ID: 1006116075

View in Genome Browser
Species Human (GRCh38)
Location 6:31776840-31776862
Sequence CCCGCAGAGCCGGCCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006116075_1006116083 27 Left 1006116075 6:31776840-31776862 CCAGGGCAGGCCGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 33
4: 268
Right 1006116083 6:31776890-31776912 AAGTCGTGTCTGCTCCAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006116075 Original CRISPR CCCGCAGAGCCGGCCTGCCC TGG (reversed) Intronic
900146523 1:1161128-1161150 CTCCCAGAGCGGCCCTGCCCAGG + Intergenic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900246396 1:1638157-1638179 CCAACAGAGCCGGCCTCACCTGG + Intronic
900257625 1:1705299-1705321 CCAACAGAGCCGGCCTCACCTGG + Intronic
900284160 1:1891273-1891295 CCCGCAGGGCCGGGCCGCCGGGG - Intergenic
900427690 1:2587907-2587929 CCACCAGAGCCGCCTTGCCCAGG - Intronic
900473047 1:2863875-2863897 CCCCCAGAGCCGGCCCTGCCCGG - Intergenic
900956123 1:5887433-5887455 CCTGCACAGCCGGCCGGCCTTGG + Exonic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
901234774 1:7661881-7661903 CCCGTGGCGCCCGCCTGCCCCGG - Intronic
902872705 1:19324172-19324194 CCTGGAGACCCGGCGTGCCCAGG + Intronic
903269355 1:22178019-22178041 CCCGCACCCCCTGCCTGCCCAGG + Intergenic
903486339 1:23691875-23691897 CCCGCAGGCTCGGCCTGCCATGG - Intronic
903554191 1:24181164-24181186 TCCCCAGAGCCTGCCTGCCATGG + Intronic
903646013 1:24896923-24896945 CCCACAGAAAGGGCCTGCCCTGG - Intergenic
903869063 1:26419170-26419192 CCCACAGAGCCAGCCTCCCAGGG - Intronic
903968474 1:27103916-27103938 CCTCCAGAGCCAGCCTGCCTGGG - Intronic
904490185 1:30853771-30853793 CCAATAGAGCTGGCCTGCCCTGG + Intergenic
905390186 1:37631153-37631175 CCAGCAGAGCCCACCTGCACGGG + Intronic
905726719 1:40258421-40258443 CCCCCATACCCGGCCAGCCCTGG + Intronic
907551446 1:55308473-55308495 CCCTCAGAGCTGCCCAGCCCAGG - Intergenic
910676544 1:89821545-89821567 CCCGCAGGGCCGGCCGCCCGGGG - Intronic
911092912 1:94031884-94031906 CCCCCAGAGCCAGAGTGCCCAGG - Exonic
912497074 1:110098555-110098577 ACCGCCCAGCCTGCCTGCCCTGG + Intergenic
915343825 1:155189529-155189551 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915343844 1:155189589-155189611 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344043 1:155190069-155190091 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344064 1:155190129-155190151 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344127 1:155190309-155190331 CCCAGAGAGCAGGCCGGCCCCGG - Intronic
915541904 1:156572650-156572672 GCCGCGGAGCCGGGCCGCCCAGG + Intergenic
918497638 1:185157430-185157452 CCCACAGAGTCGCCCCGCCCAGG - Intronic
