ID: 1006116219

View in Genome Browser
Species Human (GRCh38)
Location 6:31777409-31777431
Sequence CCCTGGTTCTGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006116219_1006116232 12 Left 1006116219 6:31777409-31777431 CCCTCTGCCCTCCAGAACCAGGG 0: 1
1: 0
2: 4
3: 58
4: 435
Right 1006116232 6:31777444-31777466 CCTGCAGCCCCCAAGGATTCAGG 0: 1
1: 0
2: 1
3: 26
4: 221
1006116219_1006116227 5 Left 1006116219 6:31777409-31777431 CCCTCTGCCCTCCAGAACCAGGG 0: 1
1: 0
2: 4
3: 58
4: 435
Right 1006116227 6:31777437-31777459 CTCCCACCCTGCAGCCCCCAAGG 0: 1
1: 1
2: 7
3: 84
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006116219 Original CRISPR CCCTGGTTCTGGAGGGCAGA GGG (reversed) Intergenic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
900462619 1:2808837-2808859 CCCTGGTGCTGGTGGGAAGGGGG + Intergenic
900792926 1:4691571-4691593 CCCTGGTGCTGGAGGAGAGTCGG + Intronic
901688923 1:10960010-10960032 TCCTGGTTCAGCAGGGGAGATGG - Intronic
901835147 1:11919304-11919326 CCCTGGCTCTTTAGGGCAGGTGG + Intergenic
901840832 1:11952906-11952928 TCATGGTTCTGGAGGCCGGAAGG + Intronic
902445286 1:16459338-16459360 CCCCTCCTCTGGAGGGCAGATGG - Exonic
902868255 1:19295456-19295478 CCCTTGGTCTGGAGAGCACATGG - Intergenic
902940449 1:19797190-19797212 CCCTGGTCCTGGATGTCACAGGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903515940 1:23911183-23911205 CCTTGGCTGTGGATGGCAGATGG - Intronic
903580660 1:24368156-24368178 CCCTAGACCTGGAGGGCAGAAGG + Intronic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
903811242 1:26036103-26036125 CCTTGGTAGTGCAGGGCAGACGG - Exonic
904351025 1:29906820-29906842 CCCTGATTCAGCATGGCAGAGGG - Intergenic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
905176214 1:36137118-36137140 ACTGAGTTCTGGAGGGCAGAGGG + Exonic
908351019 1:63286423-63286445 GCCTGGTTCTTGAGGCCATAGGG - Intergenic
908455094 1:64296252-64296274 CCCTGGGTCATGAGGGCACAGGG - Intergenic
910387932 1:86704975-86704997 CCCTGGTGCTGGGGGGAAAAGGG + Intronic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
919602610 1:199641053-199641075 CCATGGTTCTGGATGGAGGAGGG + Intergenic
919847919 1:201653262-201653284 CCCTTTTCCTGGAGGACAGAAGG - Intronic
919880557 1:201897985-201898007 TCCTGGCCCTGGAGGGCAGTGGG + Exonic
919882897 1:201912447-201912469 CCCTGATCCTGCAGGGGAGATGG - Intronic
921277780 1:213536642-213536664 CCTTGGGCCTGGATGGCAGAGGG + Intergenic
922477207 1:225914795-225914817 ACCTGGTTGTGGGGGGCAGTGGG - Intronic
923035900 1:230285011-230285033 CACTGGTGGTGGAAGGCAGAGGG + Intergenic
923607438 1:235457185-235457207 CCCTGGTCCTGAGGGGTAGATGG - Intronic
924462841 1:244274604-244274626 CCCTCATTCTGTAGGACAGAGGG - Intergenic
924710932 1:246529487-246529509 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1063813946 10:9749319-9749341 TCCTGGTTCAAGAGAGCAGAGGG + Intergenic
1064373895 10:14778294-14778316 CCCAGGCTCTGGAGTGCAGTGGG - Intergenic
