ID: 1006114184

View in Genome Browser
Species Human (GRCh38)
Location 6:31766492-31766514
Sequence GCTGAGGGGCAGCCCTGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 1, 2: 1, 3: 56, 4: 422}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006114172_1006114184 21 Left 1006114172 6:31766448-31766470 CCCCTGGCGTCTCACCTCCAGAA 0: 1
1: 0
2: 2
3: 21
4: 175
Right 1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG 0: 1
1: 1
2: 1
3: 56
4: 422
1006114171_1006114184 30 Left 1006114171 6:31766439-31766461 CCGCACTTTCCCCTGGCGTCTCA 0: 1
1: 0
2: 0
3: 19
4: 220
Right 1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG 0: 1
1: 1
2: 1
3: 56
4: 422
1006114173_1006114184 20 Left 1006114173 6:31766449-31766471 CCCTGGCGTCTCACCTCCAGAAG 0: 1
1: 0
2: 2
3: 15
4: 148
Right 1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG 0: 1
1: 1
2: 1
3: 56
4: 422
1006114178_1006114184 7 Left 1006114178 6:31766462-31766484 CCTCCAGAAGGACAGGGACTACA 0: 1
1: 1
2: 4
3: 113
4: 2787
Right 1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG 0: 1
1: 1
2: 1
3: 56
4: 422
1006114179_1006114184 4 Left 1006114179 6:31766465-31766487 CCAGAAGGACAGGGACTACAGTG 0: 1
1: 0
2: 0
3: 20
4: 362
Right 1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG 0: 1
1: 1
2: 1
3: 56
4: 422
1006114174_1006114184 19 Left 1006114174 6:31766450-31766472 CCTGGCGTCTCACCTCCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG 0: 1
1: 1
2: 1
3: 56
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006114184 Original CRISPR GCTGAGGGGCAGCCCTGTGC AGG Exonic
900090133 1:916627-916649 GCTGAGAGCCGGCCCTGAGCCGG + Intergenic
900370212 1:2328905-2328927 GCAGAGGGGCCTCCCTGGGCGGG - Intronic
900431950 1:2606728-2606750 GAGGAGGGGCACCCCTCTGCAGG + Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900809788 1:4793281-4793303 GTTAGGGGGCTGCCCTGTGCTGG - Intergenic
900934708 1:5758071-5758093 TCCGAGGGGCAGCCCTGGGCAGG - Intergenic
901325185 1:8361165-8361187 GCCGTGGGGGAGCCCTGTGGGGG + Exonic
901431258 1:9216403-9216425 CCTGTGGGGCATCCCTTTGCTGG - Intergenic
901866568 1:12110409-12110431 GCAGAGGGCCTGCCTTGTGCCGG + Intronic
902399436 1:16150077-16150099 GCTGGGGTGTAGCCCTGAGCAGG - Intronic
902646690 1:17804534-17804556 GGTCAGGGGCAGCCATTTGCTGG - Intronic
902698898 1:18158234-18158256 GCTGAGGGTGAGTCCTGTGCAGG - Intronic
902731702 1:18374058-18374080 GCTGAAGGGCATCCCGGTCCTGG - Intronic
902934467 1:19754827-19754849 GCTGTGTGCCAGCCCTGGGCCGG + Intronic
904329291 1:29747451-29747473 GGAGATGGGCAGCCCTGGGCAGG - Intergenic
904371191 1:30048488-30048510 GCAGATGGGCAGCCCTGGGCAGG - Intergenic
904378261 1:30095210-30095232 GCTGAGTGGTAGGGCTGTGCTGG + Intergenic
904689328 1:32282111-32282133 GCTGAGGGGCTTCCCTGCCCTGG + Intronic
904770190 1:32876818-32876840 GCTGAGGTGGCGCCCTCTGCTGG - Intergenic
904812847 1:33174839-33174861 ACAGAGGGCCAGCCCTGTGTTGG - Intronic
905232129 1:36521186-36521208 GCTGAGTGACAGCCCCGTGCTGG + Intergenic
905527301 1:38648674-38648696 GCTGAGGGGCAGTTCACTGCCGG + Intergenic
905810465 1:40909008-40909030 TCTGATGGTCAGCCCTGTGCTGG + Intergenic
905920165 1:41714038-41714060 GCTGCTGAGCAGCCCTGGGCAGG - Intronic
906231928 1:44171657-44171679 GCTGAGTGGCAGCTCAGTCCTGG - Intergenic
906846385 1:49197539-49197561 GCTGAGGTGCCGGCCTGGGCGGG + Intronic
907251565 1:53143013-53143035 GCTGCGGGCCAGGCCTGTGCTGG + Intergenic
907850524 1:58250558-58250580 GCTGAGGGGCTCCCCTATTCGGG - Intronic
910371723 1:86523810-86523832 GCTGAAGGGCTAACCTGTGCAGG - Intergenic
911496594 1:98638405-98638427 GGTGAGGCCCAGCACTGTGCTGG + Intergenic
912475157 1:109930128-109930150 GCTGAGATGCAGCCCAGTCCAGG - Exonic
913298536 1:117345801-117345823 GCTGAGGGGCAGCTCTGACTGGG + Intergenic
915091346 1:153428529-153428551 GGTGAGAGGCAGCCCTGAGAAGG + Intergenic
915093766 1:153444759-153444781 GGTGAGAGGCAGCCCTGAGATGG - Intergenic
918340034 1:183560713-183560735 CCTGCTGTGCAGCCCTGTGCTGG + Intronic
919756447 1:201069104-201069126 GCTGTGGGGCAGCCCTGGGGAGG - Intronic
919802778 1:201363544-201363566 CCTGTGGGCCAGCACTGTGCTGG - Intronic
920078767 1:203356730-203356752 GCAGAGGGGCTGCCATGTGATGG + Intergenic
920344699 1:205298743-205298765 GGTGAGGGGAAGGGCTGTGCAGG + Intergenic
920759568 1:208769382-208769404 GCTGAGGGGCATTACTCTGCAGG + Intergenic
922025160 1:221742796-221742818 GCTGAAGGGCCTCCCTGTCCGGG - Intergenic