919897456 1:202018235-202018257 CCTGCAGAGGCCACCTGCCCAGG - Intergenic
920263275 1:204704006-204704028 CCAGAAGATCTGGCCTGCCCTGG - Intergenic
923096406 1:230778597-230778619 CCCAGAGAGCTGCCCTGCCCAGG + Intronic
924894019 1:248316649-248316671 CCTGCAGAGATGGCCTGCCCTGG + Intergenic
1064167802 10:13001610-13001632 CCCGGGGAGCCCGCCGGCCCGGG + Exonic
1067279505 10:44860739-44860761 CCCCCAGAGCCAGGCTGCCCAGG + Intergenic
1070605465 10:77895177-77895199 CCCGCAGGGCAGCACTGCCCTGG + Intronic
1070683997 10:78468528-78468550 CCCGGCCAGCCGCCCTGCCCGGG - Intergenic
1070771537 10:79085266-79085288 CCCCCAGAACCAGCCTGCCCAGG - Intronic
1072278485 10:93845289-93845311 CCGGCAGGCCCTGCCTGCCCCGG + Intergenic
1072416265 10:95249240-95249262 CCCTCAGAGGCTGGCTGCCCTGG - Intronic
1072607550 10:96997455-96997477 CCTGCCCAGCCTGCCTGCCCAGG + Intergenic
1074591864 10:114821694-114821716 GCCGCAGGGCAGGCCTGGCCGGG + Intergenic
1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG + Intronic
1075645057 10:124091893-124091915 CCAGCCGCGCCGGCCGGCCCCGG + Intronic
1076417262 10:130300785-130300807 CCTGCAGGGCCCGCCTGCCGGGG + Intergenic
1076417309 10:130300947-130300969 CCTGCAGGGCCGGCCTGCCGGGG + Intergenic
1076417417 10:130301337-130301359 CCTGCAGGGCCCGCCTGCCGGGG + Intergenic
1076417546 10:130301813-130301835 CCTGCAGGGCCCGCCTGCCGGGG + Intergenic
1076417559 10:130301851-130301873 CCTACAGGGCCGGCCTGCCGGGG + Intergenic
1076642629 10:131929181-131929203 CCCGCAGAGTGGCCCTGCTCAGG + Intronic
1077008901 11:371359-371381 GGTGCAGAGCTGGCCTGCCCAGG - Intronic
1077060946 11:617637-617659 CCCGCAGAGCCCGCACCCCCCGG - Exonic
1077229038 11:1450502-1450524 CCCGCAGGGCAGGCGGGCCCAGG - Intronic
1077283345 11:1755205-1755227 CACGCAGAGCAGCCCTACCCCGG - Intronic
1077432912 11:2524921-2524943 GAAGCAGAGCCGGGCTGCCCGGG - Intronic
1080606806 11:33870427-33870449 CCCGCAGAGCCGCGCTGTCCGGG - Intronic
1081195830 11:40159434-40159456 CCCACACAGCTGGCCTGCACTGG - Intronic
1081981717 11:47270544-47270566 CGGGCAGAGCTGGCCAGCCCTGG + Intronic
1082775498 11:57241475-57241497 TGCCCAGAGCTGGCCTGCCCTGG + Intergenic
1083328371 11:61885246-61885268 GTCCCAGAGCCAGCCTGCCCAGG + Intronic
1083432578 11:62621967-62621989 CCTGCAGACCCCGCCTGCTCGGG - Exonic
1083669316 11:64291529-64291551 TCCCCACAGCCGGCCAGCCCCGG - Intronic
1083941896 11:65900341-65900363 CCCGCAGAGCCGCCAGCCCCGGG - Exonic
1084745676 11:71167893-71167915 CCCGGACAGCCGCCCTGTCCGGG - Intronic
1084933670 11:72575783-72575805 CTCCCAGCGCTGGCCTGCCCTGG - Intergenic
1085510772 11:77087010-77087032 CACGCAGAGCTGCCCTGCCCTGG + Intronic
1090265608 11:125351227-125351249 ACCGCTGAGCAGGCCCGCCCTGG - Intronic
1090699079 11:129278942-129278964 CCCGCAGCGCCGTCCGCCCCGGG + Intronic
