ID: 1006115966

View in Genome Browser
Species Human (GRCh38)
Location 6:31776399-31776421
Sequence ATTTCAGGACCAAGACTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115951_1006115966 27 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115952_1006115966 26 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115962_1006115966 1 Left 1006115962 6:31776375-31776397 CCTTTCTAAGGAGGGGGACTCCT 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115959_1006115966 7 Left 1006115959 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115953_1006115966 25 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115961_1006115966 6 Left 1006115961 6:31776370-31776392 CCGGACCTTTCTAAGGAGGGGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115966 Original CRISPR ATTTCAGGACCAAGACTACT GGG Intronic