ID: 1006111693

View in Genome Browser
Species Human (GRCh38)
Location 6:31750617-31750639
Sequence CGCATGTGCTTTCTAAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006111688_1006111693 26 Left 1006111688 6:31750568-31750590 CCCAGTACGAGCAGGGCGTGAGT 0: 1
1: 0
2: 0
3: 5
4: 21
Right 1006111693 6:31750617-31750639 CGCATGTGCTTTCTAAAGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1006111690_1006111693 -5 Left 1006111690 6:31750599-31750621 CCTAAGTGTTTAGTGCAGCGCAT 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1006111693 6:31750617-31750639 CGCATGTGCTTTCTAAAGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1006111689_1006111693 25 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111693 6:31750617-31750639 CGCATGTGCTTTCTAAAGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006111693 Original CRISPR CGCATGTGCTTTCTAAAGTG GGG Intronic
900695939 1:4010498-4010520 GGAATCTCCTTTCTAAAGTGTGG - Intergenic
902798622 1:18815665-18815687 AGCATCTGCTTGCTAAAATGAGG + Intergenic
902868707 1:19299063-19299085 TGCCTGTGCTTTCTAAATTTTGG - Intergenic
906581118 1:46935775-46935797 TGCATCTGCTCTGTAAAGTGAGG - Intronic
908140922 1:61183910-61183932 GGGATGTGCTTTCAAAAGAGAGG + Intronic
909108525 1:71444312-71444334 TGCATTTGCATTCTAATGTGGGG - Intronic
912965114 1:114230421-114230443 CTCCTGTGCTTTCCAAGGTGAGG - Intergenic
913546750 1:119876500-119876522 CTCATCTGTTTTCTGAAGTGTGG - Intergenic
913699538 1:121361178-121361200 CTCATGTGCTTTCCAAGTTGGGG - Intronic
914138007 1:144918857-144918879 CTCATGTGCTTTCCAAGTTGGGG + Intronic
916556568 1:165899002-165899024 GGCATGTGCTTTGTGGAGTGCGG + Intronic
919267237 1:195285725-195285747 CTCATGGGCTTTCTACTGTGTGG + Intergenic
920486947 1:206379887-206379909 CTCATGTGCTTTCCAAGTTGGGG - Intronic
921749009 1:218770931-218770953 CGAGTGTGCTTTCTACTGTGTGG - Intergenic
922537593 1:226392607-226392629 AATAAGTGCTTTCTAAAGTGTGG - Intronic
923184893 1:231561351-231561373 GGAATGTTCTTTCTAAAGTATGG + Intronic
924072219 1:240292716-240292738 AGCATATGCTTTTTAAACTGGGG + Intronic
1063806763 10:9653681-9653703 CGGATGTGCTTTATATAGTTTGG + Intergenic
1063983177 10:11472743-11472765 AGAATTTGCTTTCTAAAGTATGG + Intronic
1068386030 10:56328762-56328784 CTCATGTGTTTTCTAATTTGAGG - Intergenic
1085528100 11:77175686-77175708 GGCATGTGCTTTGTAACCTGTGG - Intronic
1092961301 12:13598891-13598913 GCCATGTGCTTTTTAAAGTGAGG + Intronic
1099869505 12:88329015-88329037 AACATGTGCTTTTTAAATTGTGG + Intergenic
1099902684 12:88732010-88732032 CCCATCTGCTTTCAAATGTGTGG + Intergenic
1100223022 12:92526706-92526728 TGCATGTGCATTTTAAAGGGTGG + Intergenic
1104457053 12:128923826-128923848 TGAATCTGCTCTCTAAAGTGAGG - Intronic
1107613343 13:42139260-42139282 CAAATGGGCTTTCTAAAGTAAGG + Intronic
1111798105 13:92949246-92949268 CACATGTTCTTCTTAAAGTGGGG + Intergenic