1091593325 12:1858377-1858399 CCCACAGATCCTGCATGCCCTGG + Intronic
1092262193 12:6958739-6958761 CCCACTGAGCTGGCCTGGCCTGG + Intronic
1092849268 12:12612101-12612123 CCGGCTCAGCCGGCCTGGCCCGG - Exonic
1096221054 12:49828344-49828366 CTGGCGGATCCGGCCTGCCCTGG - Exonic
1096777592 12:53973737-53973759 CCCGCCGAGCCCCCCTGCTCCGG + Exonic
1102151084 12:110689337-110689359 CCCGCAGGGTGGGCCTGTCCTGG + Intronic
1102597091 12:114001172-114001194 CCTGCAGGGCTGCCCTGCCCAGG + Intergenic
1102888479 12:116539360-116539382 TCCCCAGAGGCTGCCTGCCCTGG - Intergenic
1102924930 12:116819384-116819406 CGCGCAGAGCGGGGCGGCCCGGG + Intronic
1104570908 12:129924855-129924877 CTCAGAGAGCCGGCCTCCCCAGG + Intergenic
1104841272 12:131827294-131827316 CCCTCAGAGCCTCCCTGGCCCGG - Intergenic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1105858261 13:24389767-24389789 CCAGCACAACCTGCCTGCCCAGG - Intergenic
1106212762 13:27665962-27665984 CCCGCAGGGCTGGCTGGCCCTGG - Intronic
1113613627 13:111665545-111665567 CCCGCAGAGGGGCCCAGCCCTGG - Intronic
1113927740 13:113950889-113950911 CCGGCAGAGCCACCCTTCCCCGG + Intergenic
1117156986 14:52951159-52951181 CCCGCAGAGCTGCCCTGAGCGGG + Intronic
1117277435 14:54204297-54204319 CCCGGCCAGCCGCCCTGCCCGGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119474875 14:74921358-74921380 CACGCAGATCCGGCTGGCCCTGG - Exonic
1119786911 14:77320898-77320920 CCGGGAGGGCCGGCCGGCCCGGG + Exonic
1121847062 14:97181028-97181050 CCCGCAGAGCCAGCCAGTCATGG + Intergenic
1122387701 14:101360409-101360431 CCCGGGGAGCCGCCCTGCCCTGG + Intergenic
1122586038 14:102807265-102807287 CCCCAGGAGCCTGCCTGCCCAGG + Intronic
1122779755 14:104138668-104138690 CCCGGAGAGCCAGCGTGGCCGGG + Intergenic
1124026625 15:25972819-25972841 CCCCCAGAGCCAGACTCCCCTGG - Intergenic
1124371176 15:29105618-29105640 CCTGCAGAGCGAGCCTTCCCGGG + Intronic
1124413124 15:29452895-29452917 GCCGCTCAGCCGGCCTGACCAGG - Intronic
1124624490 15:31300244-31300266 GCCCCAGAGCCTGCCTGGCCTGG + Intergenic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1126345545 15:47689985-47690007 ACAGCAGAACTGGCCTGCCCAGG - Intronic
1127391897 15:58512539-58512561 CTCGCAGACCCAGCCGGCCCAGG - Intronic
1127726754 15:61757783-61757805 GCTGCAGAGCCAGACTGCCCAGG + Intergenic
1128067580 15:64774725-64774747 ACCGAGGAGCCGGCCGGCCCAGG + Intronic
1128987348 15:72231027-72231049 CCCGGCGCGCCGGCCGGCCCCGG - Exonic
1129269184 15:74410542-74410564 CACTCAGAGCCGGCTGGCCCGGG - Exonic
1129814709 15:78541153-78541175 CCTGGAGAGCCCGCGTGCCCAGG - Intronic
1131020190 15:89090935-89090957 CCAGCAGCGCCTGCCTGGCCTGG + Intronic
1131224973 15:90617024-90617046 CCTGCAGAGCCCCCCTGCCCTGG + Intronic
