ID: 1006111694

View in Genome Browser
Species Human (GRCh38)
Location 6:31750621-31750643
Sequence TGTGCTTTCTAAAGTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006111689_1006111694 29 Left 1006111689 6:31750569-31750591 CCAGTACGAGCAGGGCGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1006111694 6:31750621-31750643 TGTGCTTTCTAAAGTGGGGATGG 0: 1
1: 0
2: 1
3: 27
4: 247
1006111688_1006111694 30 Left 1006111688 6:31750568-31750590 CCCAGTACGAGCAGGGCGTGAGT 0: 1
1: 0
2: 0
3: 5
4: 21
Right 1006111694 6:31750621-31750643 TGTGCTTTCTAAAGTGGGGATGG 0: 1
1: 0
2: 1
3: 27
4: 247
1006111690_1006111694 -1 Left 1006111690 6:31750599-31750621 CCTAAGTGTTTAGTGCAGCGCAT 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1006111694 6:31750621-31750643 TGTGCTTTCTAAAGTGGGGATGG 0: 1
1: 0
2: 1
3: 27
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006111694 Original CRISPR TGTGCTTTCTAAAGTGGGGA TGG Intronic
900421866 1:2559263-2559285 GGTGCTTTCACAAGAGGGGAGGG - Intronic
900530076 1:3148783-3148805 TGTGCTAAGTAAAGTGGGGATGG - Intronic
900695938 1:4010494-4010516 TCTCCTTTCTAAAGTGTGGCCGG - Intergenic
901728551 1:11261784-11261806 TGTGCGTCCGAAAGGGGGGAAGG + Intronic
903178959 1:21595996-21596018 TGTTCTTCCTGCAGTGGGGAAGG + Intergenic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906280102 1:44547205-44547227 TGTGTTTTTTAAAATGGGGAAGG - Intronic
906694884 1:47817268-47817290 TGTGCTTTCTCAAAAGAGGATGG + Intronic
907858181 1:58324524-58324546 TATGCTTGCTCAACTGGGGATGG - Intronic
907974149 1:59414655-59414677 TTGGCTATCTAAAGTGGGGCTGG + Intronic
908314297 1:62917750-62917772 TGTCCTTTCTAAAATATGGAAGG + Intergenic
908343917 1:63211721-63211743 GGTGGTGTCTACAGTGGGGAGGG - Intergenic
908382151 1:63606899-63606921 GTTCCTTTCTAAAGTGGGGTTGG - Intronic
909002004 1:70229196-70229218 TGTGATTTTTATAGTGGAGAAGG + Intronic
909470271 1:76020056-76020078 TCTGCTTTGTTAAGAGGGGAAGG + Intergenic
911818198 1:102382079-102382101 TTTTCTTTCTAATCTGGGGATGG - Intergenic
912965111 1:114230417-114230439 TGTGCTTTCCAAGGTGAGGGTGG - Intergenic
913699536 1:121361174-121361196 TGTGCTTTCCAAGTTGGGGGTGG - Intronic
914138009 1:144918861-144918883 TGTGCTTTCCAAGTTGGGGGTGG + Intronic
915520493 1:156439632-156439654 TGTGCTCTCTCAAGAGGAGAGGG + Intergenic
915670209 1:157482706-157482728 TGTGATTTATTATGTGGGGATGG - Intergenic
915921372 1:159978174-159978196 TGTTCCTCCTGAAGTGGGGAGGG - Intergenic
916646654 1:166793275-166793297 TGTTGTTTTTAATGTGGGGATGG + Intergenic
