ID: 1006115963

View in Genome Browser
Species Human (GRCh38)
Location 6:31776384-31776406
Sequence GGAGGGGGACTCCTAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115959_1006115963 -8 Left 1006115959 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115953_1006115963 10 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115952_1006115963 11 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115951_1006115963 12 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115950_1006115963 18 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115961_1006115963 -9 Left 1006115961 6:31776370-31776392 CCGGACCTTTCTAAGGAGGGGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115963 Original CRISPR GGAGGGGGACTCCTAATTTC AGG Intronic