCTTTTTAAAGAAGG + Intronic
989524321 5:42435785-42435807 GTGCATGTGCTTTTTTAATTTGG + Intronic
991308797 5:65211768-65211790 GTGCTTGTCCTTTCTAATGTGGG - Intronic
994601796 5:101914570-101914592 GCCAATGTGCTTTCTGATGTAGG + Intergenic
997522874 5:134534565-134534587 GAGCATCTGCTCTCTAAGGTGGG - Intronic
997907122 5:137829168-137829190 GTGCATGTACTGTCTAAACTTGG + Intergenic
1006111692 6:31750616-31750638 GCGCATGTGCTTTCTAAAGTGGG + Intronic
1016473232 6:144397391-144397413 GAGCATGTGCTTGCTTAAGGAGG + Intronic
1018763319 6:166909339-166909361 GCTCATGTGCTTCCCAAAGCTGG - Intronic
1022616718 7:31939047-31939069 GCGCTTGAGCTTTTTAAATTTGG - Intronic
1031868562 7:127067082-127067104 GCCAACGGGCTTTCTAAAGTAGG + Intronic
1032707812 7:134436890-134436912 CCACATGTGTTTTCTACAGTAGG + Intergenic
1032985259 7:137330461-137330483 GCACATGTGCCTTCTAGATTTGG - Intronic
1034528639 7:151681977-151681999 CCCCATGTGCTTCCTAAGGTGGG + Intronic
1039996492 8:42538880-42538902 GCCTATGTGCTTTTTAAAGATGG - Intronic
1045918701 8:107504211-107504233 ATACATGTGCTTTCTGAAGTTGG - Intergenic
1046688018 8:117248750-117248772 GTGCAAGTGCTTTGTAAATTGGG - Intergenic
1055899213 9:81215234-81215256 GACCATATGCTTTCTAAATTTGG - Intergenic
1187149325 X:16667724-16667746 GCATATGTGCTTTTTAAAATAGG - Exonic