ID: 1006115953

View in Genome Browser
Species Human (GRCh38)
Location 6:31776351-31776373
Sequence CCGGGACTGTCCCTCCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115953_1006115965 24 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1006115953_1006115966 25 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115953_1006115958 -6 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115958 6:31776368-31776390 TCCCGGACCTTTCTAAGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 53
1006115953_1006115956 -8 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115956 6:31776366-31776388 AGTCCCGGACCTTTCTAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
1006115953_1006115957 -7 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115953_1006115960 -5 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115960 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 87
1006115953_1006115963 10 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115953 Original CRISPR CCGGGACTGTCCCTCCTTTG TGG (reversed) Intronic
900597794 1:3490407-3490429 CTGGTACTGCCCTTCCTTTGAGG - Exonic
901408214 1:9064391-9064413 CCGGGAGGGTCTCTCCTTAGAGG + Intronic
905918016 1:41699284-41699306 CCTGCCCTGCCCCTCCTTTGAGG - Intronic
908375920 1:63540771-63540793 CCTGCACTGTCACACCTTTGGGG - Intronic
910138309 1:83998815-83998837 CCCGGACTGTCACTGCTCTGGGG - Intronic
915065353 1:153220076-153220098 CCGGGACAGCCCCTCCTTGTAGG + Intergenic
916745660 1:167683110-167683132 CCGTGGCTGTCCCTCCATTGAGG - Intronic
919421197 1:197372393-197372415 GGGGGAATGTCTCTCCTTTGGGG - Intronic
919839750 1:201600190-201600212 CCTGGAGAGTCTCTCCTTTGGGG - Intergenic
922423726 1:225475630-225475652 CCAGGACTGCCCCTCCATGGAGG + Intergenic
924237879 1:242014356-242014378 GAGTGACAGTCCCTCCTTTGAGG - Intergenic
1063580322 10:7300568-7300590 CCGGGAATTTCCCTCCCATGTGG + Intronic
1067538615 10:47135631-47135653 CCGTAAATGTCACTCCTTTGGGG - Intergenic
1071387862 10:85140656-85140678 ACGGTACTGTCTGTCCTTTGTGG - Intergenic
1075194790 10:120346973-120346995 CTGGGACTGTCCTTCCTCTGGGG - Intergenic
1077139881 11:1019600-1019622 CCGGGACTCAGCCTCCTTGGAGG + Intronic
1077836032 11:5929022-5929044 CCCGGACTGGCCTTCCCTTGAGG - Intronic
1083574002 11:63776122-63776144 ATGGGACTGTCCCTCTTTAGTGG - Intergenic
1083922512 11:65788211-65788233 CCGGGCCTGGCCCTCCGCTGTGG - Intronic
1084267417 11:68012180-68012202 CAGGGACGGTCCCTGCTGTGAGG + Intronic
1091332589 11:134741865-134741887 CCTGACCTGTCCCTCCTCTGTGG - Intergenic
1092163720 12:6329910-6329932 CGGTGACTGTCCCAACTTTGCGG - Exonic
1100608539 12:96171364-96171386 GCAGGGCTGTCCCTCCTATGGGG + Intergenic
1102552028 12:113698337-113698359 CCGGGTCTGTCGCTCCTCTGGGG - Intergenic
1102952179 12:117038239-117038261 CCGAGCCTGTCCCTGCTGTGGGG - Intergenic
1103179630 12:118898874-118898896 CCAGGACTGTGCCTGTTTTGTGG - Intergenic
1104837377 12:131800294-131800316 CAGGGAGTGTCCTTCCTGTGGGG - Intergenic
1104950122 12:132436216-132436238 CAGGGTCTCTCCCTCCTTTGGGG - Intergenic
1106564258 13:30871419-30871441 CCGGCCCTGTCCTTCCCTTGGGG + Intergenic
1108505286 13:51107500-51107522 CCTTGTCTGTCCCTCTTTTGTGG - Intergenic
1113618231 13:111695878-111695900 CAGGCCCTCTCCCTCCTTTGTGG + Intergenic
1113623762 13:111781139-111781161 CAGGCCCTCTCCCTCCTTTGTGG + Intergenic
1113916140 13:113875189-113875211 ACGGGGCTGTCTCTCCCTTGGGG - Intergenic
