ID: 1006115952

View in Genome Browser
Species Human (GRCh38)
Location 6:31776350-31776372
Sequence CGGGACTGTCCCTCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115952_1006115966 26 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115952_1006115960 -4 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115960 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 87
1006115952_1006115957 -6 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115952_1006115955 -10 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115955 6:31776363-31776385 GACAGTCCCGGACCTTTCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1006115952_1006115956 -7 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115956 6:31776366-31776388 AGTCCCGGACCTTTCTAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
1006115952_1006115963 11 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115952_1006115958 -5 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115958 6:31776368-31776390 TCCCGGACCTTTCTAAGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 53
1006115952_1006115965 25 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115952 Original CRISPR CGGGACTGTCCCTCCTTTGT GGG (reversed) Intronic
901012100 1:6207793-6207815 CTGGACTGCCCCTCCTGTGCAGG - Intronic
901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG + Intronic
901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG + Exonic
904087990 1:27923452-27923474 GGGCACTGTCACTTCTTTGTAGG - Intergenic
904425392 1:30419468-30419490 CGGGACTGTCCCAGGTTTGGAGG - Intergenic
919421196 1:197372392-197372414 GGGGAATGTCTCTCCTTTGGGGG - Intronic
922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG + Intergenic
1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG + Intronic
1075194789 10:120346972-120346994 TGGGACTGTCCTTCCTCTGGGGG - Intergenic
1075413403 10:122245751-122245773 CGGGACTCTTCCTCCTTCTTGGG + Intronic
1081835657 11:46151484-46151506 GAGGACTGTCACTCCTTTGATGG - Intergenic
1081957793 11:47108672-47108694 CTGAACTGTCCCACCCTTGTGGG - Intronic
1083574001 11:63776121-63776143 TGGGACTGTCCCTCTTTAGTGGG - Intergenic
1083922511 11:65788210-65788232 CGGGCCTGGCCCTCCGCTGTGGG - Intronic
1084647644 11:70468409-70468431 CAGGACTGCCCGTGCTTTGTGGG - Intronic
1087648793 11:100839788-100839810 CGAGACTGGTCCTCCTTTATCGG - Intronic
1088095744 11:106099389-106099411 GGGGATTGTCTCTCCTGTGTTGG + Intergenic
1096429918 12:51534468-51534490 CGGGGCTGTCCATCCTTAGGAGG + Intergenic
1096611305 12:52803793-52803815 GGGGGCTGTGCCCCCTTTGTGGG - Intergenic
1101203039 12:102456789-102456811 GGGGACTGTCATTCCTTTTTGGG - Intronic
1103447078 12:121001447-121001469 AGGGACTGTCGCTGCTTCGTGGG + Exonic
1104255201 12:127130122-127130144 CAGGACTGGCCATCCTTGGTTGG - Intergenic
1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG + Intronic
1113617517 13:111691411-111691433 CAGGAATGTCCCGCCTTTGCCGG - Intergenic
1113623047 13:111776671-111776693 CAGGAATGTCCCGCCTTTGCCGG - Intergenic
1121764580 14:96475091-96475113 CTGGACTTTCCATTCTTTGTTGG + Intronic
1142054212 16:87982537-87982559 AGGGACCGTGCCTCCTTTGTAGG + Intronic
1144888095 17:18477579-18477601 AGGGACTGTCCCTGCAGTGTGGG + Intronic
