ID: 1006115950

View in Genome Browser
Species Human (GRCh38)
Location 6:31776343-31776365
Sequence GTCCCTCCTTTGTGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115950_1006115956 0 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115956 6:31776366-31776388 AGTCCCGGACCTTTCTAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
1006115950_1006115957 1 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115950_1006115958 2 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115958 6:31776368-31776390 TCCCGGACCTTTCTAAGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 53
1006115950_1006115955 -3 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115955 6:31776363-31776385 GACAGTCCCGGACCTTTCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1006115950_1006115960 3 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115960 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 87
1006115950_1006115963 18 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115950 Original CRISPR GTCCCTCCTTTGTGGGGCTC AGG (reversed) Intronic
900461161 1:2802663-2802685 CTGGCTCCTCTGTGGGGCTCAGG + Intergenic
900919093 1:5659454-5659476 GTCCTCCCTGTGTGGGGGTCTGG + Intergenic
901219462 1:7574911-7574933 GTCCTTCCCTGGTGGAGCTCTGG - Intronic
901237872 1:7677215-7677237 ATCCTTCCTGGGTGGGGCTCGGG - Intronic
901390728 1:8944236-8944258 GCACCTCCTTTGTGGGGATTCGG - Intergenic
904030981 1:27533246-27533268 GTCCCTCCTCAGTGAAGCTCAGG - Intergenic
904160482 1:28518863-28518885 GTCCCTCTCTTGCGGGGCTGGGG + Intronic
904614628 1:31743152-31743174 GTCGCGCCTTGGTGGGGCCCTGG - Intronic
905110896 1:35593760-35593782 GTGCGTCCTGTGTGTGGCTCAGG - Intronic
905792733 1:40798939-40798961 GCCCCTCCCTTGTTGGGGTCTGG + Intronic
906731305 1:48083691-48083713 TTCCCTCCATTGTGTGGCTCTGG + Intergenic
911188327 1:94925788-94925810 AGCCCTCCTTTGTGGCGCTTTGG + Intronic
913159137 1:116129435-116129457 GTCCATCCTTTCTGGGGCCAGGG - Intronic
915595050 1:156892403-156892425 GTCCCCCGGCTGTGGGGCTCTGG + Intergenic
916885107 1:169059863-169059885 GTCTCTCCTTTGTGTGCCCCTGG - Intergenic
921821731 1:219624493-219624515 GTCCTTTCTTTGTGGGGTTAGGG - Intergenic
922491059 1:226017171-226017193 GTCCTTGCTTTGTGAGGCCCTGG + Intergenic
922694859 1:227724797-227724819 TTCCTCCCTTTGTGGGCCTCAGG + Intergenic
1064410968 10:15103676-15103698 TTCCCTCCTTTCCAGGGCTCTGG - Exonic
1066656089 10:37701054-37701076 GTCCCTCAGCAGTGGGGCTCCGG - Intergenic
1066746422 10:38606281-38606303 GTCCCACCTTTGGGAGGCTATGG - Intergenic
1067042272 10:42961351-42961373 GTCCCTCCTATGTGTGGGGCTGG - Intergenic
1070087859 10:73254122-73254144 ACCCCTCTTTTGTGGGGCTACGG + Intronic
1071272091 10:84017318-84017340 GTCCCTCCTCTTTGTGGCTTTGG + Intergenic