1065839713 10:29692298-29692320 CCCTGGTTCTGCTCAGCAGAAGG + Intronic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067539721 10:47142697-47142719 TCCTGGTTCTGCAGGCCATACGG - Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068496327 10:57789162-57789184 CCCTTGGTCTGGAGAGCATATGG + Intergenic
1069740661 10:70685158-70685180 CCCTGGGGCTGGAAGGCACATGG - Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1069942259 10:71964082-71964104 CCCGGGGACTGGAGGGCCGAGGG + Intergenic
1070764057 10:79046350-79046372 GCCTGAATCTGGAAGGCAGAGGG + Intergenic
1071595345 10:86918338-86918360 ACCTTTTTCTGGAGGGAAGAGGG + Intronic
1072404077 10:95133262-95133284 CCCTTGGTCTGGAGAGCATATGG - Intergenic
1072709681 10:97707810-97707832 CCCTGGAGCTGTAGGGCAGGGGG - Intergenic
1073471194 10:103723352-103723374 CCCAGGAGCTGGTGGGCAGAAGG - Intronic
1073942979 10:108719226-108719248 CCCTGGATCATGAGGACAGAGGG - Intergenic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1075258395 10:120943392-120943414 CCATGGTGCTGGGGGGCAGGAGG + Intergenic
1076078402 10:127555995-127556017 CCCTGGTGTTGGACGGTAGAGGG - Intergenic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1077189935 11:1251704-1251726 CCCTGCTTCTGCAGGGCATTTGG + Exonic
1077259527 11:1608382-1608404 CCATGGTTCTGGTGGGTTGAGGG + Exonic
1077941091 11:6844321-6844343 ACCTGTTTCTGGAGGAAAGAAGG - Intergenic
1078068985 11:8096032-8096054 CCCTGGTGCAGGGTGGCAGAGGG + Intronic
1078093693 11:8283668-8283690 CCCTCGATCTGGAGTGGAGAGGG + Intergenic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1079101315 11:17544010-17544032 CCCTGCCCCTGGAAGGCAGAGGG + Intronic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1080640544 11:34155899-34155921 CCCTGCATGGGGAGGGCAGAGGG - Intronic
1081578166 11:44332635-44332657 CCCATGTTCTGGTGGGCACATGG - Intergenic
1082797902 11:57391391-57391413 CCCTGCTTCTGGAGGCAACAAGG - Intronic
1084361488 11:68670844-68670866 ACCTGGTTCTGAGGGGCAGGGGG - Intergenic
1084383123 11:68826068-68826090 CCCTGGCCCTGGAGAGTAGAGGG + Intronic
1084687916 11:70708091-70708113 TCCTGGTCATCGAGGGCAGAAGG - Intronic
1084800083 11:71538037-71538059 CCATGGTTCTGGTGGGTTGAGGG - Exonic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1085769107 11:79309369-79309391 TCCTGGCCCTGGAGGTCAGATGG + Intronic
1086955346 11:92929747-92929769 GCCTGCTTCTGGAGTGCACAAGG - Intergenic
1088767737 11:113000695-113000717 CCCTGTTCCTGGAAGGCTGATGG + Intronic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1088952654 11:114586991-114587013 CCCTTGGTCTGGAGAGCACATGG + Intronic
1090262501 11:125331551-125331573 TCCTGGTTCAGGAAGCCAGATGG + Intronic
1090292050 11:125554225-125554247 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1090500989 11:127261137-127261159 TCCCAGTTCTGGAGGGCAGAAGG + Intergenic
1091254269 11:134169988-134170010 CACTGGCTCTGGAGGGCATTGGG + Intronic
1091290803 11:134438708-134438730 CCATGATTCAGGAGGGCAAAAGG - Intergenic
1091721507 12:2817333-2817355 CCCTGGGCCTGGAGGGGGGAAGG + Intronic
1092984451 12:13831994-13832016 CCCTGGTGGTGAAGGGCAGTGGG + Intronic
1093518659 12:20021607-20021629 TCCTGGTTCTGGAGGCTAGAAGG - Intergenic
