ID: 1006115963

View in Genome Browser
Species Human (GRCh38)
Location 6:31776384-31776406
Sequence GGAGGGGGACTCCTAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115953_1006115963 10 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115950_1006115963 18 Left 1006115950 6:31776343-31776365 CCTGAGCCCCACAAAGGAGGGAC 0: 1
1: 1
2: 0
3: 18
4: 200
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115951_1006115963 12 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115952_1006115963 11 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115961_1006115963 -9 Left 1006115961 6:31776370-31776392 CCGGACCTTTCTAAGGAGGGGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1006115959_1006115963 -8 Left 1006115959 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115963 Original CRISPR GGAGGGGGACTCCTAATTTC AGG Intronic
900375385 1:2352008-2352030 GGAGGTGGACCTCTAATTCCTGG - Intronic
902620499 1:17647982-17648004 GCAGGCGGCTTCCTAATTTCAGG + Intronic
911995791 1:104764714-104764736 TGTTGAGGACTCCTAATTTCAGG - Intergenic
913572167 1:120131700-120131722 GGAGGGAGACTCCCGATTGCAGG - Intergenic
914293087 1:146293344-146293366 GGAGGGAGACTCCCGATTGCAGG - Intergenic
914554131 1:148744127-148744149 GGAGGGAGACTCCCGATTGCAGG - Intergenic
915170950 1:153977051-153977073 GGAGGGGGTGCCCTATTTTCTGG - Intronic
917212151 1:172642217-172642239 GGAGGGGGAGAACCAATTTCAGG - Intergenic
920291849 1:204929089-204929111 GGAGGGGGACACCTGGTTTTAGG - Intronic
923800721 1:237205849-237205871 GGAGGAGGACGCCTACTGTCTGG + Intronic
1063534464 10:6869887-6869909 GGATGGGGACTCATCATTTATGG + Intergenic
1068627542 10:59265328-59265350 GGGGGGGGAATCCTGGTTTCAGG + Intronic
1069719702 10:70541581-70541603 GGAGGAGGACTCCTGCTTGCCGG + Intronic
1071596826 10:86933921-86933943 GGGGGGGGGGTCCTAATTTTAGG + Intergenic
1083340273 11:61954900-61954922 GGAGGGGGCCTCCTCCTGTCCGG + Intronic
1097042267 12:56162935-56162957 GGTGGGGAAAACCTAATTTCGGG - Intronic
1098177332 12:67806301-67806323 GGAGGGGCACTACTAATTTAAGG + Intergenic
1102747837 12:115265573-115265595 GGAGGAGGCCTTCTAACTTCTGG - Intergenic
1103029465 12:117600895-117600917 GGCTGGGGACTCCTATGTTCCGG + Intronic
1108467728 13:50734134-50734156 AGAGCAGGACTCCTAATTTGCGG - Intronic
1108791430 13:53973156-53973178 GGAGGAGTACTCCCAAGTTCAGG + Intergenic
1112405547 13:99116930-99116952 AAAGGGGGATTCCTAAATTCTGG + Intergenic
1113766659 13:112885819-112885841 GGAGGGGGACTCTTCATCCCAGG - Exonic
1113881194 13:113627619-113627641 GGTTGGGGACTCCTGATTTAAGG - Intronic
1114598333 14:23933525-23933547 GGAGGGGGCCTCCTCACTGCTGG + Intergenic
1117665603 14:58052966-58052988 TAAAGGGGACTCCTAGTTTCTGG - Intronic
1125966323 15:43878455-43878477 GGACAGAGACTCTTAATTTCAGG - Intronic
1128693541 15:69743711-69743733 GGAGCGGTCCTCCTCATTTCAGG + Intergenic
1131784744 15:95900008-95900030 GGAGGGGGACTCCCAAATCTAGG + Intergenic
1132988241 16:2779169-2779191 GGATGGTGACTCCTGGTTTCTGG - Intergenic
1146257921 17:31402290-31402312 GGATGGGGACTGGTATTTTCAGG + Intronic
1147840415 17:43367657-43367679 GGAGGTGCATTGCTAATTTCTGG - Intergenic
1149989786 17:61376500-61376522 GGAGAGCGATTCCTACTTTCAGG - Intronic
1151821194 17:76497833-76497855 GGAGGAGGATTCCAAACTTCAGG - Intronic
1161391118 19:4020950-4020972 GGAGTGGGATTCCTGATTCCTGG + Intronic
1165453694 19:35899243-35899265 CGCTGGGGACTCCTGATTTCCGG - Intronic