922090639 1:222392065-222392087 TCTGAAGGGCAGGGCTGTGCAGG + Intergenic
922699511 1:227750625-227750647 GCTGAGGGGTGTCCCTGGGCTGG + Intronic
922878522 1:228960804-228960826 GCCGAGGGGCAGCTCTGGGCTGG - Intergenic
924412378 1:243819611-243819633 GCGGAGGGGATGCACTGTGCTGG - Intronic
924658815 1:245997597-245997619 GGTGAGAGGCAGTGCTGTGCAGG + Intronic
1063607241 10:7533454-7533476 GATGAAGGGCAGCACTGAGCGGG - Intergenic
1065811588 10:29448350-29448372 GCTGAGAGGCAGCCCCGTGCTGG + Intergenic
1066162210 10:32746219-32746241 GATGCTTGGCAGCCCTGTGCAGG - Intronic
1066369908 10:34811766-34811788 GCTGAGCTGCAGCGCTGTGTGGG - Intronic
1067042949 10:42966485-42966507 GCTGAGGGTCGGCTCTGAGCAGG - Intergenic
1067088761 10:43256070-43256092 GCCTAGGGGGAGCACTGTGCAGG + Intronic
1067742422 10:48905700-48905722 GCCGAGGGTCAGCACTCTGCGGG - Intronic
1069076295 10:64041737-64041759 CCTGGGGAGTAGCCCTGTGCTGG - Intergenic
1070253703 10:74795997-74796019 GGTGAGGGGCAGACATGTGGTGG - Intergenic
1070411934 10:76149918-76149940 GATGAGGGGAAGCCCTGGGAGGG + Intronic
1071491782 10:86141133-86141155 ACTTTGGGGGAGCCCTGTGCTGG - Intronic
1071600348 10:86955902-86955924 GCTGATGGGCAGCCCTGCAGGGG - Intronic
1072227913 10:93387268-93387290 GCAGAGGGGCATCCATGAGCTGG + Intronic
1072234093 10:93438424-93438446 ACCGAGGCGCAGCCCTTTGCGGG - Intronic
1072433679 10:95396291-95396313 GCTGAGAGCCAGCCCTTGGCAGG - Intronic
1075858911 10:125656872-125656894 GCTGGGGGGCAGCTCAGTGCTGG - Intronic
1076124477 10:127963067-127963089 TCTGAGGAGCAGGCCTGTGGAGG + Intronic
1076307211 10:129473910-129473932 GCAGAGGGCCAGCCATGTCCCGG + Intronic
1076540121 10:131208363-131208385 GCTGAGGAGCAGCCATGTTAAGG - Intronic
1076797572 10:132805673-132805695 GCTGGGGGGCAGCCCCCAGCCGG + Intergenic
1077153550 11:1081828-1081850 GATGAGAGGCAGCCCTGGCCTGG + Intergenic
1077264807 11:1643217-1643239 GCTGCGGGGCAGCCCCGACCTGG + Intergenic
1077407619 11:2389643-2389665 GCTGAGCGACAGCGCTGGGCCGG + Intronic
1077478679 11:2802963-2802985 GCTGAGGGGTTGCCCTGTGGTGG - Intronic
1077746779 11:4915588-4915610 GCTGAGTGGCATCCCTGGGCTGG - Exonic
1078715843 11:13838362-13838384 GGTGAGGGGCTGGCCTCTGCAGG - Intergenic
1083296120 11:61716555-61716577 GCTGAGGGTGGGCTCTGTGCTGG + Intronic
1083405673 11:62455345-62455367 GCTGACTGGCAGCGCAGTGCTGG + Intronic
1083593239 11:63907295-63907317 CCTGTGGGGCAGCCCCCTGCTGG - Intronic
1083826734 11:65208153-65208175 TGTGAGGGGCAGCCCTCTCCTGG + Intronic
1084112399 11:67022786-67022808 GCTGTAGGTCAGCTCTGTGCTGG - Intronic
1085258167 11:75188879-75188901 CCTGAAGGTCAGGCCTGTGCTGG + Intronic
1085276566 11:75303829-75303851 ACTCAGGAGCAGCCATGTGCAGG - Intronic
1085690671 11:78661420-78661442 GAGGAGTGGCAGCCTTGTGCAGG + Intronic
1086550446 11:88046922-88046944 GCTGAAGTGCAGGGCTGTGCAGG + Intergenic
1087619792 11:100528447-100528469 GGTGTGTGGTAGCCCTGTGCTGG - Intergenic
1089134298 11:116237028-116237050 GTTGATGGGCAGCACGGTGCAGG + Intergenic
1089391187 11:118103046-118103068 GCTGAGGGTCAGGCTTGAGCAGG - Intronic
1091201768 11:133786049-133786071 GCTGAGCTGCAGAGCTGTGCTGG + Intergenic
1091306501 11:134539534-134539556 GCTGAGTGCCCGCACTGTGCTGG - Intergenic
1091635819 12:2195782-2195804 GCTGAGGGGAAGCCCCTTCCCGG - Intronic
1091701330 12:2665326-2665348 GCTGCTGGGCAGGGCTGTGCAGG - Intronic
1091999421 12:5020185-5020207 GCTGGCGAGCAGGCCTGTGCTGG - Intergenic
1093340421 12:17967115-17967137 GCAGAGGGGTTGCACTGTGCTGG + Intergenic
1096419085 12:51440824-51440846 GGTGAGGGGCAGCCTGGTGTGGG + Intronic
1096472877 12:51890019-51890041 GCAGTGGGGCTGCCCTCTGCTGG + Intronic
1096486100 12:51982407-51982429 GCTGTGGGCCAGACCTCTGCTGG + Intronic
1097156579 12:57016386-57016408 CCTGTGGAGCAGCTCTGTGCCGG + Exonic
1099640793 12:85280697-85280719 GCTCAGAGGCAACCCGGTGCTGG - Intronic
1101186857 12:102289544-102289566 GCAGAGGGGGTGCGCTGTGCTGG + Intergenic
1101340855 12:103841044-103841066 GCTCGGGGGCGGCCGTGTGCGGG - Exonic
1102506862 12:113389298-113389320 GGTGAGGGGCAGGCCTGGGGTGG - Exonic
1102594687 12:113983464-113983486 CCTCAGGCACAGCCCTGTGCTGG - Intergenic
1103000911 12:117384744-117384766 GCAGAGGGGCTGCCTTGGGCAGG + Intronic
1103899400 12:124295506-124295528 GCTGGGGGGCAGCCCGGAGTCGG - Intronic
1104578049 12:129986384-129986406 GCTGTAGGGAAGCCCTGTGTAGG + Intergenic
1104637728 12:130448513-130448535 GCACAGGGGCAGCGCTGGGCTGG - Intronic
1104638825 12:130454430-130454452 GCTGTGGGGCAGCTCTCTGGAGG + Intronic