1093980381 12:25469312-25469334 GCCTGGTCTTGGAGGGCAGAGGG + Intronic
1094325518 12:29233793-29233815 GCCTAGCTCTGGAGGGAAGAAGG - Intronic
1095334846 12:41012134-41012156 CCCTTGGTCTGGAGAGCACATGG - Intronic
1095334852 12:41012175-41012197 CCCTTGATCTGGAGAGCACATGG - Intronic
1095334858 12:41012222-41012244 CCCTTGTTCTAGAGAGCACATGG - Intronic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1096677250 12:53232340-53232362 CCCTGGGGCTGGGGGGCGGAGGG + Intronic
1096892463 12:54785838-54785860 CCCTGCTGCTGGAGGGGACAGGG + Intergenic
1098434055 12:70450451-70450473 CCATGGTTGTGCAGGGCAGCAGG - Intergenic
1098952362 12:76654116-76654138 CCCTTGTTAAGGAGAGCAGATGG - Intergenic
1101760185 12:107651958-107651980 TCCTTGTTCTGGAGGGGAGGTGG - Intronic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819735 12:115897475-115897497 CCCTGATTCTGGAGGCCAGGTGG + Intergenic
1103243965 12:119439348-119439370 CCCTAGACCTGGAGGGGAGAAGG + Intronic
1103963889 12:124626019-124626041 TCCCCGTTCTGGAGGGCAGAAGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104792761 12:131494097-131494119 CCCAGGCTCAGGACGGCAGAGGG - Intergenic
1104910474 12:132237925-132237947 CCCTGAAGCTGGAGGGCAGCAGG - Intronic
1105356448 13:19663906-19663928 CCCTGGGTCTGCAGGGCACCTGG + Intronic
1105431356 13:20340321-20340343 CCCAGGGGCTGGAGGGCAGGTGG - Intergenic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1110400386 13:75083155-75083177 TTCTGGTCCTGGAGGCCAGATGG + Intergenic
1110984997 13:81956316-81956338 CCCTGAATCATGAGGGCAGAGGG - Intergenic
1113601954 13:111575806-111575828 CCCTGCTTCAGGACTGCAGATGG + Intergenic
1115271863 14:31561550-31561572 CCGTGGTGCTGCAGGGCAGGGGG + Intronic
1117621256 14:57589413-57589435 CCATGGTTCTGAAGGGCATCTGG - Exonic
1118366405 14:65101387-65101409 GCCTGGTTCTGGAGGGTGGGGGG - Intronic
1119160028 14:72444782-72444804 CCCTGGTTTAGGAGTGCATATGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120342716 14:83242806-83242828 CCCTGGTTTTGGATTGCAGATGG - Intergenic
1121253160 14:92514129-92514151 ACCTGGTTCTGCGGGGCAGGGGG + Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121712987 14:96053007-96053029 CCCGGTTTCTGCAGGGCTGAGGG + Intronic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1122234160 14:100322712-100322734 CCCTGGTTCATGTGGGCAGGGGG + Intergenic
1122236636 14:100334119-100334141 CCCTGACTCTGCAGGACAGAGGG + Exonic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1122713323 14:103676992-103677014 CCCGGGTACTTGAGGGGAGACGG + Intronic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1124203972 15:27701808-27701830 CCCTGTTGCTGGAGGGAGGAAGG + Intergenic
1126146444 15:45477826-45477848 GCTTGATTCTGGAAGGCAGATGG - Intergenic
1126186445 15:45835166-45835188 CCAAGATTCTGCAGGGCAGATGG - Intergenic
1126792581 15:52234642-52234664 CCCTGTCTCTGTAGGGCTGATGG - Intronic
1127319025 15:57824720-57824742 CCCTGCTTCAGAAGGGCAGCTGG - Intergenic
