ID: 1006115966

View in Genome Browser
Species Human (GRCh38)
Location 6:31776399-31776421
Sequence ATTTCAGGACCAAGACTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006115952_1006115966 26 Left 1006115952 6:31776350-31776372 CCCACAAAGGAGGGACAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115959_1006115966 7 Left 1006115959 6:31776369-31776391 CCCGGACCTTTCTAAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115953_1006115966 25 Left 1006115953 6:31776351-31776373 CCACAAAGGAGGGACAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115961_1006115966 6 Left 1006115961 6:31776370-31776392 CCGGACCTTTCTAAGGAGGGGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115951_1006115966 27 Left 1006115951 6:31776349-31776371 CCCCACAAAGGAGGGACAGTCCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1006115962_1006115966 1 Left 1006115962 6:31776375-31776397 CCTTTCTAAGGAGGGGGACTCCT 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006115966 Original CRISPR ATTTCAGGACCAAGACTACT GGG Intronic
901328032 1:8380855-8380877 CTTTCAGGACCAGGACTCCAAGG - Intronic
902110614 1:14075259-14075281 ATTTCAGCACCAAGACCAAGTGG - Intergenic
902333639 1:15742848-15742870 TGTTCAGGACCAAGACTCCAAGG - Exonic
903004288 1:20288505-20288527 ATTTTAGGACCAAAACTCTTTGG - Intergenic
911493490 1:98599178-98599200 ATTTGAGGATGAAGATTACTTGG - Intergenic
913070785 1:115296549-115296571 ATTTCTGGACCAAGTCACCTTGG + Intronic
916331798 1:163625733-163625755 ATTTCATTACCATGACTGCTGGG - Intergenic
1064403811 10:15042793-15042815 GTTTCTGGAACCAGACTACTTGG + Intronic
1064646819 10:17468170-17468192 ATTACAGAGCCAAGACAACTTGG + Intergenic
1069413729 10:68179294-68179316 ATTTCAGGACCTTGGCTGCTGGG + Intronic
1070983376 10:80667684-80667706 ATTTCAGGCCCAACACTCCAAGG - Intergenic
1082582663 11:54892404-54892426 ATCTCAGGACAAAAACTACAAGG + Intergenic
1082598328 11:55113439-55113461 ATCCCAGGACCAAAACTACAAGG + Intergenic
1087832058 11:102829991-102830013 ATTTCTGGAACAAGATTGCTTGG + Intergenic
1088052724 11:105537818-105537840 ATTTCAGGGCGAAGACTGCGGGG - Intergenic
1088577417 11:111285299-111285321 ATTCTAGGACCCAGACTAATGGG + Intronic
1100586047 12:95980706-95980728 CTTTCAGGCCCTAGACTACTTGG - Exonic
1101448910 12:104758607-104758629 TTTTGAGGGCCAAGACTATTGGG - Exonic
1107679949 13:42838009-42838031 TTTTCAGGATCAACACTGCTTGG + Intergenic
1108345413 13:49541603-49541625 ATTTCAGGACTAAGAATATGAGG + Intronic
1110294608 13:73849161-73849183 ATTTCAGGAGTAAGACTTTTGGG - Intronic
1110877176 13:80524276-80524298 ATTTCAGAACCCTGACTGCTAGG - Intergenic
1110907735 13:80914038-80914060 ATTACATGACCAAGACAAATAGG - Intergenic
1112173233 13:96994642-96994664 ATTTCTGGACCAAGACAAGGCGG - Intronic
1113290847 13:108904566-108904588 TTTTCAGGACCAAAACTTTTTGG - Intronic
1116169164 14:41376418-41376440 GCTTCAGGACCCTGACTACTTGG - Intergenic
1119249117 14:73136800-73136822 ATTTCCGGACCAAGGCTCCCCGG - Intronic
1121019093 14:90568051-90568073 AATTCAGGCCCAAGATGACTTGG + Intronic
1129248352 15:74293697-74293719 ACTTCATGACCAAGACTCCTGGG - Intronic
1136621600 16:31432850-31432872 ATTACAGAACCAGGACCACTAGG + Intronic
1148163140 17:45463139-45463161 CTTTGAGGAAAAAGACTACTAGG + Intronic
1149784881 17:59426252-59426274 ATTTCAGGCCAAAGACTCCAGGG - Intergenic
1155725677 18:29079310-29079332 ATTTCAGTGTCAAGCCTACTAGG + Intergenic
1155767762 18:29656717-29656739 AATTCAGCACTTAGACTACTGGG - Intergenic
1160294616 18:77626270-77626292 ATTTCAGGACATAGAATTCTTGG + Intergenic
925432199 2:3804471-3804493 ATTTGAGGAGGAGGACTACTAGG - Intronic
925545636 2:5012886-5012908 ATTTCAGATCCAAGACACCTTGG - Intergenic
928177604 2:29045488-29045510 ATTTCAGGTCTAAGATAACTGGG - Intronic
928706021 2:33950594-33950616 ATTCCAGGACCAAGAATAAAGGG - Intergenic
929953451 2:46435491-46435513 GTTTCAGTACCAGGACAACTTGG - Intronic