1145144110 17:20466724-20466746 AGGGACTGTCCCTGCAGTGTGGG - Intronic
1150460653 17:65347547-65347569 CGGGACTATCCCTCCTCTGAGGG - Intergenic
1152451636 17:80385195-80385217 CAGGACTGTCCCGCATTTGGCGG + Intronic
1157999804 18:52604563-52604585 TGTGCCTGTCCCTTCTTTGTGGG + Intronic
1166389550 19:42401550-42401572 GGGGACTGGCCCTCCCTTGCAGG - Exonic
1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG + Intergenic
1166883442 19:45942995-45943017 AGGGACTGACTCTCCATTGTGGG - Intronic
1168565301 19:57417354-57417376 AGGGACTATCCCTCCTTTTGTGG + Intronic
927960243 2:27236763-27236785 CGGGCCAGCCCCTCCTTTGAAGG + Exonic
937906632 2:127055765-127055787 CGGGACTGTCCCTCCATGCAGGG + Intronic
938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG + Intergenic
1179557780 21:42191415-42191437 TGGGACTGTCCCAGCTATGTGGG + Intergenic
1181003125 22:19997302-19997324 AGCAACTGTCCCTCCTCTGTGGG + Intronic
1181721233 22:24776125-24776147 GGGAACTGTCCTGCCTTTGTAGG - Intergenic
953958065 3:47246746-47246768 TGGGACTGCCCCTCCTGTGAAGG + Intronic
962385599 3:134929932-134929954 GAGGACTTTCCCTCCTTTTTGGG - Intronic
967656396 3:192055225-192055247 CTGGCCTTTCTCTCCTTTGTTGG - Intergenic
969518208 4:7660500-7660522 TGGGACTCTGCCTCCTTTGGGGG - Intronic
979836147 4:125370311-125370333 TGGAACTGTCTCTACTTTGTAGG - Intronic
983052346 4:163063062-163063084 CTGGACTGTACCACATTTGTAGG - Intergenic
986026277 5:3854449-3854471 CGGGCCTGGCCCGGCTTTGTGGG + Intergenic
991268587 5:64751582-64751604 CAGGACTGTCCTACCATTGTAGG + Intronic
992826570 5:80554986-80555008 AGGGGCTGTCCCTCCAGTGTCGG + Intergenic
993306699 5:86283469-86283491 CGGGACACTCCCTGCTTTGAAGG - Intergenic
999388745 5:151174606-151174628 TGGGACTCTGCCTCCTTTGTGGG + Intergenic
1005075289 6:21901116-21901138 CAGGACTTTCCCTTCTCTGTTGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1009719482 6:67448638-67448660 CCGGACTTTCACTCCTTAGTTGG + Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1019287752 7:232027-232049 TCGGGCTGTCCCTGCTTTGTGGG + Intronic
1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG + Intronic
1024929242 7:54652623-54652645 CAGGACTGGCTTTCCTTTGTTGG - Intergenic
1026233638 7:68507483-68507505 GTGGACTCTGCCTCCTTTGTGGG - Intergenic
1035453837 7:158996621-158996643 CTGGGGTCTCCCTCCTTTGTTGG + Intergenic
1048471636 8:134709350-134709372 CAGGACTGTGTCTCCTTTGCCGG + Intronic
1049570633 8:143368840-143368862 CCCGACTGTCCCTCCTGAGTGGG - Intronic
1049697096 8:143989767-143989789 CGGGACTGACCGTCCGTTCTCGG - Intronic
1049939693 9:533613-533635 CTGGACTGTCCCTGGTTTGAAGG + Intronic
1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG + Intronic
1053916467 9:42948309-42948331 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054517734 9:66053081-66053103 AGAGACTGTCCCTGCTGTGTGGG - Intergenic
1054710890 9:68509762-68509784 AGGGACTGTCCCTAATTTGCTGG + Intronic
1187390342 X:18882596-18882618 CCTGACTCTCCCTCCTTGGTTGG + Intergenic
1194245583 X:91507882-91507904 CAGGACTTTCCCTGGTTTGTAGG - Intergenic
1198520361 X:137446249-137446271 CTGGCCTGACCCTGCTTTGTGGG + Intergenic
1199717313 X:150515827-150515849 GGGCACTGTCACTCCTTTGAAGG - Intergenic
1200564551 Y:4749132-4749154 CAGGACTTTCCCTGGTTTGTAGG - Intergenic