1104654109 12:130560386-130560408 GCTGTGGGGCTGTCTTGTGCAGG + Intronic
1104955946 12:132465902-132465924 GCTGAAGGGCAGTCCGGTGAGGG - Intergenic
1105410507 13:20167852-20167874 GTTGGGGGGCAGCCCTGACCTGG - Intergenic
1106391105 13:29336652-29336674 GCTGAGCTCCAGCGCTGTGCTGG + Intronic
1106618328 13:31350834-31350856 GCTGAGCGGCAGTCCTGGGGTGG + Intergenic
1106911019 13:34463782-34463804 TGTGAGGGGCAGCTCTGAGCAGG - Intergenic
1107459379 13:40586750-40586772 ACAGAGGGGCAGTCTTGTGCAGG - Intronic
1112368300 13:98773985-98774007 GCTGCGGGGCAGCTCAGTGCTGG - Intergenic
1112793565 13:103029929-103029951 TCTGAGTGCCAGCCTTGTGCTGG + Intergenic
1113467041 13:110520081-110520103 GCTGGGGGGGAGCCGTGTGCTGG + Intergenic
1113467169 13:110520494-110520516 ACTGGGGGGCACCCGTGTGCTGG + Intergenic
1113551910 13:111199168-111199190 GCTGATGGGCATCACTGGGCTGG + Intronic
1113905945 13:113819250-113819272 CCTGAGGGGCAGCCTCGGGCCGG - Intergenic
1118332402 14:64824598-64824620 GCTGTGAGGCAGACCTGTGATGG + Intronic
1119372744 14:74161647-74161669 GCTGAGGTTCAGCCCTCTGAAGG + Intronic
1121111660 14:91317066-91317088 GAAGAGGGGCAGCCCTTTGGGGG - Intronic
1121731334 14:96189255-96189277 GGTGGGTGGCAGCTCTGTGCTGG + Intergenic
1122138483 14:99648063-99648085 GTTAGGAGGCAGCCCTGTGCTGG + Intronic
1122264821 14:100541662-100541684 GCTCAGTGGCAGACCTGGGCTGG - Intronic
1122307037 14:100772907-100772929 GGGGAGGGGCAGCCCTGGTCAGG + Intergenic
1122312124 14:100804064-100804086 ACTGAGGGGCAGCCCAGAGATGG - Intergenic
1122401319 14:101469210-101469232 GGTGAGGGGGAGCATTGTGCTGG + Intergenic
1123112964 14:105881645-105881667 GTTGAGGGACACCCCTGTCCAGG - Intergenic
1124410185 15:29430445-29430467 GCTATGGGCCAGGCCTGTGCTGG - Intronic
1124725104 15:32149303-32149325 AGTGCTGGGCAGCCCTGTGCTGG - Intronic
1125031503 15:35080479-35080501 GCTGAGTGGCTGCTCGGTGCTGG - Intergenic
1125199994 15:37095139-37095161 GGTGAGGGGCAGGCCAGCGCAGG - Intronic
1127499935 15:59546027-59546049 GCTCAGGGGATGCCCTGTCCAGG + Intergenic
1128633906 15:69290882-69290904 GCTGTGGGGCAGCTCAGGGCAGG - Intergenic
1129167008 15:73784437-73784459 GGTGGGGGCCAGCCCTGGGCTGG + Intergenic
1131108096 15:89748077-89748099 GCGGAGGAGAAGCCCTCTGCAGG + Intergenic
1131564999 15:93477931-93477953 GGTGAGGGGCCTCCCTCTGCAGG + Intergenic
1131830246 15:96349985-96350007 GCCCAGGAGCAGCCGTGTGCAGG - Intergenic
1132251125 15:100336176-100336198 GCTGGTGGGCAGCCTGGTGCAGG + Intronic
1132498155 16:273588-273610 GCGGAGGGGCTGCTGTGTGCAGG - Intronic
1133230012 16:4361950-4361972 ACTGAGGGGCAGCCCTGGTGGGG + Intronic
1133328612 16:4957755-4957777 GCTGGGGGTCAGCCCTGTCCAGG - Intronic
1134874512 16:17685109-17685131 GGTGAGGGGCAGTGATGTGCTGG + Intergenic
1135091923 16:19524172-19524194 GCTGAGGGCGGGCTCTGTGCTGG + Intronic
1135425906 16:22335766-22335788 TGTGAGGGCCAGCCCAGTGCTGG - Intergenic
1135742366 16:24986901-24986923 GCGGAGGCACAGCCCAGTGCTGG + Intronic
1136035752 16:27538704-27538726 GGTGAGGGGCAGAGCTGTGGAGG - Intronic
1136054760 16:27680191-27680213 CCTGAGGGGCTGCAATGTGCTGG - Intronic
1136076445 16:27820501-27820523 GCTGTGGGGGAGCCTTGTGAAGG - Intronic
1138534805 16:57654133-57654155 GGTCAGGGGCAGGCCTGGGCAGG + Exonic
1138549793 16:57741113-57741135 TCTGAGCCGAAGCCCTGTGCAGG + Intronic
1139504388 16:67391828-67391850 GCTGAGGGGCTGGGCTGGGCTGG + Exonic
1139966467 16:70748261-70748283 GCTGTGGGCTAGTCCTGTGCTGG + Intronic
1141836047 16:86540326-86540348 CCTGAGGGTCAGCACTGTGGGGG - Intronic
1141903264 16:87006545-87006567 GCTGCTGGGCAGCTCTGTGCTGG + Intergenic
1141933148 16:87218263-87218285 GCTGAGGGTCAGGTCTGTGCTGG - Intronic
1141933263 16:87218630-87218652 GCTGGGGGTCAGGTCTGTGCTGG - Intronic
1141933289 16:87218721-87218743 GCTGGGGGTCAGGTCTGTGCTGG - Intronic
1141950475 16:87336084-87336106 GCTGGGGACCAGCCCTGTCCCGG - Intronic
1141950588 16:87336633-87336655 GCTGAGGGGCTGTGCTGTGCAGG - Intronic
1142009808 16:87708117-87708139 GCCGAGGGGGAGGCCCGTGCAGG + Intronic
1142302202 16:89265342-89265364 CCTGAGGGGGAACCCTGTGTCGG + Intergenic
1142429639 16:90019261-90019283 GCTGCGGGGAAGCGCTGCGCGGG + Intronic
1142496288 17:307739-307761 GCTGAAGGTCAGCAGTGTGCTGG + Intronic
1143521500 17:7446796-7446818 GCTGAGGGGCTGCCCCGGGTTGG - Intronic
1143565412 17:7717611-7717633 CCTGAGGGGTAGACCTGGGCGGG + Exonic
1143632731 17:8148090-8148112 GCAGGGGGGCAGCCCTGAACGGG + Exonic