930375717 2:50563989-50564011 TTCTCAGGAACAAGTCTACTTGG - Intronic
931238556 2:60432664-60432686 GATTCAGGACCAAGACTCCCGGG - Intergenic
932371245 2:71189988-71190010 ACTGCAGGAGCAAGACTTCTTGG - Exonic
933522318 2:83389425-83389447 ATTTTAAGACCAAGATTATTTGG + Intergenic
934970110 2:98756360-98756382 ATTTCTGGACAAAGACACCTAGG - Intergenic
938684089 2:133720117-133720139 ATTTCAGGAGCAAGAAAACCTGG - Intergenic
939947762 2:148430347-148430369 ATTTCTGGATCCAGACTGCTAGG - Intronic
940719414 2:157265648-157265670 TTTTCAGGGCCAAGAGTACCAGG - Intronic
941863818 2:170312999-170313021 ATTGAAGGACCTAGACAACTGGG + Intronic
945447932 2:209960177-209960199 ATTTCAGGCCCAAGCCAAGTTGG - Intronic
946723030 2:222631531-222631553 ATTTCCGGACCAAGACTAAGTGG - Intronic
947159456 2:227197552-227197574 ATTTCTGGAATAATACTACTTGG - Intronic
1174041385 20:47702439-47702461 AACTCAGGAGCCAGACTACTTGG - Intronic
1175366965 20:58462164-58462186 ATTCCAGGACCAAGCAGACTGGG - Intronic
1175826727 20:61940513-61940535 AGTTCAGGACCAAGACTGTCTGG - Exonic
1179139158 21:38708874-38708896 GTTTCAGGACAAATACTATTAGG + Intergenic
1181442297 22:22942986-22943008 ATTTCCGGATGAAGACTCCTGGG - Intergenic
1183241810 22:36663280-36663302 TTTTGTGAACCAAGACTACTTGG + Intronic
951627652 3:24683663-24683685 ATGGCAGGACCAAGACTACAAGG + Intergenic
952161253 3:30695576-30695598 ATTCCAGTTCCAAGACAACTTGG - Intergenic
959915416 3:111811389-111811411 ATTTCTTCACCAAGACTAATTGG - Intronic
970430600 4:15985607-15985629 TGTGCAGGACCAAGACTTCTGGG - Intronic
971656564 4:29354153-29354175 ATTTCTTGACCAAGAGTATTAGG - Intergenic
978858524 4:113421285-113421307 ATTTCAGAACCAAAAATATTAGG + Intergenic
983819137 4:172171493-172171515 ATTTCATGAACAACACTGCTAGG + Intronic
1000002236 5:157150058-157150080 ATATCAGGATCAAGACTAAGTGG + Intronic
1002558681 5:180064990-180065012 ACTCTAGGACCAAGACAACTTGG - Intronic
1005979855 6:30828516-30828538 ATTTCAGGACAGAGAATACCGGG + Intergenic
1006115966 6:31776399-31776421 ATTTCAGGACCAAGACTACTGGG + Intronic
1007233570 6:40371474-40371496 ATTTCAGGATAAATACCACTTGG + Intergenic
1009360786 6:62810013-62810035 ATTTCAGGAGACAGACTCCTAGG - Intergenic
1009567517 6:65329400-65329422 ATTTAAGAACCAAGATTATTTGG + Intronic
1011784846 6:90832131-90832153 AGTTCAGGACCAAGAGCAATGGG - Intergenic
1013437687 6:110128468-110128490 ATTTCAGGTGCAGGGCTACTTGG - Intronic
1014044406 6:116868316-116868338 ACTTCAGCCCCAAAACTACTAGG + Intergenic
1022798490 7:33752548-33752570 AATTCAGGACTAAAAATACTAGG + Intergenic
1023342775 7:39239580-39239602 ATTTCTGGACCAAGATCATTAGG + Intronic
1023819581 7:43973128-43973150 ATTTCACCACCAGGACTCCTGGG - Intergenic
1029744632 7:102510097-102510119 ATTTCACCACCAGGACTCCTGGG - Intronic
1029762623 7:102609259-102609281 ATTTCACCACCAGGACTCCTGGG - Intronic
1036141887 8:6216496-6216518 ATTTCAGGATGAAGACTCCAGGG - Intergenic
1038467740 8:27781191-27781213 ATATCAGGACCTAGAGTAGTAGG - Intronic
1039390962 8:37180477-37180499 AATCCAGGACTAAAACTACTGGG - Intergenic
1051596444 9:18828931-18828953 ATTTCAAGAGCAATACTCCTGGG + Intronic
1052589301 9:30470867-30470889 AATTCAGGACCAAAATTACTGGG - Intergenic
1054868323 9:70025608-70025630 CTTTCAGGACCAACACTACATGG + Intergenic
1058603782 9:106698963-106698985 ATATAAGGACCCAGACTACCAGG + Intergenic
1061998589 9:134204136-134204158 ACTTCAGCACCAAGGCTGCTGGG + Intergenic
1186217943 X:7319733-7319755 CTTTCAGGACATAGACAACTTGG + Intronic
1190891220 X:54570312-54570334 ATTTCAGAACAAAGAATACAAGG - Intergenic
1191867402 X:65716088-65716110 ATATCAGGACAAAGAGCACTGGG - Intronic
1192119377 X:68440433-68440455 ATTTCAGGACAAAGACCTTTAGG - Intergenic
1193429611 X:81385391-81385413 ATTTCATGACTAAAACTCCTGGG - Intergenic
1194063398 X:89233042-89233064 ATTTCATGCCCAAGATTACCAGG + Intergenic
1201749726 Y:17419749-17419771 ATTGCAGGAACTAGAATACTGGG - Intergenic
1202092168 Y:21204067-21204089 ATTACAGAACTAAGAGTACTTGG - Intergenic