ID: 1006115951

View in Genome Browser
Species Human (GRCh38)
Location 6:31776349-31776371
Sequence GGGACTGTCCCTCCTTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115951_1006115963 12 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115951_1006115955 -9 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115955 6:31776363-31776385 GACAGTCCCGGACCTTTCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1006115951_1006115960 -3 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115960 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 87
1006115951_1006115958 -4 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115958 6:31776368-31776390 TCCCGGACCTTTCTAAGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 53
1006115951_1006115966 27 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115951_1006115956 -6 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115956 6:31776366-31776388 AGTCCCGGACCTTTCTAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
1006115951_1006115957 -5 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115951_1006115965 26 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115951 Original CRISPR GGGACTGTCCCTCCTTTGTG GGG (reversed) Intronic
904448491 1:30595545-30595567 GGGACTGCACCTGCTTTCTGGGG + Intergenic
906608482 1:47186947-47186969 GGTGCGGTCCCTCCTTTGGGTGG - Intronic
906645422 1:47471076-47471098 GGGGGTTTCCCTCCTCTGTGGGG - Intergenic
907545748 1:55258507-55258529 TGGAATGTCTCTCCTATGTGAGG - Intergenic
910839226 1:91546032-91546054 GGGACGCCCCCTCCTTTCTGAGG + Intergenic
910960098 1:92752598-92752620 GGAACTTTTCCTTCTTTGTGGGG + Intronic
913581667 1:120233090-120233112 AGAACAGTCCCTCCCTTGTGCGG + Intergenic
914563598 1:148844537-148844559 AGAACAGTCCCTCCCTTGTGCGG + Intronic
914609229 1:149285689-149285711 AGAACAGTCCCTCCCTTGTGCGG - Intergenic
916500768 1:165384868-165384890 GGGAATATGCCCCCTTTGTGGGG - Intergenic
919162201 1:193845020-193845042 GGGACTTTTCCTCCTTTGCTTGG + Intergenic
920667544 1:207974462-207974484 GTGACTGCTCCTCCTTTGGGTGG + Intergenic
921562313 1:216673251-216673273 GGAACGGCCCCTCCTTTCTGTGG - Intronic
923039744 1:230311093-230311115 GGCACTGGCTCTCCTTTTTGGGG + Intergenic
923525353 1:234768426-234768448 GGGACTTTCCCTGCTTTGTTTGG - Intergenic
924025842 1:239832146-239832168 TGCACTGTCCCTCCATTGTACGG + Intronic
924626751 1:245702072-245702094 GGGAGAGTCCCTCCCTTTTGGGG - Intronic
1063380932 10:5585340-5585362 GGGACAGCCCTTCCTTAGTGGGG - Intergenic
1063875226 10:10469452-10469474 GGGACTTCACCTCCTTTATGTGG - Intergenic
1064297271 10:14089772-14089794 GGGACTGGTCCAGCTTTGTGGGG + Intronic
1067042276 10:42961357-42961379 GGCCTTGTCCCTCCTATGTGTGG - Intergenic
