ID: 1006115965

View in Genome Browser
Species Human (GRCh38)
Location 6:31776398-31776420
Sequence AATTTCAGGACCAAGACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115953_1006115965 24 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1006115961_1006115965 5 Left 1006115961 6:31776370-31776392 CCGGACCTTTCTAAGGAGGGGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1006115951_1006115965 26 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1006115952_1006115965 25 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1006115959_1006115965 6 Left 1006115959 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1006115962_1006115965 0 Left 1006115962 6:31776375-31776397 CCTTTCTAAGGAGGGGGACTCCT 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115965 Original CRISPR AATTTCAGGACCAAGACTAC TGG Intronic
905785932 1:40757594-40757616 AATTTCAGGATCGAGAGCACTGG - Intronic
907266306 1:53263637-53263659 GATTTGAGGACCAAGATCACTGG - Intronic
912239527 1:107891055-107891077 AATTTCTGTACAAAGACCACTGG + Intronic
920840173 1:209547341-209547363 ACTTTCTGGACAAAGAGTACAGG - Intergenic
922923545 1:229329083-229329105 ATCATCAGGACCAAGACTAAAGG + Intronic
923078352 1:230630285-230630307 AATTTCAGGATCAAGAAATCGGG - Intergenic
924405950 1:243745917-243745939 ATTTTCAGGATGAATACTACGGG - Intronic
1065140019 10:22711384-22711406 ATTTTCAAGACCTTGACTACAGG - Intronic
1070445040 10:76490549-76490571 GATTTCAAGACAAAGACTATAGG - Intronic
1071724851 10:88187976-88187998 CATTTCAGGACCAATATTGCAGG - Intergenic
1071823866 10:89304814-89304836 ATTTTGAGGACCAACACTAAAGG + Intronic
1073250724 10:102119177-102119199 AATTCCAGGACCCAGAGTCCCGG + Intronic
1074680953 10:115906727-115906749 AATTTCAGCACCTAGAGTACAGG + Intronic
1076061231 10:127415866-127415888 AATGTCAGGGCCAAGGCAACTGG + Intronic
1079884614 11:25971512-25971534 AATGTCTGGACCAAGAGTATAGG + Intergenic
1083054771 11:59809554-59809576 GATTTCAGGCCAATGACTACTGG + Intronic
1087169546 11:95037393-95037415 AATTTCAGGCCGAATACTCCAGG - Intergenic
1087172681 11:95067030-95067052 AATTTCAGGCCAAATACTCCAGG - Intergenic
1087971149 11:104485919-104485941 AATTGCAGGACAAATACGACAGG + Intergenic
1088052725 11:105537819-105537841 TATTTCAGGGCGAAGACTGCGGG - Intergenic
1089586962 11:119515933-119515955 AATTGCAGGACTAAGCCTAGCGG + Intergenic
1101790948 12:107927366-107927388 AATTTCAGTACCAGGTCTGCTGG - Intergenic
1103955954 12:124577020-124577042 AAATTCAGGACCAAGTCCATCGG + Intergenic
1105279207 13:18953403-18953425 AAACTCAGGACCAGGGCTACAGG + Intergenic
1109355248 13:61225864-61225886 AATTTTAGGAACAATATTACAGG + Intergenic
1114035689 14:18625026-18625048 AATCTGATGACCAAAACTACAGG - Intergenic
1114122948 14:19689996-19690018 AATCTGATGACCAAAACTACAGG + Intergenic
1114636384 14:24189188-24189210 AAAATCAGGACCAAAACTAAAGG + Exonic
1115421497 14:33199798-33199820 AATTTCAGTAGCACTACTACTGG + Intronic
1116211921 14:41957866-41957888 AGTTACAGGAGCAAGACTATTGG - Intergenic
1116660733 14:47707436-47707458 AATTTCAGGACTAAAACATCAGG - Intergenic
1117115037 14:52502567-52502589 AATTTCAAAACTAATACTACAGG + Intronic
1126624883 15:50677119-50677141 AAGTTCAGGATCAAGATTCCAGG + Intronic