1128249909 15:66156673-66156695 CCCTGGTTAACGAAGGCAGAAGG - Intronic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129682815 15:77667506-77667528 CCCTGGTGCAGGAGGGAAGTGGG + Intronic
1129947353 15:79550771-79550793 TCCTGGTTCTGGAGGTTGGAAGG + Intergenic
1130036654 15:80367259-80367281 CCCTTGGTCTGGAGAGCACATGG + Intronic
1130039615 15:80395229-80395251 CCCTCGTTCAGGAGGCTAGAAGG + Intronic
1130969529 15:88721182-88721204 CTCTGGTTCCTGAGAGCAGAGGG + Intergenic
1131284399 15:91045121-91045143 CCCTGGGTTTGGAGAGCAGGAGG + Intergenic
1132645241 16:996465-996487 CCTGGGTTCTGGAGAGCAGGTGG - Intergenic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1132880178 16:2158668-2158690 CCCTGCTGCTGCAGGGCAGAAGG + Intronic
1132928544 16:2446246-2446268 CCCTGGCTCCTGAGGGCAGCAGG + Intronic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133263795 16:4570844-4570866 GCCTGGCTCTGGAGGGCAAAAGG - Intronic
1134899849 16:17927596-17927618 CCATCAGTCTGGAGGGCAGAGGG + Intergenic
1135899241 16:26441521-26441543 GCCTGGAGCTGGAAGGCAGAAGG - Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1137408062 16:48205621-48205643 CCAAGGTCCTGGAGGGCAGTGGG - Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1138569660 16:57861616-57861638 CCATGGTACTGGGGGCCAGAAGG + Intronic
1139510951 16:67428365-67428387 CCCAGGCTCTGGAGGACAAAGGG - Intergenic
1140216158 16:73010566-73010588 ACCTGGTTCTGCAGGTCAGCAGG - Intronic
1140727211 16:77824303-77824325 AGCTGGTTCTGGAGAGGAGAGGG + Intronic
1141506471 16:84481600-84481622 CCCTGTTTCTGCAGAGCTGAGGG - Intronic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142192863 16:88725870-88725892 CCCTGCATCTGTACGGCAGAAGG - Intronic
1142249451 16:88984446-88984468 CCCTGGCTCTGGAGGGCGGGCGG - Intergenic
1142288079 16:89179564-89179586 CCCTGGTTCAGGTGAGCAGGTGG + Exonic
1142552185 17:747617-747639 CTCTAGTTCTGCATGGCAGATGG + Exonic
1143298374 17:5888669-5888691 TCTTGGTTCTAGAAGGCAGATGG - Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1144119769 17:12140571-12140593 CCCTGGCTCTGGAGAGTACAGGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1146005502 17:29158271-29158293 CCCTGATTCTGGAGAACATATGG + Intronic
1146185922 17:30724178-30724200 TCCTAGTTCTGGAGGCCAGAAGG - Intergenic
1146318817 17:31830613-31830635 CCCTGGTTCAGGAGAAGAGATGG - Intergenic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1147312510 17:39603966-39603988 CCCTGCCTCCGGTGGGCAGAGGG + Intronic
1147459294 17:40558083-40558105 CCCCAGGTCTGGAGGCCAGAGGG - Intronic
1147685873 17:42286674-42286696 ACCCAGGTCTGGAGGGCAGAGGG - Intergenic
1147939875 17:44038910-44038932 CCCTGGATCTGGTGCACAGATGG - Intronic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149141558 17:53437942-53437964 CCCTGATGCTGGCTGGCAGAGGG - Intergenic
1150227904 17:63533758-63533780 CCACGGCTCTGGTGGGCAGAGGG - Intronic
1150657896 17:67052368-67052390 CCCTGGCTCTGGGGGGAAGGAGG + Intronic
1151328835 17:73394903-73394925 CCCTGCCTCTGGAGGACAGCTGG - Intronic
1151336921 17:73445514-73445536 CTCTGGTTCTGAAGAGCATAGGG + Intronic