1114693405 14:24606048-24606070 CAGGGCCTGTCCCTCCAATGGGG - Intergenic
1122637299 14:103136113-103136135 CAGGGCCTGTCCCTGCCTTGGGG - Exonic
1124222456 15:27862345-27862367 CCAGCACTGCCCCTCCTTTGAGG - Intronic
1124403549 15:29373215-29373237 CTGTCACTGTCCCTCCTTGGAGG - Intronic
1124707481 15:31977785-31977807 CTGGAGCTTTCCCTCCTTTGCGG + Intergenic
1124867551 15:33507981-33508003 ACAGGACTCTCCTTCCTTTGAGG - Intronic
1127028986 15:54840708-54840730 CAGAGACTGCCACTCCTTTGTGG - Intergenic
1128131257 15:65228561-65228583 CCTGGACTCCCCCTCATTTGGGG - Intergenic
1128930725 15:71702845-71702867 CACGGACTCTGCCTCCTTTGAGG - Intronic
1129676968 15:77636949-77636971 GCGGGACAGTCCCTTCTTGGAGG + Intronic
1132196409 15:99917561-99917583 CAGGGACTGTCCCTCCCGGGAGG - Intergenic
1132579400 16:678175-678197 CTGGGACAGGGCCTCCTTTGAGG - Exonic
1132832142 16:1933619-1933641 CAGGCACTGCCCCTCCTGTGGGG + Intergenic
1138637525 16:58352885-58352907 CTGGGACTGTCCGTCTTTTACGG - Intronic
1140025764 16:71289231-71289253 CCGGGATGGTCCCTCCCTTTGGG + Intronic
1143205303 17:5136650-5136672 CCTGGACTGTCCCACCATTTGGG - Exonic
1144876350 17:18399343-18399365 CCTGGACTGTCCCGCCATTTGGG - Intergenic
1144888094 17:18477578-18477600 CAGGGACTGTCCCTGCAGTGTGG + Intronic
1145144111 17:20466725-20466747 CAGGGACTGTCCCTGCAGTGTGG - Intronic
1145155877 17:20545077-20545099 CCTGGACTGTCCCGCCATTTGGG + Intergenic
1147143686 17:38473485-38473507 GCGGGACTGGCGCTCCTCTGTGG + Intronic
1147560820 17:41507843-41507865 CCGTGACATTCCTTCCTTTGCGG + Intergenic
1150460654 17:65347548-65347570 CCGGGACTATCCCTCCTCTGAGG - Intergenic
1151570032 17:74921484-74921506 CCGGAGCTCTCCCTCCCTTGGGG + Intronic
1151810315 17:76436521-76436543 CTGGGACTTTCCCTCCTTGCTGG + Intronic
1152593739 17:81228169-81228191 CACCGCCTGTCCCTCCTTTGAGG + Intergenic
1157999803 18:52604562-52604584 CTGTGCCTGTCCCTTCTTTGTGG + Intronic
1158675377 18:59513386-59513408 CTGGACTTGTCCCTCCTTTGGGG - Intronic
1160665315 19:325424-325446 CCAGCTCTGTCCCTCCCTTGGGG - Intronic
1163032650 19:14554396-14554418 CCGGGTCTGCCCCTCTTCTGGGG + Intronic
927606339 2:24490752-24490774 CCGGGCCTGTCCCTCCACTCGGG - Intergenic
937906631 2:127055764-127055786 CCGGGACTGTCCCTCCATGCAGG + Intronic
938421577 2:131151455-131151477 CAGGAGCTGTCCCTCCTCTGTGG + Intronic
939899508 2:147835126-147835148 CTTGGACTCTCCCTCCTTGGTGG + Intergenic
948815178 2:240506848-240506870 CCTGGAGTGTCCCTCCCATGTGG - Intronic
1168924389 20:1567215-1567237 CTGGGGCTTTCTCTCCTTTGAGG + Intronic
1170713475 20:18812359-18812381 CCAAAAATGTCCCTCCTTTGAGG - Intronic
1171280263 20:23890187-23890209 CTGGGCCTGTCTCTCCTTTCTGG - Intergenic
1174463482 20:50699486-50699508 CCGGGCATGGCCCTCCCTTGAGG - Intergenic
1175251460 20:57612542-57612564 CAGGGAGTGTCCCGACTTTGGGG + Intronic
1175479419 20:59300819-59300841 CCGGGGCTGTGGCTCCTTTTCGG + Exonic
1176885421 21:14249702-14249724 CTGGGACTGTCTGTCCTATGTGG + Intergenic
1177076333 21:16579185-16579207 CCAGGACTCTGGCTCCTTTGAGG + Intergenic
1179557779 21:42191414-42191436 CTGGGACTGTCCCAGCTATGTGG + Intergenic
1179640849 21:42746405-42746427 CCGGGAAGGTCCCTCCCCTGGGG - Intronic
1179991909 21:44952669-44952691 ACGGGACCCTCCCTCGTTTGGGG + Intronic
1180563787 22:16645840-16645862 CTGCAACAGTCCCTCCTTTGGGG + Intergenic
1181003124 22:19997301-19997323 CAGCAACTGTCCCTCCTCTGTGG + Intronic
1181312601 22:21953200-21953222 CTGGGACTGTGCCTCCTTCCCGG - Intergenic
1181740768 22:24919731-24919753 CCGGGATTTTCCCACCTTGGGGG + Intronic