1144671907 17:17137673-17137695 GCTGAGAGGCAGCCAGCTGCAGG + Intronic
1144738543 17:17568459-17568481 GCTCTGGGGCAGCTCTGTGCCGG - Intronic
1145060616 17:19731023-19731045 GCTGTGGGCCAGCCCTGCCCAGG - Intergenic
1145878235 17:28335774-28335796 GCTGAGGGGCAGGCGGCTGCAGG + Exonic
1145907096 17:28522234-28522256 GCTGAGGGTCTGCTCTGGGCTGG - Intronic
1146233175 17:31131420-31131442 GGTGCGTGGTAGCCCTGTGCAGG + Intronic
1146629818 17:34461917-34461939 GCCGAGGGCCAGCCCTATGTGGG + Intergenic
1147219971 17:38922799-38922821 GCTGATTGGCAGCACTGAGCAGG - Intergenic
1147264392 17:39225900-39225922 GCGGAGGGGCCGCCGGGTGCCGG - Intergenic
1147772517 17:42877808-42877830 CATGAGGGGCAGCCCTGGTCCGG - Intergenic
1148212599 17:45817477-45817499 GATGAGGGGCAACAATGTGCTGG - Intronic
1148680777 17:49472404-49472426 GCTGAGGGGCAGAGCTGTGGTGG + Intronic
1150858102 17:68772579-68772601 GCTGAGGTGATGCCCTGGGCAGG - Intergenic
1151469534 17:74309506-74309528 TCTGTGGGGGAGCCGTGTGCAGG + Intronic
1151569903 17:74921011-74921033 GCTCTGGGCCAGCTCTGTGCTGG - Intronic
1151710112 17:75799615-75799637 GCTGTGGGTCAGCTCTGTGCAGG + Intronic
1152278897 17:79373690-79373712 GTTGAGGGGGAGCTCTGTCCAGG - Intronic
1152500460 17:80705122-80705144 CCTGTGGGCCAGCCCTGTCCTGG + Intronic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1152736714 17:82000855-82000877 GCTGCCCTGCAGCCCTGTGCTGG + Intronic
1152861863 17:82701032-82701054 CCTGAGGGACAGTCCTGTGGTGG + Intergenic
1155232062 18:23783550-23783572 GCTGTGGGGAAGGCCAGTGCCGG + Intronic
1155252371 18:23964739-23964761 GCTGCGGGGCAGGGCTGTGCAGG + Intergenic
1155990437 18:32274033-32274055 GGTGAGGGGCAGCCCACGGCAGG + Intronic
1157814619 18:50721815-50721837 GCAGTGGGGCAGCACTGGGCTGG - Intronic
1159023424 18:63161694-63161716 GTTGATGGGAACCCCTGTGCTGG - Intronic
1160517862 18:79488423-79488445 TCTGAGGGACAGCCCTGGGGAGG - Intronic
1161042030 19:2115426-2115448 GCTGAGTGGCTGCCCGCTGCCGG - Intronic
1161321888 19:3645244-3645266 TCTGTGGGCCAGGCCTGTGCAGG + Intronic
1161343063 19:3753184-3753206 GGGGAGGGGCAGCCCTGGGCTGG + Intronic
1161582804 19:5090143-5090165 GCTGAGCGCCTGCCGTGTGCAGG + Intronic
1161583444 19:5092828-5092850 GCTGAGGAACAGCCATGAGCCGG - Intronic
1161595882 19:5150780-5150802 GTTCAGAGGCCGCCCTGTGCAGG - Intronic
1161678599 19:5667450-5667472 GGTGAGGAGCAGCTCTGGGCTGG + Exonic
1161681995 19:5684769-5684791 GCTGTGGGCCAGGCCTGTGCCGG + Intronic
1161950190 19:7463567-7463589 GCTGTGGGGCAGCCATGGGGAGG - Intronic
1162825423 19:13248440-13248462 GCAGAGGGGAAGCTCAGTGCTGG + Intronic
1162934241 19:13973178-13973200 GCCGAGGGGCATGACTGTGCAGG + Intronic
1163251012 19:16126320-16126342 GCTGGGGTGCAGCCCTGCACTGG - Intronic
1163404896 19:17116117-17116139 GCTGATGTTCAGCCCTGTGAGGG - Intronic
1163678164 19:18665852-18665874 GCTGAGCGGCACACCTGGGCTGG - Intronic
1164560624 19:29289550-29289572 GCTGACGGACAGCCCAGGGCAGG + Intergenic
1164593139 19:29517105-29517127 GCATAGAGCCAGCCCTGTGCTGG + Intergenic
1164670601 19:30070109-30070131 GCTGAGGAGGCGCCCTGTGCTGG - Intergenic
1164808526 19:31138024-31138046 GCTGAGTGGCTGCTCTGTGGAGG + Intergenic
1165136895 19:33675215-33675237 GCTGAGGGGATGCTCTGTGCTGG - Intronic
1165482345 19:36072047-36072069 GCTAAGTGCCAGCCCTGGGCTGG + Intronic
1165490199 19:36118964-36118986 GCTGTGGGTCAGGCCTCTGCTGG + Intronic
1166764027 19:45241934-45241956 CCTGAGTGTCTGCCCTGTGCTGG - Intronic
1166841227 19:45698495-45698517 GCTGAGGGCTAGTCCTGAGCTGG + Intronic
1167698125 19:51026653-51026675 GCAGGGGGGCGGCCCTGGGCGGG + Intronic
1167749333 19:51370508-51370530 CCTGAGGGGCAGCCAGGAGCAGG - Intergenic
1168639321 19:58020268-58020290 GAGGAGGGGCTGACCTGTGCAGG + Intergenic
925925080 2:8664433-8664455 GCTGAGCATCAGCCATGTGCAGG + Intergenic
926075306 2:9938077-9938099 ACTGTGGGGCAGCCCTGCACGGG - Intergenic
926508644 2:13745802-13745824 GCAGAGCTGCAGCACTGTGCTGG - Intergenic
927146828 2:20171718-20171740 GCAGAGGGGCAGACCTGCCCAGG + Intergenic
927949771 2:27159513-27159535 GCTGACAGGCAGCCCTGTGGGGG - Intergenic
929536261 2:42786243-42786265 GATGAGGGGCAGGCCTGGCCTGG + Intronic
929921202 2:46172755-46172777 CCAGAGGGGATGCCCTGTGCTGG + Intronic
930313676 2:49772151-49772173 GTTCAGGGGCAGCCATGGGCAGG + Intergenic
932492252 2:72129988-72130010 GCTGAGGGGGGTCCCTGTGAGGG - Exonic
932696919 2:73964697-73964719 GCTGAGGGGCAGCTCTCTGGTGG - Intergenic
934524204 2:95041524-95041546 GCTTAGTGGCAGCCGGGTGCTGG + Intronic