1127813996 15:62590576-62590598 AGTTTCAGTTCAAAGACTACTGG - Intronic
1129248353 15:74293698-74293720 CACTTCATGACCAAGACTCCTGG - Intronic
1130045401 15:80440434-80440456 AATTTCAGCACAGAGATTACAGG + Intronic
1131775501 15:95792760-95792782 AATATTATGACCAAGACTATCGG + Intergenic
1134016081 16:10889374-10889396 AAATTCAGGCCCAAGACTCTAGG - Intronic
1140548824 16:75840809-75840831 AATTTCCGAAACAAGACTAATGG - Intergenic
1140587947 16:76316479-76316501 AAATCCAGGACCATGACTGCTGG - Exonic
1140905744 16:79407516-79407538 AATTGCAGGAACACGATTACAGG - Intergenic
1149405573 17:56346880-56346902 AATTCCAGAACCAAAACTATAGG - Intronic
1149784882 17:59426253-59426275 TATTTCAGGCCAAAGACTCCAGG - Intergenic
1150966375 17:69973789-69973811 CATTCCAGGACCCAGACTAATGG + Intergenic
1153167626 18:2280383-2280405 ATTTTCATTATCAAGACTACAGG + Intergenic
1153921751 18:9797587-9797609 AAGCTCAGGACCCAGACTGCTGG - Intronic
1155767763 18:29656718-29656740 AAATTCAGCACTTAGACTACTGG - Intergenic
1159239650 18:65725275-65725297 AATTTCATGACAGAGAGTACAGG - Intergenic
1167445329 19:49534024-49534046 AATTTCGGGACCAAGCCCACCGG - Intronic
925404669 2:3598254-3598276 AATTTCAGGACAATGACAGCAGG + Intronic
925792453 2:7505964-7505986 ATTTTCAGGACCAAGAATAAAGG - Intergenic
926282536 2:11461717-11461739 AATTTCAGCCCCATGGCTACAGG + Intronic
928706022 2:33950595-33950617 GATTCCAGGACCAAGAATAAAGG - Intergenic
931238557 2:60432665-60432687 GGATTCAGGACCAAGACTCCCGG - Intergenic
933815437 2:86064517-86064539 AATTACATGCCCAAGACTACAGG - Intronic
933848355 2:86345286-86345308 AGTTCCAGGACCAAGGCTGCAGG - Intergenic
938274708 2:130007951-130007973 AATCTGATGACCAAAACTACAGG + Intergenic
938440661 2:131329327-131329349 AATCTGATGACCAAAACTACAGG - Intronic
941308731 2:163903256-163903278 AATTTAAGAACTAAAACTACAGG + Intergenic
941749364 2:169119001-169119023 TATTTGAGCACCAAGAATACTGG - Intergenic
941863817 2:170312998-170313020 AATTGAAGGACCTAGACAACTGG + Intronic
946538096 2:220653168-220653190 AAGATCATGACCAAGGCTACTGG - Intergenic
1175366966 20:58462165-58462187 AATTCCAGGACCAAGCAGACTGG - Intronic
1179155558 21:38848004-38848026 AATTTAAGGATCAAGTGTACTGG + Intergenic
1180459811 22:15552080-15552102 AATCTGATGACCAAAACTACAGG - Intergenic
952553708 3:34507951-34507973 GCTTTCAGGACCTTGACTACAGG - Intergenic
954343146 3:49972051-49972073 AATTTAAGGATCAAGATTATAGG + Exonic
954512546 3:51139038-51139060 CATTTAGGGACCAAGACTAATGG + Intronic
955229329 3:57085028-57085050 CATGTCAGGACCTAGACTAGAGG + Intergenic
956539451 3:70319363-70319385 ATTTTCAAGCCTAAGACTACAGG - Intergenic
958034019 3:88149540-88149562 AATTTAAGGAACCAAACTACCGG + Intronic
958864996 3:99489683-99489705 GATTTCAGGACAAAAACTATAGG + Intergenic
970430601 4:15985608-15985630 ATGTGCAGGACCAAGACTTCTGG - Intronic
972521935 4:39866819-39866841 AATTTCAGCACTAAGAAAACTGG + Intronic
973014103 4:45115088-45115110 AATTTCAGGAACAGGATTTCTGG - Intergenic
973125208 4:46574418-46574440 CATTTCAGGACCAAGAGTGAAGG - Intergenic
977626800 4:99196708-99196730 AAATAAATGACCAAGACTACAGG - Intergenic
977847427 4:101782004-101782026 AATTTCAGCCCTATGACTACAGG + Intronic
978132787 4:105219977-105219999 AATATCAGGTCCAAGAAGACAGG + Intronic