916865781 1:168856641-168856663 TGTGATTTCAATAGTGGGGAAGG + Intergenic
920104446 1:203541407-203541429 TTTAGTCTCTAAAGTGGGGAAGG + Intergenic
920486945 1:206379883-206379905 TGTGCTTTCCAAGTTGGGGGTGG - Intronic
920534239 1:206727314-206727336 CTTCCTTTGTAAAGTGGGGATGG - Intronic
920962853 1:210679693-210679715 TCCTCTTTCAAAAGTGGGGAGGG - Exonic
921598282 1:217078912-217078934 TGTTCTTTAGAAACTGGGGATGG + Intronic
922537591 1:226392603-226392625 AGTGCTTTCTAAAGTGTGGGAGG - Intronic
922677915 1:227563949-227563971 TGTGCTTTGTCCAGAGGGGAGGG + Intronic
924797098 1:247300414-247300436 TGTGCTCTCTATCCTGGGGAAGG + Exonic
924855066 1:247867873-247867895 TGTGCTTTCTGAATTGGTGAAGG + Intronic
1063521870 10:6748606-6748628 TCTGGTATCTAAAGTGGGGACGG - Intergenic
1065907509 10:30271344-30271366 TTTGCTTTAAAAAGTGGGGTGGG - Intergenic
1067141288 10:43659318-43659340 TTTGTTTTTTAAAGTGGAGATGG + Intergenic
1068801863 10:61150250-61150272 TGTGCTGTTTGAAGTGAGGATGG + Intergenic
1068933361 10:62613440-62613462 TGTTCTTTTTGAATTGGGGATGG + Intronic
1069737222 10:70664722-70664744 TGTGGTTTCAGAAGAGGGGATGG + Intergenic
1071389848 10:85162076-85162098 TGGCCTTTCTGAAGTGGGTAAGG - Intergenic
1072556617 10:96520733-96520755 TGTACCGTGTAAAGTGGGGATGG - Exonic
1072948936 10:99835677-99835699 TGGGGTGTGTAAAGTGGGGATGG - Intronic
1074493678 10:113960312-113960334 AGTGCTTTCCAAAGTGCTGAGGG - Intergenic
1074547459 10:114412385-114412407 TGTGCTTTCTGGAGTGGGAGAGG - Intergenic
1074705644 10:116127565-116127587 TGTGCTTGTTAAAGCCGGGATGG - Intronic
1075157327 10:119989126-119989148 GCTGCTTTCTAAACAGGGGAAGG - Intergenic
1076144977 10:128111115-128111137 TGTGTAATTTAAAGTGGGGATGG - Intronic
1079677755 11:23252315-23252337 TATGATTTCTAAAGAGGTGATGG + Intergenic
1081279848 11:41195549-41195571 TGTGCTTTATAATTTGGGGGGGG - Intronic
1081340372 11:41920390-41920412 TGTCCCTCCTAAAGTGAGGAAGG - Intergenic
1083332860 11:61907084-61907106 TCTGCTTTGTAAAGTGGGGCTGG + Intronic
1083640492 11:64142714-64142736 CGGGCTTTCTAATGTGGGGAGGG + Intronic
1084851904 11:71948567-71948589 TGTGCTTTCTGATGAGGGGTGGG + Intronic
1085369649 11:75988893-75988915 TGTTTTTTGGAAAGTGGGGAAGG + Intronic
1085376684 11:76069168-76069190 TGTGCTTTCAAAACTTGGGCTGG - Intronic
1086602681 11:88654098-88654120 TGTGCCATCAAAAGTGGTGAAGG + Intronic
1087802933 11:102523542-102523564 TAGGCTTTCAAAAGTGGAGAGGG + Intronic
1088762434 11:112944877-112944899 TGTGTGTTTTAAAGTAGGGAGGG + Intergenic
1089269395 11:117291152-117291174 TGAAATATCTAAAGTGGGGAGGG + Intronic