1151347916 17:73514617-73514639 AGCTTATTCTGGAGGGCAGATGG - Intronic
1151942754 17:77302929-77302951 CCCTGGTCCTGGAGAGGAAAGGG - Intronic
1151942982 17:77304519-77304541 GCCTGGTGCTAGGGGGCAGAAGG + Intronic
1152305207 17:79516379-79516401 TCCTGGTTCTCCAGGGCAGGGGG - Intergenic
1152309922 17:79543906-79543928 CCCTGGCTCTGGGGGGTAGGGGG - Intergenic
1152342394 17:79732474-79732496 GCATGCTTCTGGAGGCCAGAAGG + Intronic
1152535658 17:80949119-80949141 CCCTGGAGCTGGAGGGAGGAAGG + Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1152946358 17:83199549-83199571 CCCTGGCTCTGGCAGGCAGGTGG + Intergenic
1153103206 18:1497650-1497672 CCCTGGGTCACAAGGGCAGAGGG + Intergenic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1155227121 18:23738365-23738387 CCCTCCTTCTGGAGAGAAGAAGG + Intronic
1156030184 18:32704269-32704291 CCCAAGTTATTGAGGGCAGAAGG + Intronic
1157337525 18:46752551-46752573 CCCTTGGTCAGGAGGGGAGAAGG - Intronic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1157532700 18:48435116-48435138 CCTGGGTTCTGGAGAGCTGAAGG - Intergenic
1157661369 18:49447926-49447948 CCCTTGGTCTGGAGAGCACATGG + Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1159122519 18:64187295-64187317 CCATGGCTCTGGAGGGACGAGGG - Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160498179 18:79387316-79387338 CCTCAGTTCTGGAGGCCAGAAGG + Intergenic
1160583663 18:79901266-79901288 CCCTGGTCCTGGAGGGCTCTGGG - Intergenic
1160862772 19:1244722-1244744 GGCTGGCTCTGCAGGGCAGAGGG - Exonic
1161294446 19:3512624-3512646 CCCTGGAGCTGCAGGGCTGAGGG + Intronic
1161390265 19:4016998-4017020 GCCTGGCTGTGGAAGGCAGACGG - Intronic
1162972854 19:14191551-14191573 TCCTAGTTCTGGAGGCCAGAAGG + Intronic
1163514696 19:17755820-17755842 CCCTGGTCCTGCAGGGCTGAAGG - Intronic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1165052072 19:33148107-33148129 CCCTGGTTCTTGGGGGCACATGG - Intronic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166152482 19:40884084-40884106 TCCTGCTTCAGGAGGGCATAAGG + Intronic
1168148499 19:54432520-54432542 GCCTGGCTGTGGGGGGCAGAGGG - Intronic
1168259681 19:55186358-55186380 CCCTGGTTGAGGAAGGCAGGCGG + Exonic
1168268537 19:55236873-55236895 CCCTGGTTGTGGCGGGTGGAGGG - Intronic
1168703174 19:58453509-58453531 GCCTGGACCAGGAGGGCAGAGGG + Intronic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925493266 2:4419183-4419205 CCTGAGTTCTGGAGGGCAGAGGG + Intergenic
926234562 2:11029530-11029552 CTCTGGTTCTGCAGAACAGAAGG - Intergenic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
931894830 2:66717117-66717139 CACTGCTTCTGGAGCACAGAAGG - Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
933978368 2:87529844-87529866 TCCTGCTTCTGGAGGCCAGGTGG - Intergenic
934614707 2:95763946-95763968 CCCTGTTCCGGGAGGGCAGTAGG + Intergenic
934646197 2:96060549-96060571 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
934839600 2:97616632-97616654 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935124099 2:100207654-100207676 TCCTGGTCCTCCAGGGCAGATGG - Intergenic