1132114482 15:99125493-99125515 CGCACACAGCGGGCCTGCCCCGG - Intronic
1132214518 15:100052941-100052963 CCGGCAGAGCCAGCCTCCTCAGG + Intronic
1132464837 16:72604-72626 CCCGCCGGTCCGGCCCGCCCGGG + Exonic
1132756534 16:1488003-1488025 CCCGCCCAGCCGGCCCGGCCCGG - Intronic
1132778951 16:1612583-1612605 CCCGCAGAACCAGCCGGGCCGGG - Intronic
1132804463 16:1769201-1769223 GCCGCCGAGGCTGCCTGCCCTGG + Exonic
1132857888 16:2055206-2055228 CGTGCGTAGCCGGCCTGCCCTGG + Intronic
1134442004 16:14303889-14303911 GCCTCAAAGGCGGCCTGCCCCGG + Intergenic
1135322742 16:21507908-21507930 CCAGCAGCGCCGGCCTCCCTGGG - Intergenic
1136334226 16:29601071-29601093 CCAGCAGCGCCGGCCTCCCTGGG - Intergenic
1137734121 16:50711558-50711580 CCCACAGAGCCAGTCTGCCCAGG - Exonic
1138085708 16:54132017-54132039 TCCTCAGAGCCTGGCTGCCCTGG + Intergenic
1138396050 16:56705554-56705576 CCAGCAGGGAGGGCCTGCCCTGG + Intronic
1138433979 16:56986758-56986780 GCTGCAGAGCTGGCCTGCCTGGG + Intergenic
1138601879 16:58060436-58060458 CCAGCAGAGCCCTCCTGCCCTGG - Intergenic
1139504739 16:67393242-67393264 CCAGCTGAGCGGCCCTGCCCTGG - Intronic
1139775240 16:69312516-69312538 GCCGCAGATCCCGTCTGCCCAGG + Intronic
1141448560 16:84080643-84080665 CCCCCAGAATGGGCCTGCCCTGG - Intronic
1141617732 16:85219868-85219890 CCAGGAGAGCCTGCCTTCCCTGG - Intergenic
1142225781 16:88877034-88877056 CCCGCAGAGCCGGCTTCGCTGGG + Exonic
1142232648 16:88907004-88907026 GCCTCAGAGCCGGCCACCCCAGG - Intronic
1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG + Intronic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1142825503 17:2507472-2507494 CCCGGACAGCCGCCCTGTCCGGG + Intronic
1143520168 17:7440225-7440247 CCCCCAGCCCCCGCCTGCCCCGG + Intronic
1143689691 17:8550535-8550557 CCCGGCCAGCCGCCCTGCCCGGG + Intronic
1143858818 17:9872974-9872996 CCTGGGGAGCCGGCCTGGCCTGG + Intronic
1144493889 17:15735366-15735388 CCCGTATAACCTGCCTGCCCAGG + Exonic
1144760414 17:17704009-17704031 CCCGAGGAGCCGGGCTGCCCTGG - Intronic
1144849254 17:18235772-18235794 CCCGCCCAGCCTGCCTGCCCTGG + Intronic
1144906372 17:18641313-18641335 CCCGGATAACCTGCCTGCCCAGG - Exonic
1146912508 17:36657854-36657876 CCTGCGGAGCCGGCCTGGCTCGG + Intergenic
1147566782 17:41541302-41541324 CCCCCAGAGCTGACCTACCCCGG + Intergenic
1147968698 17:44207896-44207918 CCCCCAGAGCCTGTCTCCCCAGG - Exonic
1151505181 17:74522706-74522728 TCTGCAGAGCCTTCCTGCCCTGG - Exonic
1151657257 17:75501871-75501893 CCTCCAGTGCCGCCCTGCCCAGG - Exonic
1152049285 17:77959397-77959419 CCCTCAAACCCGGCCGGCCCGGG - Intergenic
1152103161 17:78314433-78314455 CCCGCAGCCACGCCCTGCCCAGG + Intergenic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1152276301 17:79359654-79359676 CCTGCAGAGCCAGCCCTCCCTGG - Intronic