1089463142 11:118664753-118664775 TTTGCTGTCTACAGTGGGGGAGG + Intronic
1089794548 11:120969745-120969767 GGAGCTTTCTAAAGTGGAAATGG + Intronic
1089838105 11:121389791-121389813 TGTGCATTCTTAAGTGGCGGAGG - Intergenic
1089983995 11:122795950-122795972 TGTGCTTTATAAAATAGGAAGGG - Intronic
1090424318 11:126596479-126596501 TGTCCCTTCTGAAGGGGGGAAGG + Intronic
1091320178 11:134643863-134643885 TGTGCCGTCTAAAGTCAGGAAGG - Intergenic
1093165691 12:15802819-15802841 TGTGCTTTAGAAAGTGTGTAAGG + Intronic
1095370138 12:41457355-41457377 GGTGCTTTGTAAAGTGGGATGGG + Intronic
1095599736 12:44001322-44001344 TGTACTTTCTCCAGAGGGGAGGG - Intronic
1095601047 12:44013558-44013580 TGTACTTTCAGCAGTGGGGAAGG - Intronic
1095913407 12:47451712-47451734 AGTGCTTTGAAATGTGGGGAAGG - Intergenic
1096385978 12:51195835-51195857 GGCGCTTCCTAAAGTGGGGGAGG - Intronic
1096982793 12:55737995-55738017 AGGGCTTTCTAAGGAGGGGAGGG - Intergenic
1096993958 12:55827621-55827643 TGGGCTTTCTACAGTTGGGATGG - Exonic
1099144044 12:79016465-79016487 TGTTATTTATAAATTGGGGAGGG + Intronic
1099472279 12:83066087-83066109 TGTACAATCTAATGTGGGGAGGG + Intronic
1100394557 12:94173562-94173584 TTTCATTTATAAAGTGGGGATGG - Intronic
1100513472 12:95301396-95301418 TCTGCTTGCTAAATTGGGGGTGG - Exonic
1101114807 12:101521705-101521727 TGGGTTTTCCAAAGTGGGCAAGG - Intergenic
1101236352 12:102794014-102794036 TGTGCTTTCTGGAGTGCGGAAGG + Intergenic
1101461324 12:104897916-104897938 AGTTTTTTCTAAAGTGGAGAGGG + Intronic
1102513374 12:113430478-113430500 TCTGCTTTGGAATGTGGGGAAGG + Intronic
1104370475 12:128219769-128219791 TGGGCTTTCCACAGTGGGCAGGG + Intergenic
1104968981 12:132522710-132522732 TGTGCTTCCTGGGGTGGGGAAGG - Intronic
1105842314 13:24265503-24265525 TGCACTTTCTAAAGTTGGGATGG - Intronic
1107519330 13:41163596-41163618 TGTGTTTTGTAAAGGGAGGAGGG - Intergenic
1108292372 13:48975132-48975154 TGTCCTTTCAAAAATGGTGATGG - Intergenic
1110297227 13:73882068-73882090 TGTATTTTCAAATGTGGGGAAGG - Intronic
1112727533 13:102321676-102321698 TGTGTTTTCTAAACTTGGGTAGG + Intronic
1113384520 13:109836436-109836458 TGCTCTTTATAATGTGGGGAAGG - Intergenic
1114169243 14:20255039-20255061 TGTGATAACTAAAGGGGGGAGGG - Intergenic
1114904694 14:27112324-27112346 GGTGATTACTAAAGTGGGGAGGG - Intergenic
1115245842 14:31294171-31294193 TTTGCTTTTTAAAGTAGTGAAGG + Intronic
1115881937 14:37929060-37929082 TGTGCTTCTTAAATTTGGGAAGG - Intronic
1118171412 14:63392974-63392996 TATGCTTTTTAAAGTGATGAAGG + Intronic
1119077820 14:71661537-71661559 TCTGCATTCTAAAGTGGCAATGG + Intronic