1116392092 14:44405081-44405103 GGAATGTGCTTACTAAATTGTGG - Intergenic
1116707596 14:48322144-48322166 CGCAGGTGTTCTTTAAAGTGTGG - Intergenic
1117348124 14:54854233-54854255 GGGATGTTCTTTCTAAAGTGTGG - Intronic
1120640446 14:87004932-87004954 GGCATGTGCTTTAGAAACTGTGG - Intergenic
1124163805 15:27299773-27299795 CCCATATCCTTTCTCAAGTGAGG - Intronic
1129059829 15:72851948-72851970 CGCCTGGGCCTTCCAAAGTGCGG - Intergenic
1130721800 15:86394427-86394449 CGTGTGTGCTTTCTAGATTGTGG - Intronic
1134885018 16:17783113-17783135 CGCAGGAGCTTTCTAGATTGTGG - Intergenic
1138111481 16:54327762-54327784 CTCCTGTGCCTTCTAGAGTGAGG + Intergenic
1140427503 16:74873292-74873314 CACTTTTGCCTTCTAAAGTGTGG + Exonic
1142987934 17:3708262-3708284 GCCATGTGCTCTCCAAAGTGGGG - Intergenic
1149317143 17:55449189-55449211 GACATTTGCTTTCTAAAGAGAGG - Intergenic
1149775548 17:59354121-59354143 GGCAGCTGCTTTCTAAAGTTGGG + Intronic
1153702352 18:7709020-7709042 GGAGTGTGCTTTTTAAAGTGAGG - Intronic
1156121922 18:33854841-33854863 CTCCAGTTCTTTCTAAAGTGAGG + Intronic
1156608286 18:38695238-38695260 CTCATGTTCTTTGTGAAGTGAGG + Intergenic
1156735535 18:40253961-40253983 TTCCTGTGCTTTCTATAGTGTGG + Intergenic
1164593047 19:29516625-29516647 CACATGTGCTCTCTGCAGTGGGG + Intergenic
925987402 2:9227255-9227277 GGCATGTGCTCTGTGAAGTGGGG + Intronic
926515277 2:13837285-13837307 CAAATGTGCTTTCCTAAGTGTGG - Intergenic
927519261 2:23689288-23689310 CGCAGGTGCTGTCTAGACTGAGG - Intronic
936129085 2:109818714-109818736 CACCTGTGCTTTTTAAAGTAGGG + Intronic
936215612 2:110552771-110552793 CACCTGTGCTTTTTAAAGTAGGG - Intronic
936424749 2:112407344-112407366 CACCTGTGCTTTTTAAAGTAGGG - Intronic
946602622 2:221368865-221368887 TCCATGTCCTTTCTAAAATGTGG - Intergenic
946644539 2:221818689-221818711 TGAATGTGCTTTCTAGAGTTGGG + Intergenic
948873536 2:240815778-240815800 CCCATGTGGCTTGTAAAGTGAGG - Intronic
1169906814 20:10612786-10612808 CGCATGGGCCTCCCAAAGTGCGG + Intronic
1172309337 20:33905544-33905566 TTCATGTCCTTCCTAAAGTGTGG + Intergenic
1178467677 21:32863173-32863195 AGCACGTGCTTTCTAATCTGGGG + Intergenic
1180108925 21:45638534-45638556 GGCAGGTGCTTGCTAAACTGTGG + Intergenic
1182466062 22:30517026-30517048 TGCATTTGCTGTTTAAAGTGAGG - Intergenic
1183448187 22:37874058-37874080 CTCATGTGCTTTCTGAAAGGAGG + Intronic
951334784 3:21407136-21407158 CGCATGTCCTTACTCATGTGTGG + Intergenic
953461866 3:43087904-43087926 TGCATGTCCTTTCTAAACTCAGG + Intronic
954844913 3:53546901-53546923 AACATGGGCTTTGTAAAGTGAGG + Intronic
956399878 3:68866203-68866225 GGAATGTGCCTTCTACAGTGTGG - Intronic
957575705 3:82005436-82005458 CAAATGAGCTTTCTAAAGAGAGG - Intergenic
959716224 3:109435998-109436020 CTCATGTGCCTTCTTAAGAGTGG + Intergenic
964958295 3:162390475-162390497 TGCATGTGCATTTTAAAGTTAGG - Intergenic
965698432 3:171434878-171434900 TGCATGTTCTTTTTAAAGTGAGG - Intronic
970949651 4:21739173-21739195 CGAATTTGTTTTCTAAACTGAGG + Intronic