1152485521 17:80589245-80589267 CCCGCAAAGACGGCCTGCAGAGG - Intronic
1152487203 17:80602167-80602189 CCCGGCCAGCCGCCCTGCCCAGG - Intronic
1153265075 18:3262012-3262034 CACGCAGACCCCGCCGGCCCGGG + Intronic
1154278289 18:12980103-12980125 CCCGGACAGCCGCCCTGTCCGGG - Intronic
1155877221 18:31102010-31102032 CCCGCGGAGCCCTCCTACCCCGG - Exonic
1156456851 18:37299565-37299587 CCCGCAGTGCCAGCCTCTCCTGG - Intronic
1160004916 18:75062547-75062569 GCCGCACAGGCTGCCTGCCCAGG + Intronic
1160763566 19:797563-797585 GCCGCCGCGCCGGCCTCCCCGGG + Intronic
1161483990 19:4525027-4525049 CCCACCGCCCCGGCCTGCCCTGG - Exonic
1161504442 19:4636335-4636357 CACGCAGATCCCGCCCGCCCCGG + Intergenic
1161571034 19:5031019-5031041 CCCTCAGTGCCGGCCTGAGCTGG - Intronic
1163549169 19:17955848-17955870 TCCACAGAGCTGGCCTACCCTGG - Intronic
1163631107 19:18418358-18418380 CCCGCAGGGCAGGGATGCCCGGG - Intergenic
1164643689 19:29843719-29843741 CCCTCAGGGCCGGCCTGGCCTGG - Intergenic
1165242967 19:34482016-34482038 CCCGCAGGGCCAGCCCGGCCAGG - Exonic
1165754723 19:38286182-38286204 CCCACAGAGCCTGCCTGCCTGGG - Intronic
1168267311 19:55229952-55229974 TCCCCAGAGCCGGACTGGCCTGG + Exonic
925202496 2:1979816-1979838 CCTGCAGGGCTGGCCTGCACAGG - Intronic
927652198 2:24919769-24919791 CCCGCAGAGCCGCGCCGCCCCGG + Exonic
927964876 2:27262515-27262537 CCCGCGGCGCCTGCCTTCCCTGG - Intronic
929537723 2:42793710-42793732 CCCTCACAGCCCGCCTGGCCTGG + Intergenic
930028442 2:47044000-47044022 GCAGCAGGGCTGGCCTGCCCAGG + Intronic
930730637 2:54724801-54724823 CCCCCAGAGCCGCCTTGCCCGGG + Exonic
931656085 2:64511869-64511891 CCCGCACAGCCGCCCCGTCCGGG - Intergenic
932570129 2:72934161-72934183 CTCGGAGAGCCTGCCTGCCTGGG + Exonic
933948605 2:87309050-87309072 CCCCCAGAGCCCACCTCCCCAGG - Intergenic
934514956 2:94980825-94980847 CCCACAGACCTGCCCTGCCCAGG - Intergenic
934710220 2:96509524-96509546 CCTCCAGAGCCGGTCTTCCCAGG - Intergenic
936301773 2:111309874-111309896 CCTGCAGTGCGGGCCTCCCCAGG + Intergenic
936331594 2:111552546-111552568 CCCCCAGAGCCCACCTCCCCAGG + Intergenic
938066166 2:128283107-128283129 CTCGCAGGGGTGGCCTGCCCAGG - Intronic
939064544 2:137466810-137466832 GCCACAGAGCCAACCTGCCCTGG - Intronic
941793248 2:169575208-169575230 CCCGGCCAGCCGACCTGCCCGGG - Intergenic
946431043 2:219627623-219627645 AGCGCAGAGCCGGGCTGGCCGGG - Exonic
947789061 2:232852181-232852203 CCCTCAGAGCCTTCCAGCCCTGG + Intronic
948159463 2:235812297-235812319 GAGGAAGAGCCGGCCTGCCCGGG + Intronic
948505994 2:238427209-238427231 CCCGTGGACCCGGCCAGCCCGGG - Intronic
948675871 2:239596324-239596346 CCTGCAGAGCAGGGCTACCCTGG + Intergenic