1120251955 14:82069135-82069157 TGTGGTTGCTAAAGTAGGGAGGG - Intergenic
1121681438 14:95795863-95795885 TCTGGTTCATAAAGTGGGGAGGG - Intergenic
1122461428 14:101898743-101898765 TCTGCTTTCTAAAGCCAGGACGG - Intronic
1123787915 15:23690867-23690889 GCTGCTTTCCAAAGTTGGGAGGG + Intergenic
1126754020 15:51906845-51906867 TGTACTTTTTAAAGTAGAGACGG - Intronic
1127284020 15:57517046-57517068 AGTGATTTCAAAAGTGGGGAAGG + Intronic
1127397908 15:58557867-58557889 AGTTCTTTCCAAAGTGGGGGAGG - Intronic
1127545550 15:59991765-59991787 TTTACTTTTTAAAGAGGGGAAGG + Intergenic
1127546491 15:59998155-59998177 TTTTTTTTTTAAAGTGGGGAGGG - Intergenic
1127704298 15:61532019-61532041 TTAGCTTTGTAAAGTGGAGAGGG - Intergenic
1128034818 15:64515552-64515574 TCTTCTTTTTAAAGGGGGGAGGG + Intronic
1129092261 15:73163842-73163864 TGTACTATCTGTAGTGGGGAGGG - Intronic
1133341919 16:5042168-5042190 TGTGCTTCCTGAATTGGGGATGG - Intronic
1133572894 16:7059206-7059228 TGGGCTTTAAAAAGTGGAGAGGG - Intronic
1133624629 16:7559629-7559651 TGTGCTTTCCAAGGTGGATATGG + Intronic
1134255847 16:12610654-12610676 TGTTCTTTATAAAGTGGGGGAGG + Intergenic
1136285610 16:29238820-29238842 TGTGTTTTCCACAGTGGGGTGGG - Intergenic
1137284361 16:47002896-47002918 TGTGTTTTTTTAAGTAGGGATGG - Intergenic
1142090943 16:88208996-88209018 TGTGGTTTCCACAGTGGGGTGGG - Intergenic
1142400031 16:89853801-89853823 TGTACTTTGTGAACTGGGGAAGG - Intronic
1144212567 17:13027624-13027646 GGTGCTGTCTGAAGTGGGGATGG - Intergenic
1146421276 17:32688175-32688197 CGTGCTTTCTTGAGTGGGCAAGG - Intronic
1148264300 17:46212831-46212853 TGTGCTGTCGAAGGTGGTGAGGG - Intronic
1153940878 18:9975652-9975674 TGTGCTTCCTAAACTGTGGTTGG + Intergenic
1155190199 18:23422816-23422838 TGTGCTTTCTGCATTGGGGGGGG - Intronic
1156614753 18:38770197-38770219 TGTGCTACCTAAAGAGGGGAGGG - Intergenic
1163413416 19:17171218-17171240 TGTATTTTCAAAAGTGGGGCCGG + Intronic
1164564049 19:29313316-29313338 TGTGTTTTGTGGAGTGGGGATGG + Intergenic
1167845173 19:52157048-52157070 TGTGTTTTCTCAAGTTGGGTGGG + Exonic
926136698 2:10341644-10341666 GGGCCTTTCTAAAGTGGGGAGGG + Intronic
926160746 2:10487660-10487682 TCTGCTTACCAAAGTGGGCAAGG - Intergenic
926813537 2:16778183-16778205 TTTTCTTGGTAAAGTGGGGATGG - Intergenic
927378193 2:22443607-22443629 TGTGTATTCTAAATTTGGGATGG + Intergenic
928284795 2:29980374-29980396 TGTGCTTTATAAAGGGAGCAGGG - Intergenic
930381787 2:50639014-50639036 TGTGTTTTCCAAAGTTTGGATGG - Intronic
930737011 2:54789558-54789580 TGTGCTTTCCAAAGTAGACATGG + Intronic