934582664 2:95457711-95457733 GTTGAGGACCAGCCCTGTGCTGG + Intergenic
934596786 2:95619003-95619025 GTTGAGGACCAGCCCTGTGCTGG - Intergenic
935024236 2:99261150-99261172 GCTGAGGTGCAGCTCTGCGGGGG + Intronic
935099731 2:99982042-99982064 GCTGAGGAAGAGCCCTGTGCAGG - Intronic
936188922 2:110324814-110324836 CCTGAGGGGCAGGGCAGTGCTGG - Intergenic
937233993 2:120419392-120419414 GCTGAGGGCAACCCCTGAGCTGG - Intergenic
938105995 2:128530212-128530234 TCTGAGGGGCAGCCCAGTGTGGG + Intergenic
938402564 2:131005369-131005391 GCTGGAGGGCAGCCCTGTGTGGG - Intronic
938790417 2:134671127-134671149 GCTGAGGGCCAGCTCACTGCTGG - Intronic
940406669 2:153311663-153311685 GCTATGAGGCAGCCCTGTGGAGG - Intergenic
940918378 2:159282766-159282788 GCCTAGTGGCAGCCCTGTGAGGG - Exonic
942244990 2:173999489-173999511 GCTTGGAGGCAGCCCAGTGCTGG + Intergenic
943203576 2:184860935-184860957 GCTGTGGGCCAGCCTTGTGCTGG + Intronic
946162889 2:217846842-217846864 GCTGAGGACCAGCCCTGTATGGG - Intronic
946188471 2:217994831-217994853 GCTGAGGGGCAGGAATGTCCTGG - Intronic
948604882 2:239128795-239128817 GCAGAGGGTCAGGCCTGGGCAGG - Intronic
948608217 2:239149637-239149659 GCAGCGGGGCTGCCCTGAGCAGG - Intronic
948712487 2:239833677-239833699 GCAGAGGGGCAGCAATGAGCAGG + Intergenic
948832842 2:240606685-240606707 GCTGAGGGTCAGCCAAGGGCAGG + Intronic
948869601 2:240791563-240791585 GATGGGGGCCAGGCCTGTGCGGG - Intronic
948893303 2:240917201-240917223 GCTGAGTGGCTGCCCTTTGCAGG + Intergenic
1168916261 20:1490901-1490923 GGTGAGGCTCAGCCCTGGGCCGG - Intronic
1169131229 20:3167254-3167276 ACTGAGGGGCAGAGCGGTGCCGG - Intronic
1169139487 20:3218858-3218880 GCTGAGGGGTGCCCCTGGGCAGG + Intronic
1169218215 20:3805403-3805425 GATTAGGGGCAGCCCTGGCCCGG - Exonic
1170217894 20:13910668-13910690 GCTGAGTGCCAACCCAGTGCCGG - Intronic
1170567763 20:17616442-17616464 GCTCAGGAGCAGCTCTGGGCAGG - Intronic
1170864548 20:20141931-20141953 GAGGAGGGGCAGCCATGAGCAGG + Intronic
1171035968 20:21713304-21713326 GCAGAGGGGCCGCTCTGTCCTGG + Intronic
1171305501 20:24102483-24102505 GTTGAGGAGCTGCCCTCTGCTGG - Intergenic
1171418435 20:24999735-24999757 CCTGAGAGGCAGCTCTGGGCTGG + Intergenic
1172385287 20:34529896-34529918 GATCAGGGGCAGCCCTGAGCAGG - Intronic
1173769990 20:45647961-45647983 TATGAGGGCCAGCCCAGTGCTGG + Intergenic
1174565488 20:51461650-51461672 GATGTGGGGGAACCCTGTGCCGG - Intronic
1175147932 20:56910853-56910875 ACCAAGGGTCAGCCCTGTGCAGG - Intergenic
1175267614 20:57711928-57711950 GCTGAGCTGCAACCCTGAGCCGG + Intergenic
1175309911 20:58004628-58004650 CCTGAGGAGTAGCCATGTGCTGG - Intergenic
1175529233 20:59662755-59662777 GCTGGGGGCCAGTCCTGGGCTGG + Intronic
1175726247 20:61320650-61320672 GCTGGGAGGCAGCCCTGGGTAGG - Intronic
1175801608 20:61804228-61804250 GGTGAGGGGCTGGCCTCTGCAGG + Intronic
1175829097 20:61952315-61952337 GCTGAGGGGTAGCCCTTGGGTGG - Intergenic
1176059085 20:63164350-63164372 GCTGGGGGCCAGCCCAGGGCAGG + Intergenic
1176450634 21:6858604-6858626 GCTCAGGCGCTGCCCTGCGCCGG + Intergenic
1176828804 21:13723622-13723644 GCTCAGGCGCTGCCCTGCGCCGG + Intergenic
1178881800 21:36455769-36455791 GTTCAGGGACAGCCCTGAGCTGG - Intergenic
1179933898 21:44590722-44590744 CCTGGGGGGCAGCCATGAGCTGG + Intronic
1180070363 21:45432814-45432836 TCTGTGAGCCAGCCCTGTGCAGG + Intronic
1180162446 21:46004269-46004291 TCTGAGGCTCAGCCCTGAGCTGG + Exonic
1180855514 22:19042470-19042492 GGTGAGGGACAGCCCTTTCCTGG + Intronic
1181001870 22:19991620-19991642 CCTGAGGGGCAACACTGGGCTGG - Intronic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181465245 22:23107376-23107398 GCAGCTGAGCAGCCCTGTGCGGG + Intronic
1181500780 22:23314476-23314498 GCAGAGGGGCTGGGCTGTGCTGG - Intronic
1181639756 22:24190324-24190346 GCTGAGGGTCAGCCCCTTGGCGG + Intergenic
1182390170 22:29987275-29987297 GCTGACTGGCAGCTCTGTGGTGG + Intronic
1182548515 22:31089158-31089180 GGTGAGGGGCAGCCCTGGGACGG - Intronic
1182789300 22:32935978-32936000 ACTGAGTCTCAGCCCTGTGCTGG - Intronic
1183205703 22:36417523-36417545 GCTGAGTGCCTGCCATGTGCCGG + Intergenic
1183215028 22:36473936-36473958 CCTGAGGGCCAGCCATGTGCAGG - Intronic
1183521724 22:38299500-38299522 GCTGTGGGGCAGCCCAGTGTGGG + Intronic
1184387561 22:44185063-44185085 GCTGAGAGCCTGCCCTGTGCTGG + Intronic
1184406870 22:44305391-44305413 GCTGAGGGCCAGCCCTGGCCAGG - Intronic
1184714668 22:46274069-46274091 GGTGAGGGGCCTCCCTGGGCTGG + Exonic