948808850 2:240464921-240464943 CCCGCGGGGCCAGCTTGCCCCGG - Exonic
1172644439 20:36461259-36461281 CACGCCCAGCCGGCCGGCCCAGG - Intronic
1175754494 20:61520918-61520940 CCCGCAGAGCTGCACTGACCTGG - Intronic
1175782935 20:61695275-61695297 CCCGCAGAGGCGTCCTGCCCGGG + Intronic
1176042636 20:63073379-63073401 CCCTCTGGGCCGGACTGCCCTGG - Intergenic
1176115484 20:63430189-63430211 CCCACAGCTCCGTCCTGCCCTGG - Intronic
1179209231 21:39312554-39312576 CCCGCAGAGGCGGCCGCACCTGG + Intronic
1179615486 21:42580598-42580620 ACCGAAGACCCGGCCGGCCCTGG + Exonic
1179641182 21:42747995-42748017 CCCGCTGACCCTGCCTGGCCAGG - Intronic
1179825909 21:43966387-43966409 CCCCCACAGCAGGCCTGCCCTGG - Intronic
1180801390 22:18633782-18633804 CCCGGGGAACCGGGCTGCCCGGG + Intergenic
1181015622 22:20066830-20066852 CCCAGAGACCCGGCCTGCCCAGG + Intergenic
1181220331 22:21361479-21361501 CCCGGGGAACCGGGCTGCCCGGG - Intergenic
1183097006 22:35558364-35558386 CCCACAGAGCCACTCTGCCCAGG + Intergenic
1184559475 22:45253615-45253637 CCCCCAGACCCCTCCTGCCCAGG - Intergenic
1184680845 22:46071481-46071503 CCCGCAGAACAGGGGTGCCCGGG + Intronic
1184745075 22:46451323-46451345 CACGCAGAGAAGGCCAGCCCTGG - Intronic
1185078146 22:48694361-48694383 CCAGCAGTGCCAGCCTTCCCTGG - Intronic
1185148419 22:49151400-49151422 CCCTCAGGGCCGGGCTGCACCGG - Intergenic
1185299619 22:50072562-50072584 CCCGCAGACCCCTCCTGCCTCGG - Intronic
1185339343 22:50284542-50284564 GCAGCCGAGCCGGCCTGCCCTGG + Intronic
949980816 3:9500774-9500796 CCCGGGGAGCCTCCCTGCCCTGG - Exonic
950438732 3:12995010-12995032 GTCGCAGAGCAGACCTGCCCCGG + Intronic
952339382 3:32432551-32432573 CCTGCTGAGCCGGGCTGCCTGGG + Intronic
952875578 3:37941735-37941757 CCTTCAAAGCAGGCCTGCCCCGG + Intronic
954646324 3:52133799-52133821 CCCGCAGAGCCCCCATGCCCAGG + Intronic
956290359 3:67654449-67654471 GCAGCGGCGCCGGCCTGCCCGGG - Intronic
960639983 3:119815126-119815148 CCGAGAGAGCCTGCCTGCCCTGG + Intronic
966015471 3:175132756-175132778 CCAGGAGAGCCGCCCTGTCCGGG - Intronic
966878261 3:184335838-184335860 CACGCAGAGGCGGCCTGGACCGG - Intronic
968428086 4:536146-536168 CCCGCAGACTCGGCGGGCCCGGG + Intronic
968908245 4:3464198-3464220 GCGGCAGAGCCGGCCAGGCCCGG + Intronic
969426967 4:7130133-7130155 TCAGCAGAGACGGACTGCCCGGG - Intergenic
969699928 4:8762380-8762402 CCCTCGCAGCTGGCCTGCCCGGG + Intergenic
970609122 4:17709251-17709273 CCCGCAGGGCCGGCTGCCCCAGG - Exonic
981920320 4:150078812-150078834 TCCGCAGCGCCGAGCTGCCCAGG - Intronic
982281084 4:153684273-153684295 GCCTCCGAGCCGGCCTGCCCGGG - Intergenic
984815738 4:183834381-183834403 CCAGCAGATCCGGGCTGCTCTGG - Intergenic
985723435 5:1502555-1502577 CCCGCAGCCTCGGCCTTCCCTGG - Intronic