933297582 2:80508019-80508041 TGTCTTTTCTAAAGTGGCAAAGG - Intronic
934043096 2:88146398-88146420 TGTGTTTTTTAATTTGGGGAAGG - Intergenic
935813068 2:106818342-106818364 TGAGCTGCCTAGAGTGGGGAAGG - Intronic
937197479 2:120172475-120172497 TGTGCTTTCTGAATTCTGGAGGG + Intronic
937453752 2:122023889-122023911 CGTGCTTTTTAAAGTTTGGAAGG - Intergenic
938218975 2:129549320-129549342 AGTGCTTTCTATAGGGAGGATGG - Intergenic
938841718 2:135171186-135171208 TGTGGTATCTAGAGTGGGAAGGG + Intronic
940757585 2:157700173-157700195 TGTGATTTCTTCAGTGGGCAAGG - Intergenic
941894489 2:170615424-170615446 AGAGCTTTCTAAAGAGGGAATGG + Intronic
941921216 2:170852824-170852846 TGTGCTTTCTAAAGAACGTACGG - Intronic
942023190 2:171887009-171887031 TGTGTTTCCAAAAGTGTGGAAGG - Intronic
944981133 2:205121347-205121369 TGTGCTTTCTAAATTAGAGAAGG + Intronic
945547930 2:211181200-211181222 TGTGCTTTCCTACGTGAGGAAGG - Intergenic
947273894 2:228370052-228370074 GGTGCTTTCTAAAGAGGTAAAGG + Intergenic
947392190 2:229650876-229650898 AGTGCTTTCTATAGAGTGGATGG + Intronic
948293518 2:236844747-236844769 TCAGTTTTCTAAAGTGGAGAAGG - Intergenic
948614189 2:239187779-239187801 TGTGCTTGTTAAAGTGGACAGGG + Intronic
1169533824 20:6514981-6515003 TATGCTAGCTAAAGTGGGGATGG - Intergenic
1170368562 20:15623468-15623490 GGAGGTTTGTAAAGTGGGGATGG + Intronic
1170620101 20:17988794-17988816 AGTGCTTTTTTAAGTGGGAAAGG - Intronic
1170630487 20:18060585-18060607 GGGGATTTCAAAAGTGGGGAGGG + Intergenic
1171538293 20:25918957-25918979 TGTGCTTTCTGTTGTGGGGTGGG - Intergenic
1171722938 20:28583158-28583180 TGTGATACGTAAAGTGGGGAAGG - Intergenic
1171787537 20:29482593-29482615 TGTGATACGTAAAGTGGGGAAGG - Intergenic
1174168970 20:48604589-48604611 TGTGGTCCTTAAAGTGGGGACGG - Intergenic
1175061242 20:56245363-56245385 TGTGCTTTTGAGAGTGGGGAAGG + Intergenic
1175669474 20:60889706-60889728 TTTGCTTTCTATAGTCGGGAGGG + Intergenic
1177725022 21:24955991-24956013 TGTGTTCTCTAAAGAGGGTAGGG - Intergenic
1177792895 21:25739271-25739293 AGCCCTTTCTAAAGTGGGAAGGG + Intronic
1179144189 21:38752822-38752844 CCTCCTATCTAAAGTGGGGATGG + Intergenic
1179285673 21:39975632-39975654 TGTGCTCTCTAAAGAGTTGATGG + Intergenic
1180296495 22:10941828-10941850 TGTGATACGTAAAGTGGGGAAGG - Intergenic
1181034779 22:20164669-20164691 TGTGCATTGTGGAGTGGGGAGGG + Intergenic
1181509038 22:23380690-23380712 TGCGCATTGTAGAGTGGGGAGGG - Intergenic
1182846271 22:33433786-33433808 TGTGTTTTCTTAAGTGCGGATGG - Intronic
1183089279 22:35510380-35510402 TGTGCTTCCTAAGGAGGTGAAGG - Intergenic