1076413380 10:130267445-130267467 GTCGCTCCCTCTTGGGGCTCTGG + Intergenic
1076579605 10:131498358-131498380 TTCACTCCTTCCTGGGGCTCTGG - Intergenic
1076820841 10:132938835-132938857 GCCCCTCCTGGGAGGGGCTCCGG - Intronic
1076824728 10:132961116-132961138 GTCCCTCTGTGGTGTGGCTCCGG - Intergenic
1080051694 11:27864896-27864918 GTGCCTGCCTTCTGGGGCTCAGG - Intergenic
1081139134 11:39475898-39475920 GTCCCTCCTTTGTAGGGACATGG - Intergenic
1083201193 11:61122015-61122037 CTCCATCCTTTCTGGGTCTCTGG - Intronic
1084190602 11:67497069-67497091 GTCCCTTCTTTCTGGGCCTCAGG + Intronic
1084593826 11:70105511-70105533 TTCCCACCTATGTGGGTCTCAGG + Intronic
1085394422 11:76200104-76200126 GGCCCTGCTTTCTGGGTCTCTGG - Intronic
1086928593 11:92667783-92667805 CTCACTCCTTTGTGGAGCTGGGG + Intronic
1088441685 11:109877896-109877918 GTGCCTTCATTCTGGGGCTCTGG - Intergenic
1092000223 12:5025518-5025540 GTCCCTCCCGTGAGGGGCTTAGG - Intergenic
1094415873 12:30214294-30214316 GTTCCTGCTTTATGGGGCTAAGG - Intergenic
1096817512 12:54210763-54210785 ATCCCACCTGTTTGGGGCTCAGG - Intergenic
1097325492 12:58271765-58271787 GTCCCTATTCTGTGGGGCTATGG + Intergenic
1098298776 12:69032239-69032261 GCCCCTCTTTTGTGTGTCTCAGG + Intergenic
1103911697 12:124355585-124355607 GTCTGTCCATTGTGGGGCCCAGG + Intronic
1104410512 12:128553930-128553952 GTCCCTCCTTGTTGCAGCTCCGG + Intronic
1104682418 12:130760915-130760937 GGCCCTACTCTGTGGGCCTCCGG + Intergenic
1115561742 14:34588881-34588903 CTCCCTCCTTTGGGAGGCTGAGG + Intronic
1116849388 14:49893200-49893222 TTCGCTCCTTTGTGGAGCTCTGG + Intronic
1119764702 14:77181248-77181270 GGCCCTCCCTGGTGGGGCTGTGG + Intronic
1120018045 14:79496980-79497002 GTCCCAACTTTGTGGGGTTATGG - Intronic
1120831490 14:89001237-89001259 GTCCCTCATTTGGGGGCATCAGG + Intergenic
1121211498 14:92210897-92210919 GGCAGTCCTTTGTGGGGCCCAGG - Intergenic
1121525894 14:94619090-94619112 GTCCCTCCTATGAGGGACTCTGG + Intronic
1122354047 14:101112837-101112859 GTCCCTGCCTTGGTGGGCTCTGG + Intergenic
1123053495 14:105559025-105559047 CTTCCTCCTCTCTGGGGCTCTGG + Intergenic
1123078072 14:105679439-105679461 CTTCCTCCTCTCTGGGGCTCTGG + Intergenic
1124049367 15:26180687-26180709 AGCCCTCCTCTCTGGGGCTCTGG - Intergenic
1124160844 15:27268072-27268094 GTCCCTCCTTTGTAGTTTTCTGG + Intronic
1125154046 15:36565982-36566004 ATTCCTCCGTTGTGGTGCTCTGG - Intergenic
1127959025 15:63877267-63877289 GTGCCTTCATTCTGGGGCTCTGG - Intergenic
1128735875 15:70053653-70053675 GTCCCTCCAGGGTGGGCCTCTGG + Intronic
1129605681 15:77023930-77023952 CACCTTCCCTTGTGGGGCTCAGG - Intronic
1132264831 15:100460708-100460730 GTCCTTCCCTTGTCTGGCTCAGG + Intronic
1132411351 15:101580264-101580286 CTCTCTCCTTTGCGGGGGTCAGG - Intergenic
1132540429 16:505901-505923 GTTCCTCCTCTGTGTGGGTCAGG - Intronic