1069984471 10:72274061-72274083 GTGAGTGTCCCTTCTGTGTGTGG + Intronic
1069987321 10:72293282-72293304 TGGCCTGTCCCTGCTGTGTGAGG + Intergenic
1071522530 10:86340080-86340102 GGCACTCTCCCTCATCTGTGAGG - Intronic
1075413404 10:122245752-122245774 GGGACTCTTCCTCCTTCTTGGGG + Intronic
1075544874 10:123347535-123347557 GGGACTGGCCCCCCTTGGTGAGG + Intergenic
1076742904 10:132496829-132496851 GGCACTGTCCTTCCTCTGTCTGG + Intergenic
1078621510 11:12912912-12912934 GGGTCTGTCCCTTCCTTCTGGGG + Intronic
1079568771 11:21916484-21916506 GGGTCTGTACCTCCTTTATGTGG + Intergenic
1081835656 11:46151483-46151505 AGGACTGTCACTCCTTTGATGGG - Intergenic
1081872343 11:46389197-46389219 TGGACAGTCCCTCAGTTGTGTGG - Intergenic
1083574000 11:63776120-63776142 GGGACTGTCCCTCTTTAGTGGGG - Intergenic
1083922510 11:65788209-65788231 GGGCCTGGCCCTCCGCTGTGGGG - Intronic
1084647643 11:70468408-70468430 AGGACTGCCCGTGCTTTGTGGGG - Intronic
1085047895 11:73363917-73363939 TCTACTGTCCCTCCTCTGTGTGG + Intronic
1085523427 11:77151196-77151218 AGGACTGTCCCCGCATTGTGTGG + Intronic
1087445974 11:98253807-98253829 GGGGCTTTCCCTTCTTTGTTTGG - Intergenic
1095937898 12:47705257-47705279 GCAACTGTCCCTTCTTAGTGAGG - Intronic
1097176378 12:57145758-57145780 GGGACTGTCCCTTCTCTGAGAGG + Intronic
1097727369 12:63090345-63090367 GGGACTGTCCTTTTTTTGTGAGG + Intergenic
1101679308 12:106949368-106949390 GGGACTTTTCCTCCTTTGCTCGG - Intergenic
1102678944 12:114677152-114677174 GGCTCTCTCCCTCCTTCGTGGGG - Intronic
1103671730 12:122622300-122622322 GTGACTGCGCCTCCTTTTTGAGG - Intronic
1104023308 12:125008263-125008285 GTGACTGCCCCTCCCTTGGGTGG - Intronic
1104858034 12:131910952-131910974 GGGGCTGTCACCCGTTTGTGGGG - Intronic
1107708184 13:43127482-43127504 GAGATTGTCCCTGTTTTGTGTGG - Intergenic
1109622697 13:64929917-64929939 AGGACTTTACCTCCTCTGTGGGG + Intergenic
1111786328 13:92791457-92791479 ACTATTGTCCCTCCTTTGTGAGG - Intronic
1112162736 13:96885866-96885888 GGGACTGTCCCACATGTATGCGG + Intergenic
1113468540 13:110529043-110529065 GGGACTGGCCCTTCTTGGTGTGG - Intronic
1113932092 13:113973956-113973978 GGGCCGGTGCCTCCTGTGTGTGG + Intergenic
1117992637 14:61449493-61449515 GGCATCATCCCTCCTTTGTGAGG + Intronic
1121324887 14:93014053-93014075 GGGAAGTTTCCTCCTTTGTGAGG - Intronic
1122279193 14:100611089-100611111 TGGGCTGTCCCTCCTGGGTGTGG + Intergenic
1123116335 14:105895810-105895832 GGGTCTGTCCCTCGCTTATGTGG + Intergenic
1124403547 15:29373213-29373235 GTCACTGTCCCTCCTTGGAGGGG - Intronic
1132832144 16:1933621-1933643 GGCACTGCCCCTCCTGTGGGGGG + Intergenic
1133063756 16:3191826-3191848 GGGCCTCTCCCCACTTTGTGCGG + Intergenic
1133089142 16:3390020-3390042 GTGACTGTCCTTCCTCTGGGTGG + Exonic