949437411 3:4044356-4044378 TGTGGTTTGGAAAGTGGTGATGG - Intronic
950013479 3:9740210-9740232 TGTGGTTTGTTAAGTTGGGATGG + Intronic
952273442 3:31854734-31854756 TGTTTATTTTAAAGTGGGGAAGG - Intronic
952646519 3:35665689-35665711 TGTGCTTTTGAAAATGAGGATGG - Intronic
953242677 3:41163505-41163527 TTTGCTTTCTAAAGTGAGCTGGG - Intergenic
955879568 3:63529367-63529389 TGTTATTTCTAAATTGGGGTGGG + Intronic
955953707 3:64267284-64267306 TGTTCTTTCTGAATTGGGGTAGG - Intronic
956112602 3:65884748-65884770 TGGGCCTCCCAAAGTGGGGATGG - Intronic
956567743 3:70658521-70658543 TGTGTTTTCTTAATTGGGAAGGG - Intergenic
959602292 3:108201079-108201101 TCTGCTTTCTTATCTGGGGATGG - Intronic
960649161 3:119926932-119926954 AGTCATTTATAAAGTGGGGAAGG - Intronic
961109807 3:124274326-124274348 TCTGCCTTCTGATGTGGGGAAGG + Intronic
963700408 3:148618730-148618752 TGTGCATCCTAAGGTGGGCAAGG + Intergenic
963910525 3:150813793-150813815 TCTGAATTCCAAAGTGGGGAGGG + Intergenic
965096117 3:164228196-164228218 TGTAGTTTCTAGAGTGTGGAGGG + Intergenic
965238866 3:166166348-166166370 TTTTCTTTCTATAGTGGGAATGG + Intergenic
967895820 3:194395866-194395888 TGTACTTTTTAAAGTAGAGACGG - Exonic
969095096 4:4726826-4726848 TGTGCTTTGGAAGGTCGGGAAGG + Intergenic
970385508 4:15552462-15552484 TGTGCTTTGGAGAGTGGAGAGGG - Intronic
971181362 4:24331161-24331183 TGTGCTGGGCAAAGTGGGGATGG - Intergenic
973925584 4:55734295-55734317 TGTGATTTTTAAAGTGGAGCTGG - Intergenic
974141367 4:57892146-57892168 TTAGCTTTCTAAAGTGCAGAAGG + Intergenic
977247354 4:94648790-94648812 TGAACTGTCTAAGGTGGGGACGG - Intronic
978455250 4:108882122-108882144 TGAGCTTTTTGAAGTTGGGAGGG - Intronic
980176537 4:129352709-129352731 TTTGCTTTCTTATGTGGAGAGGG + Intergenic
980631025 4:135433823-135433845 TGTGCTTTCAGAAGTTGGGTGGG - Intergenic
985438596 4:189960678-189960700 TGTGATACGTAAAGTGGGGAAGG + Intronic
986363823 5:7009119-7009141 TGTGGTTTTTGAAGTGGGGCTGG + Intergenic
988987441 5:36634476-36634498 AGTGCTTTCCAAAGTGGGATAGG - Intronic
989166405 5:38437245-38437267 TTTTGTTTCTTAAGTGGGGAAGG + Intronic
989262352 5:39432434-39432456 TGTGCATTCCAAAGTTGGGTTGG - Intronic
990538960 5:56753131-56753153 TGGGCTTTGCAAAGAGGGGAGGG + Intergenic
990843852 5:60114380-60114402 TGTGCTTTCTAAAGTTTTAATGG + Intronic
993049003 5:82903629-82903651 TGTGATATCAAAAGTGGGGGAGG - Intergenic
995925740 5:117370786-117370808 TGTGTTTTCTGAGGTAGGGATGG - Intergenic
995991318 5:118243260-118243282 TGTGATTTCAACAGAGGGGAAGG - Intergenic
996152195 5:120052959-120052981 TGTCATTTCTAAAGAGGGTATGG - Intergenic