936159140 2:110070866-110070888 TCCAGGTTCTGGAGAGCAGGAGG + Intergenic
936185521 2:110300466-110300488 TCCAGGTTCTGGAGAGCAGGAGG - Intergenic
936315464 2:111420957-111420979 TCCTGCTTCTGGAGGCCAGGTGG + Intergenic
937007972 2:118535497-118535519 CCCCGGTTCAGTAGGGCAGGAGG + Intergenic
937024087 2:118682994-118683016 CCCGGGTACTGGATGGGAGAGGG - Intergenic
937069230 2:119050221-119050243 CCCTGGTACTGGAAGACAAAGGG - Intergenic
937335868 2:121062111-121062133 CGCTCTTTCTGGAGGTCAGAGGG + Intergenic
937419595 2:121742509-121742531 CCCAGGCTCTGGTGGGCAGGGGG + Intronic
938293413 2:130162243-130162265 CCGTGGTGCTGCAGGGCAGCAGG - Intronic
939675687 2:145069534-145069556 TCCTGCACCTGGAGGGCAGAGGG + Intergenic
940504769 2:154539148-154539170 CCCTGGTTCTGGGGGGATAATGG + Intergenic
940910038 2:159202426-159202448 TACTGGTTTTGGAGAGCAGAGGG + Intronic
940990206 2:160088573-160088595 CCCTTGGTCTGGAGAGCACATGG - Intergenic
942091460 2:172495604-172495626 CCGTGGTTCTGGAGGGCGAGAGG - Intronic
942552782 2:177137171-177137193 GCCTGGCTCTGCAGGGCTGAAGG - Intergenic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
943984641 2:194603906-194603928 CCCTTGGTCTGGAGAGCATATGG + Intergenic
943984648 2:194603947-194603969 CCCTTGGTCTGAAGGGCACATGG + Intergenic
944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG + Intronic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
944923067 2:204435632-204435654 TCCTGATGCTGGAGGGCAGCAGG - Intergenic
945041382 2:205746180-205746202 CCCTGGCTCTTCAGGCCAGAGGG + Intronic
945824659 2:214706631-214706653 TATTGGTTCTGCAGGGCAGATGG - Intergenic
947819057 2:233058355-233058377 TCCTGAATGTGGAGGGCAGAAGG + Intergenic
948025470 2:234772783-234772805 TCCTGGTTCTAGAGGACAGGAGG - Intergenic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948692559 2:239715797-239715819 CCCTGGTCCAGGGGAGCAGAAGG - Intergenic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948835193 2:240622979-240623001 CCCAGGTTCGAGAGGCCAGATGG - Intronic
948944298 2:241211630-241211652 TCCTGGTTCTGGATGGCCAAGGG + Intronic
1168947921 20:1777077-1777099 ACGTGGTTCTGGAGGGCTGTGGG + Intergenic
1169759894 20:9079626-9079648 CCTCTGTTCTGGAGGGCAAATGG - Intronic
1169895536 20:10501610-10501632 ACTTGGTTCTCGAGGGCAGCAGG + Intronic
1170210127 20:13839595-13839617 TCATAGTTCTGGAGGCCAGAAGG + Intergenic
1171045946 20:21809479-21809501 CCCTGGCTCTGTCAGGCAGAAGG + Intergenic
1171185497 20:23121491-23121513 CCTTGTTTCTGTCGGGCAGATGG + Intergenic
1171254623 20:23680088-23680110 GCCTGGTTGTGGAGTGAAGAGGG + Intergenic
1171261105 20:23735361-23735383 GCCTGGTTGTGGAGTGAAGAGGG + Intergenic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1171957738 20:31472862-31472884 CTCAGGTCCTGGAGGACAGAGGG - Intronic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1172446323 20:34995321-34995343 TCCTGCTCCTGGAGGGCACACGG - Exonic
1172509964 20:35493670-35493692 GCCTGGTTTGGGAGGGTAGATGG + Intronic
1172654109 20:36526395-36526417 CACTGGTTCTGGTTTGCAGAAGG - Intronic