1133296310 16:4754189-4754211 GGTTCTGTCCCTCCCCTGTGAGG - Intronic
1135574105 16:23571871-23571893 GAGACTTTCCCTCCTTTCAGAGG - Exonic
1137443043 16:48512164-48512186 GGGCCTGTCCCTGCTTAGGGAGG + Intergenic
1138492577 16:57384836-57384858 GGGGCCCTGCCTCCTTTGTGAGG + Exonic
1139280809 16:65768837-65768859 GTGACTGTCCCTCCCTTTTGTGG + Intergenic
1141647338 16:85374810-85374832 GGGGCTGTCCGTCCTCAGTGAGG - Intergenic
1144485226 17:15659026-15659048 GGGACAGCCCCTCCTTCTTGCGG - Intronic
1144888096 17:18477580-18477602 GGGACTGTCCCTGCAGTGTGGGG + Intronic
1145144109 17:20466723-20466745 GGGACTGTCCCTGCAGTGTGGGG - Intronic
1150817194 17:68401537-68401559 GTGTGAGTCCCTCCTTTGTGGGG + Intronic
1152003765 17:77664151-77664173 GGGACAGGCCCACCTCTGTGGGG - Intergenic
1152799537 17:82324373-82324395 GGGACAGTTCTTCCTTTGGGAGG - Intronic
1153542639 18:6172407-6172429 GGGCCCGTCTCTCATTTGTGAGG - Intronic
1153682460 18:7513389-7513411 TGCACTGTCCCTTCTTTTTGGGG + Intergenic
1153842261 18:9017465-9017487 GGGACTGCCCCTCCTTTGGCAGG - Intergenic
1156299850 18:35826825-35826847 GGGAATATCCCTGCTTTGGGAGG + Intergenic
1157999805 18:52604564-52604586 GTGCCTGTCCCTTCTTTGTGGGG + Intronic
1161397492 19:4052374-4052396 TGGTTTGTCCCTCCTTGGTGAGG - Intronic
1161554745 19:4934626-4934648 CGGAATTTCCCTCCTTTTTGTGG + Intronic
1163963023 19:20715324-20715346 AGGACTGTCTCTCCTTTTTTTGG - Intronic
1164204432 19:23046068-23046090 GGGACTGTGTCCCCTTAGTGGGG + Intergenic
1166883441 19:45942994-45943016 GGGACTGACTCTCCATTGTGGGG - Intronic
925451097 2:3969713-3969735 GGGACTGTCCTGCATCTGTGGGG - Intergenic
926734544 2:16062978-16063000 GGGCCTGTAACTCCTTTGTTTGG - Intergenic
927515519 2:23669668-23669690 GGGATGGTCCCCCCTCTGTGTGG + Intronic
928877607 2:36058667-36058689 GGCACTGATTCTCCTTTGTGTGG - Intergenic
929027357 2:37617308-37617330 GGGACTCTTCCTCCTTTGCTAGG + Intergenic
932285874 2:70531205-70531227 GGGACTGACCATACTCTGTGTGG - Intronic
936270330 2:111043974-111043996 GAGCCTGCCCCTCCTATGTGGGG + Intronic
936386235 2:112032119-112032141 GAGACTTGCCCTCCCTTGTGAGG + Intergenic
937970580 2:127545971-127545993 GTGACTTTGCCTCCTTTGGGTGG + Intronic
938948858 2:136239143-136239165 GGGACTTTCTCCCCCTTGTGTGG + Intergenic
942954147 2:181754389-181754411 AGGACTGTCCCTCCCTTCTCAGG - Intergenic
945139326 2:206667188-206667210 GGGTCTGTGCCGTCTTTGTGGGG - Intronic
948524187 2:238560222-238560244 GGGACTGGACCTGCTTGGTGAGG - Intergenic
948569714 2:238910014-238910036 GGGAGTGCCCTTCCTATGTGGGG - Exonic
948974235 2:241453718-241453740 TGGAGTGTCCTTCCTTTATGAGG + Intronic
1169040756 20:2493527-2493549 GGGCCTTTCCCTCCTTTTTCTGG + Exonic