1133042408 16:3067665-3067687 CTCCACCCTGTGTGGGGCTCAGG + Intronic
1134380418 16:13719181-13719203 GGGCCTCCTTTGTGTGGATCTGG + Intergenic
1135832420 16:25787672-25787694 CTCACACCTTTGTGGGGCTGAGG + Intronic
1136513518 16:30753833-30753855 TTACCTCCTCTATGGGGCTCAGG - Intronic
1136688185 16:32008392-32008414 CTCCTTCCTTGGTGGTGCTCTGG + Intergenic
1136736637 16:32473361-32473383 GTCCCACCTTTGGGAGGCTATGG + Intergenic
1136788789 16:32951947-32951969 CTCCTTCCTTGGTGGTGCTCTGG + Intergenic
1136881024 16:33901987-33902009 CTCCTTCCTTGGTGGTGCTCTGG - Intergenic
1136935944 16:34464946-34464968 GCCCTTCCTTTCTGGGGTTCTGG + Intergenic
1136963876 16:34883624-34883646 GCCCTTCCTTTCTGGGGTTCTGG - Intergenic
1137528609 16:49261412-49261434 CCACCTCCTTTCTGGGGCTCAGG + Intergenic
1137541771 16:49367884-49367906 GTCCCTCCTTTATGGAGTTTAGG + Intergenic
1137783020 16:51113943-51113965 GGGCCGCCTTTGTGGCGCTCGGG + Intergenic
1138134892 16:54512961-54512983 TTCCTTCCTTTGTGGGGCGGTGG + Intergenic
1138487125 16:57352889-57352911 GTCCCTCCATGGGTGGGCTCAGG - Intergenic
1139167865 16:64591309-64591331 GTCCCTCCTTTGTGGTTTCCTGG + Intergenic
1140477217 16:75245083-75245105 CCCGCTCCTCTGTGGGGCTCTGG - Intronic
1141853784 16:86667001-86667023 GATCCTCCCTTGTGGGGCTGGGG + Intergenic
1203016431 16_KI270728v1_random:356216-356238 GTCCCACCTTTGGGAGGCTATGG - Intergenic
1203034766 16_KI270728v1_random:629374-629396 GTCCCACCTTTGGGAGGCTATGG - Intergenic
1203090985 16_KI270728v1_random:1213436-1213458 CTCCTTCCTTGGTGGTGCTCTGG + Intergenic
1142637445 17:1266926-1266948 GAGCCTCCATGGTGGGGCTCTGG - Intergenic
1143115732 17:4581005-4581027 ATCCCTCCTTTGGGAGGCTGAGG - Intergenic
1143730498 17:8880190-8880212 TCCCCTCCTCTGTGGGGCTCAGG - Exonic
1147581215 17:41628180-41628202 GCCCCTCCTGTATGGGGCTGTGG + Intergenic
1148157443 17:45432056-45432078 GTCCCTCCTGTGCGCGGCTCTGG + Intronic
1148781202 17:50123134-50123156 GTCCCTTCTTTGTAGGGCTGTGG - Intronic
1150292650 17:63990543-63990565 CTCCCTCCACTCTGGGGCTCTGG + Intergenic
1150306661 17:64091450-64091472 CTACCTCCTTACTGGGGCTCTGG - Intronic
1151475380 17:74342033-74342055 GCCCCTCCTGAGTGGGGCTAAGG - Intronic
1158882724 18:61796476-61796498 GTCCCTCCTCTGTGGTTCCCTGG - Intergenic
1160290563 18:77589543-77589565 GTCCCTCCCATCTGAGGCTCAGG - Intergenic
1160594201 18:79963067-79963089 CTCACTCCTTTGTGTGGCTGAGG + Intergenic
1160754757 19:751455-751477 GCCCCTCCCTTGGAGGGCTCTGG - Intronic
1160830760 19:1104079-1104101 GGCGCTGCTCTGTGGGGCTCTGG + Exonic
1161397489 19:4052368-4052390 GTCCCTCCTTGGTGAGGTTGGGG - Intronic
1163367476 19:16883792-16883814 GTCCCTTCTCTCTGTGGCTCTGG + Intergenic
1163818641 19:19483410-19483432 GAGCCTGCTTTGTGGGGCCCAGG - Intronic
1163860230 19:19738936-19738958 GCCCCTCCCTTGGGGGACTCAGG - Intergenic