985767410 5:1787288-1787310 CAGGCAGAGCAGGCCTGGCCGGG - Intergenic
985767468 5:1787515-1787537 CACACAGAGCAGACCTGCCCTGG + Intergenic
990210789 5:53480239-53480261 CCGGCAGCGCCGGCGCGCCCGGG - Intergenic
992627526 5:78648806-78648828 GCGGCCGAGCCGCCCTGCCCAGG + Exonic
994245641 5:97472160-97472182 CCCGCAGAGCCTGCCATCCTAGG - Intergenic
995991728 5:118247668-118247690 ACTGCACAGCAGGCCTGCCCTGG - Intergenic
997120026 5:131164641-131164663 CGCGCACAGCCGGCCTGCCAGGG - Intronic
997470663 5:134115239-134115261 CGCGCAGAGCGTCCCTGCCCCGG + Intronic
998192775 5:140041939-140041961 CCCGCAGACCCTGCCAGCCTGGG + Intronic
999306204 5:150521210-150521232 ACCGGAGGCCCGGCCTGCCCTGG - Exonic
1000692835 5:164344392-164344414 ACCACAGAGCTGGCCTGCCTGGG + Intergenic
1001400538 5:171443884-171443906 CCCACAGAGCCTGTCTCCCCAGG - Intronic
1002094568 5:176823416-176823438 CCCCCAGTGCCTGCCTGACCCGG - Intronic
1002351665 5:178588283-178588305 CCAGCAGTGGCTGCCTGCCCAGG + Intronic
1003052549 6:2793060-2793082 CCCCCAGAGCCGGCCCTGCCCGG + Intergenic
1003321946 6:5059574-5059596 GCCGCAGAGCAGGCATGTCCAGG - Intergenic
1003497808 6:6679429-6679451 CCCGCAGAGCCGGGAAGCCAGGG + Intergenic
1003921700 6:10838629-10838651 CCCGCAGGCCCCGCCTTCCCCGG + Intronic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1006449495 6:34098004-34098026 CCATCGGAGCCGCCCTGCCCAGG + Intronic
1008649461 6:53548116-53548138 CTCGGAGAGCCGGCCTGTCGCGG + Intronic
1013272871 6:108559632-108559654 CCCGCGGAGCCGGGCCGCGCAGG + Intergenic
1016428849 6:143962166-143962188 CCCCCAGACCAGGCCTGCCTTGG - Intronic
1016965749 6:149717712-149717734 CGGGCAGAGCCGGCCCGCTCCGG - Intronic
1018774409 6:166999618-166999640 CCCCCAGTGCCCGCCGGCCCCGG - Intronic
1019594130 7:1850587-1850609 TCGGCAGAGCCGGCCTGGGCCGG + Intronic
1019685871 7:2381988-2382010 CTCCCAGAGCCGGCCTGCTGTGG + Intergenic
1020124871 7:5527955-5527977 ACCCCACAGCCGACCTGCCCAGG + Intronic
1023064816 7:36366954-36366976 CCCGCGGAGCCCGCCGCCCCGGG - Intronic
1023296703 7:38722365-38722387 CCCACAGAACTGGGCTGCCCAGG - Intergenic
1023868807 7:44251930-44251952 ACCGCAGAGCTGGCCTGGCGAGG - Intronic
1024540141 7:50469374-50469396 CCAGCAGTGCCGGCCTGCAGTGG - Intronic
1026585826 7:71655461-71655483 ACCGCAGAGGCTGCCTACCCCGG - Intronic
1026889718 7:73974837-73974859 TCCCCAAGGCCGGCCTGCCCTGG + Intergenic
1026944253 7:74306133-74306155 CCCGCAGGTGCTGCCTGCCCAGG + Intronic
1029110868 7:98212429-98212451 TCTGCGGAGCCGGCCGGCCCGGG + Exonic
1029438995 7:100577186-100577208 CCCGCTGAGCCGTTCTGCCTTGG - Intronic
1029460972 7:100693860-100693882 CCCCCAGAGCCGGCCAGCCTCGG - Intergenic
1031110916 7:117607329-117607351 GCCTCTGAGCCAGCCTGCCCTGG - Intronic