980178180 4:129372475-129372497 TGCATGTGCTTGCTTGAGTGAGG + Intergenic
981030002 4:140114753-140114775 GGCATGTGCTTTCTATAATATGG - Intronic
981205458 4:142034803-142034825 CTCCTGTCCTTTCTAAAGTATGG + Intronic
984931435 4:184851027-184851049 CTCTTATGCTTTCCAAAGTGGGG - Intergenic
987570933 5:19657778-19657800 AACATGTGCTTCCTAGAGTGAGG - Intronic
993049005 5:82903633-82903655 AGCATGTGATATCAAAAGTGGGG - Intergenic
994743714 5:103653137-103653159 CGCCTGTGCTTGCTGAAGTCTGG + Intergenic
997198078 5:131992892-131992914 AGCACCTGCTTTCTAAGGTGTGG - Intronic
1003737399 6:8892248-8892270 TGCTTGTGCTTTCTACAGAGAGG - Intergenic
1005478770 6:26234730-26234752 CGCAAGCGCTTTCTTAAGCGCGG + Exonic
1006111693 6:31750617-31750639 CGCATGTGCTTTCTAAAGTGGGG + Intronic
1007571123 6:42891552-42891574 CGCCTCAGCTTTCCAAAGTGCGG + Intergenic
1009833823 6:68971990-68972012 AGCATGTGCTCTCCAAAGGGTGG + Intronic
1012726134 6:102813012-102813034 CACATGTGCTTCCTAATATGAGG - Intergenic
1022166360 7:27766799-27766821 AGCATTCTCTTTCTAAAGTGTGG + Intronic
1022306143 7:29148185-29148207 GGAATTTGCCTTCTAAAGTGTGG + Intronic
1022486048 7:30778551-30778573 GGTATGTGCTTTCTAAGGTGTGG + Exonic
1023297618 7:38732107-38732129 CGCATGTGCCATATGAAGTGTGG + Intronic
1024540388 7:50471082-50471104 TGCAGGTGTTTTTTAAAGTGTGG + Intronic
1025093919 7:56083430-56083452 CGCATGATCTTTCTAGGGTGGGG + Exonic
1025535080 7:61937555-61937577 TGCAACTGCTTTCTAATGTGTGG + Intergenic
1026215438 7:68344259-68344281 CGCCTTTGCATTCCAAAGTGCGG - Intergenic
1026281618 7:68927469-68927491 GGCATGTGCTCTTTCAAGTGGGG - Intergenic
1036161376 8:6391777-6391799 AGCATTTTCTTTCTGAAGTGCGG + Intergenic
1037729418 8:21511391-21511413 AGCCTGGGCTTTCTACAGTGTGG + Intergenic
1039740376 8:40377441-40377463 TGAATGTGCTTTCAAAAGTTAGG + Intergenic
1039897381 8:41725755-41725777 CGGACGTGCTTTCCAAGGTGAGG - Exonic
1041730606 8:61058522-61058544 GGCATGTACTTTTTAAATTGAGG + Intronic
1042015005 8:64299232-64299254 AGCAGGTGCTTTGTAAAGAGAGG - Intergenic
1044411425 8:91888067-91888089 CGCATGTGCTTGCAAATGTCTGG - Intergenic
1048622311 8:136147420-136147442 CTCATGTCCTTTGTAGAGTGAGG + Intergenic
1048847504 8:138614797-138614819 CACATGTGCTTTCTTAGCTGTGG - Intronic
1050993954 9:12189947-12189969 AGTATGTGTTTTCTAAAGTGTGG - Intergenic
1052073601 9:24113225-24113247 CGAATATGCTTAATAAAGTGGGG - Intergenic
1057297053 9:93852890-93852912 CTCATGTTGTTTTTAAAGTGAGG + Intergenic
1057750001 9:97784955-97784977 AGCATGTGCCTTCTGATGTGAGG + Intergenic
1062318782 9:135980516-135980538 CCCATATGCTGTCTAAAGAGGGG - Intergenic
1189708817 X:43787470-43787492 AACTTGTGCTTTCCAAAGTGGGG + Intronic
1191152413 X:57233892-57233914 CGCCTCTGCCTCCTAAAGTGAGG + Intergenic
1197056002 X:122119734-122119756 CTGATGAGCTTTCTAAAATGTGG + Intergenic
1197608742 X:128614992-128615014 CATATGTGCTTTATAAACTGTGG + Intergenic