1164403418 19:27919400-27919422 CTCCCCACTTTGTGTGGCTCTGG + Intergenic
1166528156 19:43526248-43526270 CTCCCGCCTTAGTGGGGCCCAGG - Exonic
925004831 2:433823-433845 GTCCCTCCTTTGAGGGGCCAAGG - Intergenic
933786900 2:85850469-85850491 GCCCCTCCATTCGGGGGCTCAGG - Intronic
934308825 2:91845470-91845492 GTCCCACCTTTGGGAGGCTATGG - Intergenic
934684898 2:96313798-96313820 GCCCATCCTGTGTTGGGCTCTGG - Intergenic
935627892 2:105186044-105186066 GGCCCTCCTTTGTGCAGGTCAGG + Intergenic
935836666 2:107062440-107062462 GTCCCAGCTTTCTAGGGCTCAGG - Intergenic
936033894 2:109094301-109094323 TTCCCTCCTTTTTGGGGATCCGG + Intergenic
936270332 2:111043980-111044002 GCCCCTCCTATGTGGGGCCCAGG + Intronic
936287372 2:111191086-111191108 GTCCCTCCTGTGTGTGTGTCTGG - Intergenic
939877912 2:147598837-147598859 GTCCTTTCTTGGTGGGACTCAGG - Intergenic
939996017 2:148920851-148920873 GCCCCTCCTATGTGTGGCTCTGG - Intronic
940998118 2:160172244-160172266 GTCCCTCCTTTCTGAGGCTGTGG + Intronic
944671988 2:202002552-202002574 GTCCCTCCTCTGGCCGGCTCTGG - Intergenic
946001365 2:216485290-216485312 GTCCCTCCTTGAAGGGGATCTGG - Intergenic
946330529 2:219006357-219006379 ATCCCTCCTTTCTGGGAGTCTGG + Intronic
947520079 2:230838755-230838777 GTCCCTCCTTGGTCTGGGTCTGG - Intergenic
948556491 2:238814775-238814797 TTTCCTCCTCTATGGGGCTCTGG + Intergenic
949036704 2:241818755-241818777 GCCCCTCCTATGAGGGGCTGAGG - Intergenic
1168730528 20:75041-75063 GTCCTTCCTTTGTGGGTGTGAGG - Intergenic
1170797836 20:19565139-19565161 GTCCCTCCTCTGTGGGTTTGTGG + Intronic
1172271884 20:33659615-33659637 GGTCCTCCCTTGTGGGGCCCTGG + Exonic
1172626481 20:36350342-36350364 GTCCCTCCTGGGTGGGGCAGTGG + Intronic
1174486795 20:50866250-50866272 GTCCCTTACTTGTAGGGCTCAGG + Intronic
1175528000 20:59648855-59648877 GTCCCTCCTATGGGGGACACAGG - Intronic
1176377341 21:6093071-6093093 CCCCCTCCTGTGCGGGGCTCTGG + Intergenic
1178377134 21:32076183-32076205 GCCCCTACTTTGTGGGGGTGGGG + Intergenic
1179746133 21:43445173-43445195 CCCCCTCCTGTGCGGGGCTCTGG - Intergenic
1180535910 22:16392558-16392580 GTCCCACCTTTGGGAGGCTATGG - Intergenic
1180594587 22:16964886-16964908 GTACATCCTGGGTGGGGCTCAGG + Intronic
1180878107 22:19184707-19184729 GTTCCTCCTCTGTGGGCCTTGGG + Intronic
1181394324 22:22608574-22608596 GTCATGCCTTTGTCGGGCTCTGG + Intergenic
1181510494 22:23386748-23386770 CTCCCTCCTGGGTGAGGCTCTGG - Intergenic
1181682701 22:24506877-24506899 ACCCCTCCTTTGTGGGGCCCTGG + Intronic
1181899193 22:26138766-26138788 GTCCCTCCTGTGTGTAGCCCAGG - Intergenic
1182350307 22:29695610-29695632 CTCCTTCCTGTGTGGGGCTGGGG + Exonic
1183712270 22:39512149-39512171 GGCCCTTCTTTCTGGGGCTGAGG + Intronic
1184024050 22:41840806-41840828 GTCCCAACTTGTTGGGGCTCTGG + Intronic