1034439911 7:151081252-151081274 CGGGCAGAGCCGGGCCGCCCCGG - Exonic
1034491541 7:151395703-151395725 CCTGCACTGCCGCCCTGCCCTGG - Intronic
1035076427 7:156180665-156180687 CCCGCAGAGGCAGCCTGCAGAGG + Intergenic
1035113794 7:156506104-156506126 CCAGCACTGCCCGCCTGCCCGGG - Intergenic
1038038451 8:23705382-23705404 CTGGCAGAGGAGGCCTGCCCTGG + Intronic
1038714690 8:29981175-29981197 CCCTCAGACCAGGCCTGGCCAGG + Intergenic
1039595425 8:38787028-38787050 CCCGCGCAGCCGGCAAGCCCCGG + Intronic
1040471618 8:47738824-47738846 CCCCCAGGGCCGGCCGGACCCGG - Exonic
1041673766 8:60517430-60517452 GCCGCAGACCGGGCCTGGCCAGG - Intronic
1041828378 8:62124321-62124343 CCTGCAAAGCCGTGCTGCCCCGG + Intergenic
1042271572 8:66961644-66961666 CCCCCAGGGCCCGCCGGCCCCGG + Exonic
1049211017 8:141386414-141386436 CCAGCAGAGCCGGCCTGGAGCGG - Intergenic
1049319133 8:141986730-141986752 CACCCACAGCCAGCCTGCCCAGG + Intergenic
1049660117 8:143816034-143816056 GCCGCAGAGCCGGCCGTCCAAGG - Intergenic
1049660387 8:143817203-143817225 GGCACAGAGCTGGCCTGCCCTGG + Intronic
1049726462 8:144148553-144148575 CCTGCAAAGCCGGCGTGCCCCGG + Intronic
1050305783 9:4304955-4304977 CCCCCAAAGCAGACCTGCCCCGG + Intronic
1052576586 9:30299441-30299463 CCAGCAGTGCCGGCCTGCTGGGG + Intergenic
1053180004 9:35960700-35960722 CCCTCAGAGCTGGGATGCCCTGG - Intergenic
1055505034 9:76939577-76939599 CCTGCTGAGCTTGCCTGCCCGGG + Intergenic
1056489952 9:87096103-87096125 TCCGCAGAGCCAGCCAGCCCTGG - Intergenic
1056532173 9:87497740-87497762 CCCGCAGCGCCGGCCTGGCAGGG + Intronic
1057312956 9:93953073-93953095 CCCGCGGCGCCGGGCAGCCCGGG + Exonic
1060722563 9:125988710-125988732 CTCTCAGAGGAGGCCTGCCCGGG + Intergenic
1060791596 9:126489120-126489142 CCCGGACAGCCAGGCTGCCCTGG + Intronic
1060849356 9:126861155-126861177 CCTGGAGAGCCGGCCGGGCCAGG + Intronic
1061097179 9:128465139-128465161 CCCAGAGAGGTGGCCTGCCCAGG + Intronic
1061149046 9:128818678-128818700 CCCGCAGCGCCCGCATGGCCGGG - Exonic
1061628980 9:131859574-131859596 CGCCCAGAGCCAGCCTGGCCAGG - Intergenic
1062321808 9:135993917-135993939 CTCGGAGAGCCGGCCAGGCCAGG - Intergenic
1062440733 9:136568194-136568216 CGCCCAGAGCAGGCCAGCCCGGG + Intergenic
1062670532 9:137706140-137706162 CATGCAGAGCCGACCTGGCCTGG + Intronic
1192166701 X:68831183-68831205 CCCCCAGCCCCGCCCTGCCCCGG + Intronic
1192167135 X:68833217-68833239 CCCCCTGAGCTGGCCTCCCCAGG - Intronic
1200043526 X:153387583-153387605 CCTGCAGGGCCCTCCTGCCCTGG - Intergenic
1200115927 X:153769717-153769739 CCAGCTGGGCCGGCCTCCCCAGG + Intronic
1200161891 X:154013851-154013873 TCCGCAAAGCAGGACTGCCCGGG + Intronic
1200163291 X:154019871-154019893 TCCGCGGACCCGGCCGGCCCAGG - Exonic