ID: 1006115957

View in Genome Browser
Species Human (GRCh38)
Location 6:31776367-31776389
Sequence GTCCCGGACCTTTCTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115952_1006115957 -6 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115950_1006115957 1 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115953_1006115957 -7 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1006115951_1006115957 -5 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115957 Original CRISPR GTCCCGGACCTTTCTAAGGA GGG Intronic
907519625 1:55014717-55014739 ATCCCAGACTTTTCTGAGGATGG - Intergenic
912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG + Intergenic
1068295436 10:55065406-55065428 CAACAGGACCTTTCTAAGGAGGG - Intronic
1069744097 10:70703888-70703910 GCCCCTGGTCTTTCTAAGGAAGG - Intronic
1081674688 11:44961929-44961951 GTCTCTGTCCTCTCTAAGGAGGG + Intergenic
1085763013 11:79258476-79258498 GTCCTGGCCCTTACCAAGGAAGG - Intronic
1095894554 12:47267350-47267372 GTCCCAGAAATTGCTAAGGAGGG + Intergenic
1098139556 12:67437827-67437849 GTCCCAGACCTGTCTATGGCTGG - Intergenic
1112935669 13:104795027-104795049 CTCCCGGATCTTGCTAAGGCAGG + Intergenic
1122054270 14:99081988-99082010 GTCCCGCAGTTTTCTCAGGATGG - Intergenic
1136060844 16:27725381-27725403 GTTCCAGATCTTTCTCAGGACGG - Intronic
1138427528 16:56945999-56946021 GTCCTGGGCCATTCTCAGGAAGG - Intergenic
1140640768 16:76969703-76969725 ATCCAGGACCTTTCAAAGAACGG - Intergenic
1152986631 18:327395-327417 GGCCCGGACAGTTCCAAGGATGG - Intronic
1154041561 18:10860831-10860853 TTCCCTGACCTGTCTTAGGAAGG + Intronic
1162495783 19:11022677-11022699 GCCCTGGACCTGTCTAAGGTGGG - Intronic
1164257916 19:23545366-23545388 ATCCTGGACCTTTCTACAGAGGG - Intronic
1165358193 19:35317045-35317067 GTGCCGGTCCCTCCTAAGGATGG - Intergenic
1168489637 19:56797402-56797424 CTCTCTCACCTTTCTAAGGATGG - Intronic
937413619 2:121697357-121697379 TTCAGGGACCTTTCTAAGGAAGG + Intergenic
937438299 2:121897029-121897051 CTCCCGGACCTTGCAAAGGCGGG + Intergenic
948580697 2:238985864-238985886 GTCTCGGAGCTTTCTTGGGAGGG - Intergenic
1171049186 20:21839742-21839764 GTTCCTGAACTTTCTATGGAGGG - Intergenic
1173571347 20:44078600-44078622 TTCCAGGCCCTTTCTAAGAAAGG + Intergenic
1184654264 22:45933247-45933269 GTCTCGGACCTTGCTGGGGAGGG - Intronic
1185065769 22:48631064-48631086 CGCCCTGTCCTTTCTAAGGACGG + Intronic
953498939 3:43414008-43414030 GACCGAGACCTTTCCAAGGAAGG + Intronic
962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG + Intronic
969299703 4:6290724-6290746 AGCCCAGCCCTTTCTAAGGAAGG - Intronic
975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG + Intergenic
975722606 4:77262817-77262839 GTCCCTGACCTTTCTGTGGTAGG - Intronic
976073305 4:81267410-81267432 GTCCTGGACCTTTCTATGATGGG + Intergenic
986061061 5:4191805-4191827 GTGCAGGGCCTTTCTGAGGAGGG + Intergenic
987460780 5:18207037-18207059 GTCCCTGATCTTTCTTGGGATGG + Intergenic
1001313866 5:170629403-170629425 GTCCGGGACCCCTCTAAGGGTGG - Intronic
1004252710 6:14035027-14035049 GTCCAGGACCATTCTTAGCAGGG - Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1013167689 6:107608373-107608395 GTCCCGGTCCTTTCTTGGGAAGG + Intronic
1014279832 6:119429466-119429488 GTCACTGACCTACCTAAGGATGG - Intergenic
1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG + Intergenic
1024342239 7:48278674-48278696 GTCCCAGACATTTCTAAGAGGGG - Exonic
1028934034 7:96445665-96445687 GTCCTAGACTTTTCTAAGAATGG + Intergenic
1029460626 7:100692129-100692151 GACCTGGCCCTTTCTCAGGATGG + Intergenic
1036651828 8:10649098-10649120 ATCCGGGAATTTTCTAAGGAAGG - Intronic
1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG + Intronic
1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG + Intronic
1060222168 9:121770330-121770352 CTCCCGGACATTTCTAGGGCAGG - Intronic
1189712442 X:43827383-43827405 GTCTAGTACCTTTGTAAGGAGGG + Intronic