1184821190 22:46910330-46910352 GTCCCTCCTTTGTAGGTCCCGGG + Intronic
949483039 3:4511951-4511973 GGCTATCCTTTGTGGGGCTAAGG + Intronic
950293252 3:11805117-11805139 GTCCCACCTTTGAGCGGCTGAGG - Intronic
950679643 3:14576027-14576049 GACCCACCCCTGTGGGGCTCAGG + Intergenic
961476661 3:127151009-127151031 GCCTCTGCTTTGTGGGGCACAGG + Intergenic
961485265 3:127211644-127211666 GTCCCACCTTAGTGGGGTGCTGG - Intergenic
962812457 3:138971343-138971365 CTCCTTCCCATGTGGGGCTCAGG - Intergenic
964408060 3:156370651-156370673 ATTCCTCCATTGTGGAGCTCAGG - Intronic
967852508 3:194093102-194093124 GTCACTCCTGTGAGGGGCTGCGG - Intergenic
968570496 4:1338020-1338042 GTCCCCTCTTTGTGGAACTCTGG + Intronic
968596436 4:1488495-1488517 GTGGCTCCTTGGTGGGGCACTGG - Intergenic
968609208 4:1549491-1549513 ATCCCTCCTGCCTGGGGCTCTGG - Intergenic
972635523 4:40880699-40880721 GCCCATCCTTTGTCTGGCTCAGG + Intronic
975956593 4:79848084-79848106 GTCCCTCATTTGTTAGGCTAGGG + Intergenic
979938258 4:126724930-126724952 TTACCTCCTCTGTGGGGCTGAGG - Intergenic
984092145 4:175387568-175387590 GTCCCTCCCCTCAGGGGCTCAGG - Intergenic
985088747 4:186342287-186342309 GTGCCTGCTTTGTGTGTCTCTGG + Intergenic
988033566 5:25797155-25797177 GTCCCTCCTCTGTGGGGCAGGGG - Intergenic
989003884 5:36788594-36788616 CTCCCTCCTGTGTGGGGGGCAGG + Intergenic
989011118 5:36874930-36874952 ATCCCTCATTTGTGGGTTTCTGG + Intergenic
990003675 5:50922354-50922376 ATCCCTCCTGCCTGGGGCTCTGG + Intergenic
990524123 5:56608051-56608073 ATCCCTCCAGTGTGGAGCTCAGG - Intergenic
993590925 5:89794454-89794476 GTCCCTCCTTTGGTGCTCTCAGG - Intergenic
995176892 5:109188297-109188319 CTCCCTCCTTTGGGAGGCTGAGG + Exonic
995580031 5:113589156-113589178 GAACCTCCTTTCTGGGACTCTGG + Intronic
997472032 5:134122536-134122558 CTCCCTCCTTGGAGGGGCTGGGG - Intronic
997742899 5:136273187-136273209 GTCCCTACTCACTGGGGCTCTGG + Intronic
998449197 5:142221166-142221188 GTGCCTACTTTCTGGGGCTGGGG + Intergenic
999132476 5:149294970-149294992 TTTCCTCCTTTGTAGGGCGCTGG + Intronic
1001696847 5:173676503-173676525 GTCCTTCCTTTCTGGGGTCCTGG + Intergenic
1001702924 5:173720718-173720740 TTCCTTCCTTTGTGGGGCGGGGG + Intergenic
1006115950 6:31776343-31776365 GTCCCTCCTTTGTGGGGCTCAGG - Intronic
1006926625 6:37659040-37659062 GCCCCTCCATTGGGCGGCTCAGG - Intronic
1007477564 6:42129085-42129107 GTCCCTCGTTTTTGGAGCCCAGG + Intronic
1007757090 6:44106868-44106890 CTCCTTCCTCTGTGGGGCCCAGG - Intergenic
1007764015 6:44150476-44150498 GTCCCTCCTCTGTGAGCCACTGG - Intronic
1011804966 6:91061390-91061412 GTCCCAGCTTTGGGGGGCTGAGG - Intergenic
1011914349 6:92484726-92484748 GTCCCTCGTTAGTGTGGCTAAGG + Intergenic
1019664998 7:2247378-2247400 GACCCTCCTCTGTGGGGCAGGGG + Intronic
1028001235 7:85500919-85500941 TTCCCTCCTTTGGGGGATTCAGG + Intergenic