1169677001 20:8165594-8165616 GGGACTTTACCTCATTTGTTTGG + Intronic
1170476859 20:16723541-16723563 GGGACTGTCTCACCTTTATTTGG - Intergenic
1170609425 20:17900221-17900243 GGGACTGTCCTTGTTTTGGGGGG - Intergenic
1173148452 20:40545545-40545567 GGGGCTCTCACTCCTCTGTGGGG - Intergenic
1174603254 20:51741612-51741634 GCGAGTTTCCCTCCATTGTGAGG - Intronic
1175968029 20:62669350-62669372 GGGACTGCCCCTCCACAGTGTGG + Intronic
1178275964 21:31237178-31237200 GGGACCATACCTCCTTTGAGAGG + Intronic
1178944720 21:36937205-36937227 GGCACTGCCTCTCCTTTGTTTGG + Exonic
1179129463 21:38621698-38621720 GAGACTAACCCTCCTTTCTGGGG - Intronic
1179713245 21:43274933-43274955 GAGACTCTCCCTCCTAGGTGGGG + Intergenic
1179895202 21:44357956-44357978 TGGAATGTCCCTCCTTCTTGTGG + Intronic
1180693625 22:17738273-17738295 GGGACTGTCTTTCCTTTGAGAGG - Intronic
1183581405 22:38728650-38728672 GGGCCAGTACCTCCTTTGTACGG - Intronic
1184495335 22:44837873-44837895 GGGCCAGTCCCTCCTCTTTGGGG + Intronic
950154398 3:10710750-10710772 GGTTCTGTCCCTACTGTGTGTGG + Intergenic
950882827 3:16336961-16336983 GGGACTCTCCCTCTTATGGGAGG - Intronic
952656491 3:35792594-35792616 GGGTCTGTCCCTGGTTTGGGTGG + Intronic
956265414 3:67391251-67391273 GGCACTGTACCTCCTCTGGGTGG + Intronic
960268966 3:115653516-115653538 GTGTCTGCCCCTACTTTGTGTGG + Intronic
961635393 3:128329784-128329806 GGCCATGTCCCTCCTATGTGTGG - Intronic
968441816 4:628075-628097 GTGTCTGTCCCTCCATTCTGTGG + Intronic
972598857 4:40554045-40554067 GGGACTGTGCATCCTTTAAGTGG - Intronic
977929100 4:102732335-102732357 GGGGCTTCCCCTCCTTTGTCAGG + Intronic
979836146 4:125370310-125370332 GGAACTGTCTCTACTTTGTAGGG - Intronic
984404331 4:179307639-179307661 GGGAATGTCCCAGCTGTGTGAGG - Intergenic
985584824 5:725261-725283 GGGACTTCCCCTGCTGTGTGAGG + Intronic
985598328 5:809575-809597 GGGACTTCCCCTGCTGTGTGAGG + Intronic
986739559 5:10694192-10694214 GCCACGGTCCCTCCTTTGCGTGG - Intronic
987806997 5:22781967-22781989 GGGACTGTGGCCCCTTTGTTTGG + Intronic
990332297 5:54740078-54740100 TCTTCTGTCCCTCCTTTGTGAGG - Intergenic
992064421 5:73092527-73092549 GGAACTGTCCCTCCTAGCTGTGG - Intergenic
997851047 5:137332891-137332913 TGGACTCTCCCTCATTTTTGCGG - Intronic
1001955953 5:175848272-175848294 CAGTCTGTCCCTCCTTTTTGGGG - Intronic
1003273853 6:4631424-4631446 GGGACAGTCCCCCATTTATGAGG + Intergenic
1006115951 6:31776349-31776371 GGGACTGTCCCTCCTTTGTGGGG - Intronic
1006412860 6:33885408-33885430 GGGACTGTCCCTCTGTAGTATGG - Intergenic
1006743796 6:36327193-36327215 GGTGCTTTCCCTCCATTGTGTGG - Intronic
1008745747 6:54667754-54667776 GGGACTTTCCCACCTTTGGGTGG + Intergenic
1011738186 6:90333489-90333511 GGGCCTGTATCTCCTTTGTTTGG - Intergenic
1011933225 6:92739630-92739652 GGGACTCTCCCCCCTTTGCTTGG - Intergenic