1001753454 5:174148510-174148532 TGTGATTTATAAAGGGGAGAAGG - Intronic
1004573803 6:16873271-16873293 TATGCTTTCTAAAGGGGAGAGGG + Intergenic
1006030234 6:31172326-31172348 TGTGCTTTGTTTAGTGGGGCTGG + Intronic
1006062938 6:31439141-31439163 TGTGTTTGTTAAAATGGGGAGGG + Intergenic
1006111694 6:31750621-31750643 TGTGCTTTCTAAAGTGGGGATGG + Intronic
1006622012 6:35371994-35372016 TGTGGTTTCTAAGGTGGGTCTGG + Intronic
1012876496 6:104734747-104734769 TGTACTATTTAAAGTGGAGAAGG + Intronic
1013970561 6:116013156-116013178 TGTGCTTTCTTCACTGGGGGAGG + Intronic
1014812503 6:125902486-125902508 TTTTTTTTTTAAAGTGGGGATGG + Intronic
1015142070 6:129946575-129946597 TGTGCTATATAAAGTCGGCAGGG + Intergenic
1016541426 6:145170323-145170345 TGTGCTTTCTGGAGTGGGGAGGG - Intergenic
1018068675 6:160142084-160142106 AGTGCTTTCTACAATGGGCACGG + Intronic
1018537145 6:164833164-164833186 TGTGTTTTCTCATGTGGGAATGG - Intergenic
1020440844 7:8215088-8215110 TGTTCTTTGTAAGGTGGAGAAGG - Intronic
1020555168 7:9661969-9661991 TGTGCTGTCTATAGTGGAGGTGG + Intergenic
1020838380 7:13183376-13183398 TCTGCTTTCTAAAGAAGGGAGGG - Intergenic
1022004154 7:26251750-26251772 TGTGCTTTCTGATGTGTGGCAGG + Intergenic
1022941181 7:35241268-35241290 TGTCCTTTCTAAAATGGTAAGGG + Intronic
1024736454 7:52310023-52310045 TGAGCTTTTTGAATTGGGGATGG - Intergenic
1028517160 7:91690719-91690741 TGTGCTCTCTAGAATGGGGCAGG - Intergenic
1028550413 7:92055709-92055731 TGTGCTTTCTAAAATAGAGGGGG + Intronic
1028999071 7:97134091-97134113 TGAGCTTTGGAAAGGGGGGAGGG - Intronic
1029080640 7:97971613-97971635 TGTGTTTTCTGAGGTGGGGACGG - Intergenic
1029870831 7:103691026-103691048 TGTGCTTTTTGAATTGGGGTTGG - Intronic
1030206413 7:106956623-106956645 TGTGATTGCAAAAGTGGGCAAGG - Intergenic
1033094590 7:138419413-138419435 TGGGGTTTATATAGTGGGGAAGG - Intergenic
1033170713 7:139081285-139081307 TGTGCTTTTTTGTGTGGGGAAGG + Intronic
1035112688 7:156496389-156496411 CTTGCTTTCTACAGTGGGGCTGG - Intergenic
1035854868 8:2964028-2964050 TATAATTTCTAGAGTGGGGAAGG - Intronic
1036006075 8:4664848-4664870 TGTGTTTTATAAAGTTTGGATGG - Intronic
1038375706 8:27038289-27038311 TGTGCTTACTATACTTGGGAAGG - Intergenic
1039037561 8:33376285-33376307 TATGCTTTCTAAATTTGGAATGG - Intronic
1040071522 8:43192514-43192536 TGTGTTTTCTTAAATGGGCATGG - Intronic
1041768920 8:61451781-61451803 TGTGTTTTGTACAGAGGGGAAGG - Intronic
1042072156 8:64948386-64948408 TGTGCTTTCTCAAATTTGGAAGG - Intergenic
1043623617 8:82228077-82228099 TGTGCTTTCCTAAGTGGGTTAGG - Intergenic