1028752135 7:94393958-94393980 GTCTCTCCTTTCTGAGGCTGCGG - Intergenic
1029107370 7:98189359-98189381 GTTACTCCTTTGATGGGCTCTGG + Intronic
1029365246 7:100112372-100112394 CCCCATCCTTTCTGGGGCTCTGG + Intronic
1029610885 7:101625961-101625983 CTCCCTCCCTCGTGGAGCTCTGG - Intronic
1035527587 8:325767-325789 GTCCCTGCTGTGTGGGGGTGAGG - Intergenic
1036700999 8:11013887-11013909 GACCCTCCCATGAGGGGCTCCGG - Intronic
1040611170 8:48983503-48983525 ATCCCTCCTTTGGGAGGCTGAGG - Intergenic
1040622801 8:49108457-49108479 CTCCCTCCCTTTTGGGGCTTAGG + Intergenic
1041292651 8:56321351-56321373 GACACTGCTGTGTGGGGCTCTGG + Intergenic
1041460561 8:58107045-58107067 GTCCCTGCTTTGTGAGGTTATGG - Intronic
1041523837 8:58784160-58784182 CTGCTTCCTTTGTGGGTCTCTGG + Intergenic
1044070334 8:87752268-87752290 GTCCCTCCGTTCTGGGTCCCTGG + Intergenic
1044456864 8:92399798-92399820 GTCCCCCCTAGGTGGGGCTTTGG + Intergenic
1045981194 8:108190261-108190283 GTACCTACTTTGTAGGGCTGTGG - Intergenic
1045982970 8:108213636-108213658 GTACATCATATGTGGGGCTCCGG - Intronic
1046777884 8:118183143-118183165 GTGCCTCCCTTGTGAGGCCCTGG - Intergenic
1048219579 8:132529087-132529109 GTACCTGCCTTGTGGGGCTTTGG - Intergenic
1048552813 8:135449349-135449371 GTCCCTCCTTTGTGGGGCTGAGG - Intergenic
1048799900 8:138185956-138185978 GTCCCACCTAGGTGGAGCTCAGG - Intronic
1049097624 8:140558216-140558238 TTCTCTCCTCTGTGAGGCTCAGG + Intronic
1049219951 8:141424618-141424640 CTCCCTCCTCTGGGGTGCTCAGG - Intronic
1049519817 8:143082374-143082396 ATACCTCCTTGCTGGGGCTCTGG + Intronic
1051866556 9:21689736-21689758 GTCAGTCCTTTGGGGAGCTCTGG + Intergenic
1053001755 9:34580525-34580547 GGCCGGCCTTTGTGGGCCTCTGG + Intronic
1053801414 9:41766567-41766589 GTGTCTCCTTTGTGGGCATCAGG + Intergenic
1054189845 9:61978721-61978743 GTGTCTCCTTTGTGGGCATCAGG + Intergenic
1055189253 9:73497759-73497781 GTCCCTTCTTTCTGGGTCTAGGG - Intergenic
1057292983 9:93818971-93818993 TGCCCTCCTTGCTGGGGCTCAGG + Intergenic
1058851130 9:109013149-109013171 GGACCGCCTGTGTGGGGCTCCGG - Intronic
1060299286 9:122365196-122365218 CTCCCTCCTTTTTTGGGCTTAGG + Intergenic
1061829289 9:133280565-133280587 GTCCCTCCTTTTTCGGCCTTTGG + Intergenic
1062064533 9:134519100-134519122 GTTTGTCCTTTGTGGGTCTCAGG - Intergenic
1185487444 X:493950-493972 GACCCTCATGTGTGGGACTCAGG - Intergenic
1186836051 X:13439167-13439189 ATCCCTCCTTTCTGGTGCTTAGG - Intergenic
1187471989 X:19577889-19577911 GTACCTCCTTTCTGGGGCACGGG - Intronic
1195039244 X:100999153-100999175 GTTCCTCCATTGTGTGGCTCTGG + Intergenic
1197321657 X:125039346-125039368 GTTCCTCCTTTGTCGTGCACTGG - Intergenic
1198390680 X:136170720-136170742 GTCCCTCCTTTTTGGTGCCCCGG + Intronic
1200165854 X:154034659-154034681 CTCCCTCCTTTATGGGGAGCTGG - Intronic