1013426076 6:110013787-110013809 GGGACTGTCCATACAGTGTGCGG + Intergenic
1014047765 6:116912935-116912957 GGGACTGACACTCTTTTTTGAGG + Intronic
1016154987 6:140794982-140795004 GGGGCTTTTCCTCCTTTGTTTGG - Intergenic
1016407458 6:143745480-143745502 GAGACAGCCCCTGCTTTGTGCGG + Intronic
1018662864 6:166104683-166104705 GGCTCTAACCCTCCTTTGTGTGG + Intergenic
1018738767 6:166711195-166711217 GGGGCTATTCCTGCTTTGTGGGG - Intronic
1019353793 7:568587-568609 TGGACATTCCCTCCCTTGTGGGG - Intronic
1019756130 7:2771552-2771574 AGGACACTCCCTTCTTTGTGTGG + Intronic
1020059717 7:5143381-5143403 GGCACTGTCCCGCCTTAGTCTGG + Intergenic
1023151414 7:37204487-37204509 GGGTCTGTGCCGCCTTTATGAGG - Intronic
1023213453 7:37833104-37833126 GGGGTAGTCCCTGCTTTGTGCGG + Intronic
1026692491 7:72561418-72561440 GAGACTGTCCCTCTCTTTTGTGG + Intronic
1031959540 7:127976276-127976298 GGTGCTGTCCTTCTTTTGTGCGG + Intronic
1034893593 7:154860681-154860703 GGGGCTGTTCCTTCTTTGTTAGG - Intronic
1035105149 7:156435722-156435744 GGGACTGCTGCTCCTTAGTGGGG - Intergenic
1035310246 7:157963203-157963225 GAGACAGTCCCTCCCTTCTGCGG + Intronic
1040378609 8:46850698-46850720 GTCACTATCCTTCCTTTGTGTGG - Intergenic
1040665675 8:49629869-49629891 GGGACTGGCACAGCTTTGTGAGG - Intergenic
1041894536 8:62908186-62908208 GGGCCTGTAGCTCCTTTGTTTGG + Intronic
1046381136 8:113452645-113452667 GGGACTGTTACTACTTTGGGGGG - Intergenic
1047414665 8:124654170-124654192 AGGCCTGTCCCTCCTTTCTTTGG - Intronic
1048498987 8:134958824-134958846 GTGATTATCCCTCCTCTGTGAGG - Intergenic
1049048479 8:140172106-140172128 GAGACAGTTCTTCCTTTGTGTGG - Intronic
1049570631 8:143368839-143368861 CCGACTGTCCCTCCTGAGTGGGG - Intronic
1053788427 9:41669007-41669029 GGGCCTGTCTCTCCTTTGCCTGG - Intergenic
1056114908 9:83432423-83432445 GTGACTGTGTGTCCTTTGTGTGG + Intronic
1056724939 9:89106523-89106545 GGGACTGTCCTTCAGTAGTGAGG + Intronic
1062067853 9:134538383-134538405 GGGCCTGGCTGTCCTTTGTGGGG + Intergenic
1062157807 9:135063414-135063436 GGGCCTGTAGCCCCTTTGTGTGG - Intergenic
1189047294 X:37606648-37606670 GAGTTTGTTCCTCCTTTGTGTGG - Intronic
1189592567 X:42530624-42530646 TGCTCTGTCCCTCCTTTGAGTGG + Intergenic
1193861518 X:86673426-86673448 GGGACTGTTACCCCTTTGTTTGG + Intronic
1194220533 X:91183789-91183811 GGGCCTGTAGCTCCTTTGTTTGG + Intergenic
1195369265 X:104156928-104156950 GCGACTGTCGCTGCTTTCTGAGG - Exonic
1199016254 X:142819586-142819608 GGGCCTGTGCCTCCTTGATGGGG - Intergenic
1199593126 X:149486510-149486532 GGGACTCAGCCTTCTTTGTGGGG - Intronic
1199717312 X:150515826-150515848 GGCACTGTCACTCCTTTGAAGGG - Intergenic
1199908678 X:152261511-152261533 GGGACTGTAGCCCCTTTGTTTGG - Intronic