1185196304 22:49472083-49472105 CCTGATGGGCATCTCTGTGCAGG + Intronic
1185227372 22:49660620-49660642 CCTGTGGGGCTGCGCTGTGCAGG - Intergenic
1185377922 22:50490740-50490762 GTGGAGGGGCTGCTCTGTGCGGG - Intergenic
1203292813 22_KI270736v1_random:11671-11693 GCTGTGGGACAGGCCTGTCCTGG - Intergenic
950009829 3:9715168-9715190 GCTGCAGGGCAGCCTAGTGCTGG - Intronic
950031992 3:9859679-9859701 CCCGAGGGTCAGCCCTGGGCAGG + Intergenic
950032569 3:9862431-9862453 CCTGAGGGTCAGCCCCGGGCAGG + Intergenic
950053892 3:10010783-10010805 CCTGAGGGTCAGCCCGGGGCAGG + Intronic
950558313 3:13708090-13708112 ACTGAGGGGAATCCCTGTGTAGG + Intergenic
950560233 3:13717046-13717068 TGTGAGGGGCAGCCCTGCCCTGG + Intergenic
950582370 3:13870949-13870971 GCTGAGAGGCAGCAATGGGCAGG - Intronic
952223620 3:31351088-31351110 CCTGAGGAGCAGCACTGTGTGGG - Intergenic
953024383 3:39136526-39136548 GTTGAGGGGCAGCTGTGTGCAGG + Intronic
953658123 3:44870340-44870362 GGTGAGGGGCTACCCTGTGAGGG - Intronic
954637107 3:52076969-52076991 GCAGAGGGGCAGCACTGTCTGGG + Intronic
954963734 3:54591404-54591426 GCTGAGAGGCAGGCCTTTGCTGG + Intronic
956454272 3:69405485-69405507 CATGACTGGCAGCCCTGTGCAGG + Intronic
957840404 3:85661225-85661247 CCTGAGTGGCAGTGCTGTGCAGG + Intronic
960575111 3:119221461-119221483 GCTGAGTGTCTGCCCCGTGCTGG - Intronic
961646553 3:128395732-128395754 ACTGAGGCTCAGCCCTCTGCTGG - Intronic
961671755 3:128537349-128537371 GCTGAGGAGCAGCCCAGGGCTGG + Intergenic
961712160 3:128836029-128836051 CCTGAAGGTCAGCCCTGGGCAGG - Intergenic
961785290 3:129343755-129343777 TCTGAGGGTCAGCCCCGAGCAGG + Intergenic
962102163 3:132354133-132354155 TCTGATGGGCAGACTTGTGCCGG - Intronic
963140442 3:141942254-141942276 GCTGAGGGGCTGCTATGTTCCGG + Intergenic
963515404 3:146301850-146301872 GGTGAGGCCCAGCACTGTGCTGG + Intergenic
966862133 3:184236441-184236463 GCCGAGGGTAGGCCCTGTGCTGG - Exonic
967558685 3:190892777-190892799 GCTGAGGGGAGGGGCTGTGCTGG + Intergenic
968154417 3:196367671-196367693 CCTGAGGGGCAGCTCTGGGAGGG - Intronic
968285365 3:197505479-197505501 TCTGAGGGGCAGCCCTGTGCCGG - Intergenic
968656857 4:1782425-1782447 GGGGTGGGGCAGCCCTGAGCTGG + Intergenic
969214105 4:5709080-5709102 GCTGTGGGTCAGCCCTGGGCCGG + Intronic
969469828 4:7381296-7381318 TCTCACTGGCAGCCCTGTGCTGG - Intronic
969613965 4:8241740-8241762 GCTGAGGGGCAGCCCAGAAAAGG - Intronic
974062008 4:57043833-57043855 GGTGAGGCCCAGCCCTTTGCAGG - Intronic
976084903 4:81397817-81397839 GCTGAGTGCCTGCCTTGTGCTGG + Intergenic
976184693 4:82431596-82431618 GCTGAGGTGCAGACAAGTGCTGG - Intronic
976521040 4:86027050-86027072 GCTCTAGGGCAGCCATGTGCTGG - Intronic
977810218 4:101348105-101348127 GGTGAGAGGCAGCCCTGAGAGGG + Intronic
980092352 4:128455767-128455789 GCTGGGGGACAGCCCTGCACAGG - Intergenic
985005937 4:185535470-185535492 GCGGAGTGGCTGCCCTGCGCGGG - Exonic
985529076 5:423295-423317 GTTGAGAGCAAGCCCTGTGCAGG - Intronic
985532887 5:443992-444014 GCCGAGGGGAACACCTGTGCTGG - Intronic
985669589 5:1200653-1200675 TGTGGGGGGCAGTCCTGTGCCGG - Intergenic
985694980 5:1335139-1335161 GGTGAGGGGCAGCTCGGTGGTGG + Exonic
985945165 5:3176822-3176844 CATTAGGGGCAGCCCTGTGAAGG + Intergenic
986002932 5:3644273-3644295 GCTGAGGGGCGGCCTTTTTCTGG - Intergenic
986402939 5:7396581-7396603 GCCGAGGGGCAGCCCGGAGCGGG - Intronic
987061788 5:14250355-14250377 GGTGAGGGACAGCCCTGGCCAGG - Intronic
987710398 5:21496387-21496409 GGTGAGGGGATGCCCAGTGCTGG + Intergenic
990059678 5:51631787-51631809 GCTGTGGGGCAGAGCTGTGCTGG - Intergenic
990381688 5:55226437-55226459 GGTGAGGGGAAGCATTGTGCAGG - Intronic
991530094 5:67605275-67605297 GTTGTGGGGCTGTCCTGTGCAGG - Intergenic
991737467 5:69640979-69641001 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
991760726 5:69915446-69915468 GGTGAGGGGATGCCCAGTGCTGG + Intergenic
991786605 5:70202655-70202677 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
991789043 5:70220705-70220727 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
991813793 5:70495811-70495833 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
991816923 5:70517095-70517117 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
991839956 5:70790497-70790519 GGTGAGGGGATGCCCAGTGCTGG + Intergenic
991879049 5:71203040-71203062 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
991881489 5:71221069-71221091 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