926795421 2:16615342-16615364 GGAGAGGAACTCCGGATTTCGGG - Intronic
927413363 2:22851727-22851749 AGTTGGGGACTCCTAAATTCAGG - Intergenic
931560372 2:63554978-63555000 TGAGGGGATCTCCTAATTTGTGG - Intronic
937770036 2:125709934-125709956 GGAGGGGGACTGCTTACTTAAGG + Intergenic
940105822 2:150098890-150098912 GGAGAGGAAGTCCTCATTTCAGG - Intergenic
1169308213 20:4512804-4512826 GGAGGGTTACTCTTAGTTTCTGG - Intergenic
1172062089 20:32193546-32193568 GGAGGGGGACAGCTCATTGCTGG + Exonic
1172912450 20:38420057-38420079 TGAGGGGTACTCTTAAGTTCAGG - Intergenic
1180254612 21:46616644-46616666 GGAGTTGCAATCCTAATTTCAGG - Intergenic
1181549841 22:23631562-23631584 GGATGGGGACTCCAAAATTGGGG + Intronic
1181798551 22:25327965-25327987 GGATGGGGACTCCAAAATTGGGG - Intergenic
950077933 3:10200380-10200402 GGAATGGGACACCTGATTTCAGG - Exonic
953459487 3:43071358-43071380 AGAGGGGGTCTCCAGATTTCAGG + Intergenic
956129707 3:66041453-66041475 GGTAGGGGACTCCTAATTCAAGG - Intergenic
963923246 3:150925584-150925606 GGAGGGGCACTCCTTACATCCGG - Intronic
965946012 3:174242225-174242247 GGATGGGGACCCCTGATTTATGG - Intronic
982555201 4:156852779-156852801 GGAGGGTGATTCTTTATTTCTGG + Intronic
985937531 5:3108353-3108375 GGAGGCTGACTCCTAAATTTTGG - Intergenic
986681356 5:10235700-10235722 GGAGGGGGACTCAAATTTTAAGG - Intronic
986823763 5:11498044-11498066 GGCTGGGGAGTCCTGATTTCAGG - Intronic
989991739 5:50774719-50774741 GCAGAGGCACTCCTCATTTCCGG + Intronic
992781502 5:80132286-80132308 GGAGGGGGTCTAGGAATTTCAGG - Intronic
993482970 5:88448067-88448089 GGAGAAGGATTTCTAATTTCTGG - Intergenic
996587570 5:125107643-125107665 AGAGGGTGTCTCCTTATTTCTGG + Intergenic
999340532 5:150766708-150766730 AGAGGGAGACTAGTAATTTCAGG + Intergenic
1002055896 5:176597717-176597739 GGATGGGGACTCCGTTTTTCTGG + Exonic
1006115963 6:31776384-31776406 GGAGGGGGACTCCTAATTTCAGG + Intronic
1006903334 6:37516848-37516870 GTGGGGGGACTCCTGATTTGGGG - Intergenic
1020689801 7:11339942-11339964 GGATGGAGACTCCTCATTGCTGG + Intergenic
1022529097 7:31056158-31056180 GGAGAGGGGCTCCTTATCTCAGG + Intronic
1022754531 7:33271547-33271569 GGAGCTGCAATCCTAATTTCAGG + Intronic
1025265913 7:57456817-57456839 GGAGGGGGACTCTGGATGTCTGG + Intronic
1029112782 7:98222258-98222280 GGAGGGGGACTCCCACTTCTGGG + Intronic
1035665969 8:1379806-1379828 GGTGGGGGTCTGCTGATTTCGGG + Intergenic
1035962753 8:4156115-4156137 GCAGAGGGACTCTTAATGTCAGG - Intronic
1036228434 8:6980130-6980152 GGATGAGGTGTCCTAATTTCCGG + Intergenic
1036230887 8:6999240-6999262 GGATGAGGTGTCCTAATTTCCGG + Intronic
1036233333 8:7018339-7018361 GGATGAGGTGTCCTAATTTCCGG + Intergenic
1048366652 8:133744355-133744377 GGAGAGGGACTCCAAATATAGGG - Intergenic
1048500334 8:134969528-134969550 CCAGGAGGACTCCTAGTTTCAGG + Intergenic
1048802091 8:138203635-138203657 GGAGGGGGACTACTGCTTTAAGG - Intronic
1060777812 9:126389204-126389226 GCAGGGGGTCTCTTCATTTCTGG + Intronic
1062588857 9:137263930-137263952 GGAGGGTGACTCCCAAGTCCCGG - Intronic
1187275742 X:17815419-17815441 GGAGGGAGAATCCTGATTTAAGG - Intronic
1190991183 X:55552147-55552169 GGAGAGGGGCTCCTCATTACTGG - Intergenic
1193353872 X:80493970-80493992 GGAGAGGGAATCCTAATGTCAGG + Intergenic
1196840168 X:119852599-119852621 GGAGGGGCTCTCCCCATTTCGGG + Intronic
1198119836 X:133580979-133581001 CGAGTGGAACTCCTAATATCAGG - Intronic
1198420973 X:136470515-136470537 GGAGAAGGACTCCAAATTTCAGG - Intergenic