978426177 4:108584979-108585001 AATTTCAGAACCAAGAAGGCAGG - Intergenic
979167823 4:117558617-117558639 ACTTTCTGGCCCAAGATTACTGG - Intergenic
980199965 4:129643472-129643494 ATTTTTAGGACCAAGACCAAGGG - Intergenic
986557669 5:9027429-9027451 ACTTGCAGGACCAATACCACAGG - Intergenic
987504336 5:18749449-18749471 AATATCAGGACCCACACCACTGG - Intergenic
992726187 5:79609577-79609599 AAATAAATGACCAAGACTACAGG - Intergenic
994023634 5:95056810-95056832 AAATCCAGGAGCAAGACTATGGG - Intronic
997035431 5:130185229-130185251 CATTTCAAGACCAAGACCTCTGG - Exonic
999957155 5:156715154-156715176 AATTTCAGGACCAAGACAAGTGG - Intronic
1005579868 6:27223488-27223510 AATTTAAGGACACAGACTGCAGG - Intergenic
1005764785 6:29000297-29000319 TATTCCAGGACAAAGACCACAGG - Intronic
1005979854 6:30828515-30828537 CATTTCAGGACAGAGAATACCGG + Intergenic
1006115965 6:31776398-31776420 AATTTCAGGACCAAGACTACTGG + Intronic
1011198674 6:84809890-84809912 AATTGCAGAATCAAGACCACTGG + Intergenic
1011342642 6:86334315-86334337 AATTTCTAGACCAAGATTATAGG - Intergenic
1013453781 6:110311124-110311146 AATTTCAGGACCACCAATTCTGG + Intronic
1013617942 6:111862075-111862097 ACTTTCAGGCCCAACAATACTGG + Intronic
1017189087 6:151632444-151632466 AAATTCAGAAGCATGACTACTGG + Intergenic
1018392083 6:163348313-163348335 AATGACAGGACGATGACTACAGG + Intergenic
1020617079 7:10472552-10472574 AGTTTCAGGGCCAAGACAAAGGG - Intergenic
1022596430 7:31717863-31717885 CATTTCAGGTCCTAGACTACTGG - Intergenic
1024195194 7:47052597-47052619 AATTTCAGGCCAAATACTCCAGG - Intergenic
1031566706 7:123307515-123307537 AATTTCAGTACAAGGACTGCTGG - Intergenic
1033979006 7:147140580-147140602 AATTTGATGACAAAGAATACAGG - Intronic
1034732524 7:153400377-153400399 AATTTCAGAATCAAGACTGTTGG - Intergenic
1036141888 8:6216497-6216519 GATTTCAGGATGAAGACTCCAGG - Intergenic
1039756551 8:40529565-40529587 AACTGCATGACCAAGACTATAGG + Intergenic
1045361596 8:101438205-101438227 AAATTCAGAATCAAAACTACAGG + Intergenic
1046888002 8:119389884-119389906 AATTTCAGGCCCATGACCAGAGG + Intergenic
1048011951 8:130464844-130464866 GATTTCAGCACCAACACCACTGG - Intergenic
1052589302 9:30470868-30470890 AAATTCAGGACCAAAATTACTGG - Intergenic
1057120126 9:92564057-92564079 AATGTAAGGATCAAGTCTACAGG + Intronic
1061998588 9:134204135-134204157 AACTTCAGCACCAAGGCTGCTGG + Intergenic
1062346354 9:136117111-136117133 AACTCCAGCACCAGGACTACGGG + Intronic
1185911370 X:3984189-3984211 AATTACAGAAGCAAGACCACGGG + Intergenic
1188122493 X:26326230-26326252 AATATCTGGACTAAAACTACTGG + Intergenic
1188140213 X:26540966-26540988 AGCTTTGGGACCAAGACTACGGG + Intergenic
1191867403 X:65716089-65716111 AATATCAGGACAAAGAGCACTGG - Intronic
1196927029 X:120643608-120643630 AATTTCAGGTCCAAAACTCAAGG - Intergenic
1199657170 X:150007584-150007606 AATTTCCTGACCTAGAGTACAGG + Intergenic
1200858241 Y:7962070-7962092 CATTTCTGGACCAAGATCACAGG - Intergenic
1200863797 Y:8021000-8021022 AATTTCTGGACCCAGATCACAGG - Intergenic
1200947367 Y:8858568-8858590 AATTTAAGGAGCAAGAAAACAGG + Intergenic
1202246626 Y:22826974-22826996 CATTTCTGGACCCAGATTACAGG + Intergenic
1202399615 Y:24460722-24460744 CATTTCTGGACCCAGATTACAGG + Intergenic
1202471165 Y:25209364-25209386 CATTTCTGGACCCAGATTACAGG - Intergenic