992473489 5:77080444-77080466 TTGGAGGGGCAGCGCTGTGCTGG - Intronic
994410828 5:99405136-99405158 GCTAAAGGGAAGCCCTGTCCTGG + Intergenic
994422348 5:99536494-99536516 GGTGAGGGGATGCCCAGTGCTGG + Intergenic
994460025 5:100061046-100061068 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
994483005 5:100360149-100360171 GCTAAAGGGAAGCCCTGTCCTGG - Intergenic
995409905 5:111845016-111845038 TCTGAGGGCCAGCCTAGTGCTGG + Intronic
996747032 5:126854584-126854606 GCTGAGCGGGAGCCTAGTGCAGG + Intergenic
996954362 5:129164866-129164888 GGTGTGTGGTAGCCCTGTGCAGG + Intergenic
997242498 5:132318130-132318152 ACAGAGGGGAAGCCCTGAGCAGG + Intronic
997660828 5:135588433-135588455 GCTGAGTGCCTGCTCTGTGCCGG + Intergenic
1001954949 5:175842724-175842746 CCAGAGGCGCAGGCCTGTGCTGG - Intronic
1002175227 5:177397841-177397863 GCGGATGGGCAGGCGTGTGCAGG - Exonic
1003218563 6:4136223-4136245 CCCGAGGGCCAGCCCTGAGCCGG + Intergenic
1003397424 6:5765188-5765210 CCAGAGGGGCAGCCCCGTGTGGG - Intronic
1004308595 6:14523594-14523616 GTGGAAGGGCAGCCCTGTGGAGG - Intergenic
1004999817 6:21229636-21229658 GCGGAGGGGCAGCCCAGAGGCGG - Intronic
1005547296 6:26884130-26884152 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG + Exonic
1006145819 6:31959038-31959060 GCGGAGGGGCAGACCTGGACCGG - Exonic
1006364706 6:33608539-33608561 GCTGTGTGCCACCCCTGTGCGGG - Intergenic
1006429849 6:33988771-33988793 ACTGAGGGGCAGGGCTGTGGGGG + Intergenic
1007399932 6:41597845-41597867 GCTGAGGGGCAGCAGGCTGCTGG - Exonic
1007779855 6:44246539-44246561 GCTGAGGGGCAGCTCAGCGTAGG - Intronic
1008074464 6:47131471-47131493 GCTGAGGGGCAGCAATGGGGTGG - Intergenic
1009018055 6:57925203-57925225 GGTGAGGGGATGCCCAGTGCTGG - Intergenic
1017084095 6:150697557-150697579 GCTGAGGGCCGGCCCTGGGAGGG + Intronic
1018299536 6:162386586-162386608 CCTGAGGGCCAGCCCAGTGCTGG - Intronic
1018428883 6:163708044-163708066 GCTAAGGGGAAGCACTGAGCTGG - Intergenic
1018736245 6:166689058-166689080 GCCGAAGGCCAGCCCTGAGCAGG + Intronic
1018800982 6:167222065-167222087 GCAGAGGGGCAGCACTGAGTGGG - Intergenic
1018859838 6:167703708-167703730 GCTGAGGGTCAGCCCTCCACAGG - Intergenic
1018933875 6:168260724-168260746 GGTGCCGGTCAGCCCTGTGCAGG - Intergenic
1018949970 6:168372629-168372651 CCCCAGGGGCAGCCCTGAGCTGG - Intergenic
1018972907 6:168540869-168540891 GGTGAGGGGCAGCTCCCTGCAGG - Intronic
1019136450 6:169911616-169911638 GCTGAGGTGCAGCCCAGGCCAGG + Intergenic
1019166868 6:170102971-170102993 GTGGAGAGGAAGCCCTGTGCAGG + Intergenic
1019487597 7:1296468-1296490 GCTGTGGGCCAGGCCTGAGCTGG + Intergenic
1019509606 7:1411213-1411235 GCTGAGGGCCAGGCCAGGGCTGG - Intergenic
1019556303 7:1633279-1633301 CCTGGGGGACACCCCTGTGCTGG - Intergenic
1019656562 7:2199118-2199140 GCTGTGGGGCATCTCCGTGCAGG - Intronic
1019726520 7:2605914-2605936 GGCCACGGGCAGCCCTGTGCAGG + Exonic
1019733622 7:2640102-2640124 GCTGCGGGTCTGCCCTGAGCAGG - Intronic
1019989502 7:4682083-4682105 GCTGGGGGCGAGGCCTGTGCCGG - Intergenic
1022541926 7:31145785-31145807 GGTGAGATGCAGCACTGTGCTGG - Intergenic
1023048906 7:36234894-36234916 GCTGTGGGGGAGGCCTGGGCTGG - Intronic
1023048937 7:36234969-36234991 GCTGTGGGGGAGGCCTGGGCTGG - Intronic
1023048963 7:36235044-36235066 GCTGTGGGGGAAACCTGTGCTGG - Intronic
1023048978 7:36235094-36235116 GCTGTGGGGAAGGCCTGGGCTGG - Intronic
1023049005 7:36235169-36235191 GCTGTGGGGGAAACCTGTGCTGG - Intronic
1023049012 7:36235194-36235216 GCTGTGGGGAAGGCCTGGGCTGG - Intronic
1023049021 7:36235219-36235241 GCTGTGGGGGAGGCCTGGGCTGG - Intronic
1025927042 7:65968508-65968530 GGTGAGGGGAAGCCCAGTGATGG - Intronic
1026665625 7:72337547-72337569 GCTGAGGAGCAGCAGTTTGCCGG - Intronic
1029630647 7:101748099-101748121 GCCGAGGGGCCGCGCTGGGCGGG + Intergenic
1031422210 7:121565794-121565816 GCTGAAGTGCAGGGCTGTGCAGG - Intergenic
1032019796 7:128400932-128400954 GCTGAGGGGCAGGGCTGAGGAGG - Intronic
1034272325 7:149809248-149809270 GCCGAGGGACAGGGCTGTGCTGG - Intergenic
1034415464 7:150962206-150962228 GGTGAGGCGCATCCCTGTTCAGG - Intronic
1034675747 7:152891484-152891506 GCTGTGGGGACGCCCTGTGGAGG - Intergenic
1034858629 7:154577321-154577343 CCTGAGAGCCAGGCCTGTGCAGG + Intronic
1034885582 7:154795928-154795950 TCTGAGGGCCAGCCCTGGGGTGG - Intronic
1035222709 7:157415594-157415616 ACTGAGGTGCAGCCGTGTCCAGG + Intronic
1035312123 7:157976028-157976050 GGTGAGGGAGGGCCCTGTGCTGG - Intronic
1035375943 7:158406947-158406969 GCTGTGGGCGAGGCCTGTGCAGG - Intronic