1183119958 22:35722642-35722664 CAGGGAATGTCCCTCCTTTTTGG + Intronic
1183206262 22:36421284-36421306 CCAGGATTTTCCCTCCTGTGTGG + Intergenic
1184409002 22:44315923-44315945 CCCGGACTGTGAATCCTTTGAGG - Intergenic
1184429956 22:44436827-44436849 CAAGCACTGTCCCTCCTATGAGG - Intergenic
951081019 3:18449818-18449840 CCGGGAGTGTCTGTCCTATGTGG - Intergenic
952958487 3:38575422-38575444 CCGGCGCTGTCCCTGCTGTGCGG - Exonic
955412788 3:58666811-58666833 CAGGCTCTGCCCCTCCTTTGAGG + Exonic
956165331 3:66394240-66394262 AAGGGAGTGTCCCTCCTTTGCGG - Intronic
961820403 3:129572860-129572882 CCGGGACTTGCCCTCCTTAGAGG + Exonic
962897041 3:139724918-139724940 CCAGGACTGCCCCTACTCTGGGG + Intergenic
967100249 3:186210232-186210254 CCAGGGCTGTCCCTCACTTGTGG + Intronic
968751662 4:2393067-2393089 CTGCGTCTGCCCCTCCTTTGAGG + Intronic
968985738 4:3873473-3873495 CCGAGAGTGACCCTCCTCTGGGG - Intergenic
969518209 4:7660501-7660523 ATGGGACTCTGCCTCCTTTGGGG - Intronic
970550833 4:17179338-17179360 CTGGGACTGTTCCTGCTTAGGGG - Intergenic
970554140 4:17214719-17214741 CAGGGCCTGTCCCTTCTTGGGGG - Intergenic
970904733 4:21202639-21202661 CCTGGACTGTCACTGCTCTGGGG - Intronic
976645617 4:87384602-87384624 CTGGGAATGTCCGTCCTATGTGG + Intronic
981651263 4:147061612-147061634 CAGGGACTGGCCTTGCTTTGAGG + Intergenic
982098054 4:151941523-151941545 CCGGAATTGTCCTTCCATTGAGG - Intergenic
985630490 5:1011498-1011520 CCAGGACTGGCCCTCCTCAGTGG - Intronic
986026276 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG + Intergenic
987622105 5:20347603-20347625 CAGGGACTGTCCCAACTTAGGGG + Intronic
995105162 5:108369302-108369324 TCGAGTCTGTCCCTCCTTTCTGG + Intronic
996591185 5:125149450-125149472 CCAGCTCTGTCTCTCCTTTGTGG + Intergenic
999388744 5:151174605-151174627 CTGGGACTCTGCCTCCTTTGTGG + Intergenic
999549634 5:152672150-152672172 TTGGGACTGTCCCTTCTGTGAGG + Intergenic
1001961348 5:175882048-175882070 CCTGGTCTGTCCCTTCTTTGGGG + Exonic
1004740309 6:18453806-18453828 CAAGGACTGTTCCTCCTGTGTGG - Intronic
1006115953 6:31776351-31776373 CCGGGACTGTCCCTCCTTTGTGG - Intronic
1007110386 6:39310282-39310304 CCTGGACTAACCCTCCTCTGCGG - Intronic
1007777981 6:44234329-44234351 CCAGGCCTGTCCCTCCCCTGTGG - Intergenic
1016445104 6:144123586-144123608 CCGGGTCTGTTCCTCTTCTGTGG - Intergenic
1017119200 6:151007701-151007723 CCCGGATTATCCCTCTTTTGGGG + Intronic
1019587947 7:1815019-1815041 CCGGAGCTGCCCCACCTTTGAGG + Intergenic
1020365542 7:7377359-7377381 CCTGGACTGTGAATCCTTTGAGG - Intronic
1025806683 7:64839519-64839541 CCCGGACTGGCCTTCCCTTGAGG + Intergenic
1028697425 7:93731242-93731264 CCATCACTGTACCTCCTTTGTGG - Intronic
1039848290 8:41341843-41341865 CCGGGAATGTCTCTGCTCTGAGG + Intergenic
1046903551 8:119547829-119547851 CCTGGGCTCTCCCTGCTTTGTGG - Intergenic
1047857397 8:128926594-128926616 CCTGGATTGTCCCTTCTTTTGGG - Intergenic
1049570635 8:143368841-143368863 CCCCGACTGTCCCTCCTGAGTGG - Intronic
1053427925 9:38023199-38023221 CCTGGACTGTCCCTGCCTGGCGG - Intronic
1056933209 9:90895768-90895790 CCGGGACTGCCTTTGCTTTGTGG - Exonic
1059299142 9:113298658-113298680 CCTGGTCTGTCCCTCCTATGGGG + Exonic
1203774690 EBV:66158-66180 CCGGGACAGGGCCCCCTTTGTGG + Intergenic
1186104626 X:6192706-6192728 CTGGGGCTGACCCTCCCTTGTGG + Intronic
1192502597 X:71663747-71663769 CTGGGACTGACTTTCCTTTGGGG - Intergenic
1192528942 X:71870240-71870262 CTGGGACTGACTTTCCTTTGGGG - Intergenic