1046715342 8:117560952-117560974 TGTTCATTCAACAGTGGGGAGGG - Intergenic
1047463514 8:125091390-125091412 GGTGCTTCCTAAAGCGAGGAAGG + Intronic
1048380846 8:133863526-133863548 TGTGCTTTCTGATTTGTGGAGGG + Intergenic
1050929232 9:11303033-11303055 TGTGCCTTGTGCAGTGGGGATGG + Intergenic
1051802668 9:20953865-20953887 TTTCCTTTCTAAAATTGGGATGG - Intronic
1051842144 9:21410654-21410676 TTTCCTTTCTTAAGTGTGGAAGG - Intronic
1051855679 9:21561013-21561035 TGTGTTTTTTAAAGTGGCTAAGG - Intergenic
1053747600 9:41215949-41215971 TGTGATACGTAAAGTGGGGAAGG + Intergenic
1054338783 9:63834575-63834597 TGTGATACGTAAAGTGGGGAAGG - Intergenic
1054479683 9:65649420-65649442 TGTGATACGTAAAGTGGGGAAGG - Intergenic
1054778570 9:69145213-69145235 TGTGCTTTGACAAGTGAGGAAGG - Intronic
1055010923 9:71564201-71564223 TGGGCTTTCCAGAGTGTGGAGGG - Intergenic
1055197029 9:73608177-73608199 TCTGCTTTCTAAAGCCAGGAGGG - Intergenic
1055455552 9:76468228-76468250 TGTGGTTTCTAAGGTGGATAAGG + Intronic
1055471166 9:76612555-76612577 TGGGCTTTCAAAAGTGGAGGTGG + Exonic
1055899209 9:81215229-81215251 TATGCTTTCTAAATTTGGGGTGG - Intergenic
1057768339 9:97943386-97943408 TTTGCTTTCCTAAGTGGAGAAGG + Intronic
1058843695 9:108934666-108934688 AGTGCCTTCTGACGTGGGGACGG - Intronic
1059478257 9:114566717-114566739 TGTGCCTTCTTAAGGGGAGAAGG + Intergenic
1060406391 9:123375122-123375144 GATGCTTGCTGAAGTGGGGATGG + Intronic
1061783519 9:133009323-133009345 TTTGCTTTTTAAAAAGGGGATGG + Intergenic
1062202373 9:135310314-135310336 TGTGCCTTCTAAAGGGAGGCTGG + Intergenic
1202783734 9_KI270718v1_random:26720-26742 TGTGATACGTAAAGTGGGGAAGG + Intergenic
1186307405 X:8277366-8277388 TCAGATGTCTAAAGTGGGGAAGG - Intergenic
1187562548 X:20416276-20416298 TTTTCCTCCTAAAGTGGGGATGG + Intergenic
1188206619 X:27367250-27367272 TGTGTTTTGGCAAGTGGGGATGG - Intergenic
1188835053 X:34945115-34945137 TGGGCCTCCCAAAGTGGGGAGGG - Intergenic
1189040781 X:37540713-37540735 TGGGCCTCCCAAAGTGGGGAGGG + Intronic
1191963115 X:66725591-66725613 TGGGATTTCTATATTGGGGATGG + Intergenic
1192784827 X:74325508-74325530 TGAGCTCTCTAAAAGGGGGAGGG + Intergenic
1192803797 X:74492811-74492833 TGAGCTCTCTAAAAGGGGGAGGG - Intronic
1195563471 X:106313227-106313249 TGGGACTTCAAAAGTGGGGAGGG - Intergenic
1195766852 X:108305343-108305365 TTTGTTTTCTGAAGTGAGGAGGG + Intronic
1196892984 X:120308619-120308641 AGAACTGTCTAAAGTGGGGAGGG - Intronic
1198306780 X:135391465-135391487 AGTGGTTTGTAAAGGGGGGAGGG - Intergenic
1198500446 X:137239549-137239571 TTTGCTTTTCAAAGTGTGGATGG - Intergenic