1035390930 7:158504278-158504300 GGTGAGGGGATGCTCTGTGCAGG - Intronic
1035731475 8:1856634-1856656 GCTGAGGGGGAGCCCTGCTAGGG - Intronic
1035870602 8:3133133-3133155 GCTGAGGAGAAGCTGTGTGCCGG - Intronic
1040814353 8:51491899-51491921 GCAGGGAGCCAGCCCTGTGCAGG - Intronic
1041028208 8:53708169-53708191 TCTGAGGGCCAGCCCTCTGGGGG - Intergenic
1041836695 8:62224051-62224073 GCTGAGCTGGAGCTCTGTGCTGG - Intergenic
1043640370 8:82442846-82442868 GCTGAGGTGCAGCCCCGAGCAGG - Intergenic
1045977847 8:108149677-108149699 GCGGAGGGGGTGCACTGTGCTGG - Intergenic
1047204874 8:122795057-122795079 GAAGTGGGCCAGCCCTGTGCTGG - Intronic
1048979648 8:139696541-139696563 GCTGGGTGGGAGCCCTGTGCTGG - Intronic
1049031671 8:140042732-140042754 ACTCAGGAGCAGCCCGGTGCTGG - Intronic
1049169163 8:141147793-141147815 ACTGCTGGGCAGCTCTGTGCGGG - Intronic
1049320832 8:141995315-141995337 GGTGAGGTGGAGCCATGTGCTGG + Intergenic
1049475572 8:142795578-142795600 GCTGAGAGGAAGCACTGGGCAGG + Intergenic
1049545095 8:143226860-143226882 CCTGAAGGGCAGGCCGGTGCAGG + Intergenic
1049666088 8:143843413-143843435 GCTGAGGGCCTGCTGTGTGCCGG - Intergenic
1049773822 8:144395667-144395689 GGTGAGGGGCAGCTGTGTCCTGG + Intronic
1049773829 8:144395696-144395718 GCTGAGTGGCAGCCCCTTCCAGG - Intronic
1049805581 8:144537307-144537329 GCCCAGGGGCAGCCCTGGGCGGG + Intronic
1051352687 9:16213362-16213384 TCTGTGGGACAGCCCTGTGATGG - Intronic
1052024631 9:23560931-23560953 GCTGAGTGTCAACCATGTGCTGG + Intergenic
1052387106 9:27835394-27835416 GTGGAGGGGCTGCGCTGTGCTGG + Intergenic
1053097979 9:35345741-35345763 GCTGAAAGGGAGCCCTGGGCAGG + Intronic
1053130057 9:35609548-35609570 GATGAGGGGCTGCCCTGTCCTGG + Exonic
1053200513 9:36148837-36148859 GCTCAGTGCCAGGCCTGTGCTGG + Intronic
1056737230 9:89220193-89220215 GCTGTGGAGCAGGCCTGTGAAGG - Intergenic
1057204360 9:93162459-93162481 GCTGAGGGGCCGGGCGGTGCAGG + Intergenic
1057473744 9:95381186-95381208 GCTGAGAGGCAGCCATGGGAAGG - Intergenic
1057854952 9:98594698-98594720 GGGGATGGGCTGCCCTGTGCAGG - Intronic
1058916139 9:109568041-109568063 GCTGCTCGGCAGCCCTGTGCAGG - Intergenic
1059346004 9:113628449-113628471 GCTGATTGGCAGCCCGCTGCGGG - Intergenic
1059396167 9:114035383-114035405 GCCGAGGTCCAGCCCTGGGCGGG + Intronic
1060182784 9:121545734-121545756 GCTGAGGCGCAGCGCTGGGCTGG + Intergenic
1060495245 9:124113519-124113541 GCTGGGGAGCACCACTGTGCTGG + Intergenic
1060557678 9:124517491-124517513 GCTGGCGGGCAGCCCTTGGCCGG + Exonic
1060663276 9:125416658-125416680 GCTGAGGGGCCTCCCTGAGTTGG - Intergenic
1060667765 9:125443136-125443158 GCTGAGGGACTGCACAGTGCAGG - Intronic
1061297921 9:129687003-129687025 GCTGAGGGACAGCCACCTGCAGG + Intronic
1061376476 9:130228044-130228066 ATTGTGAGGCAGCCCTGTGCAGG - Intronic
1061894774 9:133641476-133641498 GCCGATGGGCCGCCCTGTGCAGG - Intronic
1061938820 9:133873173-133873195 GCTGAGTGCCTGCTCTGTGCTGG + Intronic
1062303297 9:135887921-135887943 GCTGTGGGGCAGGCCTCGGCGGG + Intronic
1062350365 9:136135747-136135769 GCGGAGGGACAGCCCTGAGGTGG + Intergenic
1062370336 9:136235485-136235507 GACGAGGGGAAGCCCTGAGCTGG + Intronic
1062393280 9:136342517-136342539 GCTGCCGGGCTGCCCTGGGCGGG - Intronic
1062454739 9:136630128-136630150 GCTGAGGGGCAGCCTGGGGCTGG - Intergenic
1203518548 Un_GL000213v1:25913-25935 GCTCAGGCGCTGCCCTGCGCCGG - Intergenic
1185894068 X:3843189-3843211 GCGCAGGGGCAGCCCCGCGCTGG + Intronic
1185899186 X:3881613-3881635 GCGCAGGGGCAGCCCCGCGCTGG + Intergenic
1185904303 X:3920042-3920064 GCGCAGGGGCAGCCCCGCGCTGG + Intergenic
1190732432 X:53234557-53234579 GCTGGGGGGCAGGACTGTACAGG + Exonic
1191685380 X:63884624-63884646 GGTGCTTGGCAGCCCTGTGCAGG - Intergenic
1193055501 X:77145177-77145199 TCTGATGGGCTTCCCTGTGCAGG - Intergenic
1195826238 X:109003972-109003994 GCAGAGGTGGAGCGCTGTGCTGG - Intergenic
1196982736 X:121232543-121232565 GGTGCAGGGTAGCCCTGTGCAGG + Intergenic
1197177483 X:123500903-123500925 GATGTTTGGCAGCCCTGTGCAGG + Intergenic
1198512208 X:137363696-137363718 CCTGAGAGCCAGCTCTGTGCTGG + Intergenic
1199564399 X:149199202-149199224 GCAGAGGGGGAGCACTGTGCTGG + Intergenic
1200238675 X:154482347-154482369 GCTGAGGAGCCGGCCAGTGCTGG + Intergenic
1200244476 X:154515851-154515873 GGTCAGGGGCAAGCCTGTGCGGG + Exonic
1202111609 Y:21427285-21427307 GCTGGGGAGCAGCCCAGGGCTGG + Intergenic
1202116835 Y:21476852-21476874 GCTGGGGAGCAGCCCAGGGCTGG - Intergenic