1172767125 20:37356770-37356792 TCCAGGTTCAAGAGGGCAGAGGG - Intronic
1173227073 20:41168314-41168336 CCCTGGCTGTGGAGGGGAGGGGG - Intronic
1173475574 20:43356772-43356794 CCCAGAAGCTGGAGGGCAGAGGG - Intergenic
1174182889 20:48686226-48686248 CCCTGGTCCTCCAGGGTAGAAGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175610756 20:60349290-60349312 TCCAGGTTCAGGAGGGCTGAGGG + Intergenic
1175636271 20:60586888-60586910 TCCTGATTCTGGAGGGGAGCAGG + Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178378985 21:32092666-32092688 TCCTGGTTCTGGAGGCCAGAAGG + Intergenic
1178472774 21:32908743-32908765 CCCTGGGCCTGAAGTGCAGAGGG + Intergenic
1179243143 21:39609404-39609426 GCCTGGATCAGGAGGGGAGAAGG + Intronic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1179959813 21:44761921-44761943 ACCAGGTGCTGGAGGGCAGTGGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181446134 22:22976320-22976342 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1181446141 22:22976363-22976385 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1182424881 22:30266669-30266691 CCCAGTTCCCGGAGGGCAGAGGG + Intronic
1182438323 22:30345742-30345764 CCATGGTTCAGGAGTGCAGAAGG + Intronic
1182508688 22:30803360-30803382 CCCTGGCTTGTGAGGGCAGAGGG - Intronic
1182518286 22:30871271-30871293 CCCTGGCTCTGGAAGCCACACGG + Intronic
1183217268 22:36489168-36489190 GCATGGTTCAGGATGGCAGAGGG + Exonic
1183354260 22:37350015-37350037 ACCTGGTCCTGGCGGGCAGTGGG + Intergenic
1183380293 22:37487291-37487313 CCCAGGTTCTGGAGTGGAGCAGG - Intergenic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185148321 22:49151032-49151054 CCCGGGTTTATGAGGGCAGATGG - Intergenic
949153490 3:799406-799428 CCCTGGTTCTGAATGGGAGGGGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953049450 3:39327609-39327631 CCCCAGTTCTGGAGGCCAGATGG - Intergenic
953430501 3:42835889-42835911 CCCAGGCTCGGGTGGGCAGAAGG - Intronic
953768858 3:45763736-45763758 CCCAGGTTCTGGAGGCTAAAGGG - Intronic
954044379 3:47916861-47916883 CCCTGGTTAAGGATGTCAGATGG - Exonic
954374666 3:50188010-50188032 CCCTGGGGCTGGGGGGCACATGG - Exonic
954394948 3:50288497-50288519 TCATTGTTCTGGGGGGCAGAGGG + Exonic
954685632 3:52368727-52368749 CCCTGGCGCTGCAGGACAGACGG + Exonic
955778991 3:62463544-62463566 GCCTGGCACTGGAAGGCAGATGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956808044 3:72836530-72836552 CCCTGAATCTGGAGGCCAGGGGG - Intronic
956844484 3:73169881-73169903 CCCAGGTTGTGGAGAGCTGAAGG + Intergenic
957511339 3:81191594-81191616 CCCCAGTTCTGGAGGCCAGAGGG - Intergenic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
962990582 3:140573828-140573850 CCCTGTTTCTGGGGAACAGAAGG + Exonic
965380373 3:167980924-167980946 CCCAGATTGTGGAAGGCAGACGG - Intergenic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
968594250 4:1474166-1474188 CCCTGGTGATGGAGGGGTGAGGG + Intergenic
968600390 4:1505990-1506012 CCCTGCTTCTGGAGGGCACAGGG - Intergenic
968960358 4:3740146-3740168 CCCAGGTCCTGGAGGGCCCAAGG - Intergenic
969622134 4:8283958-8283980 CCCGGGATGGGGAGGGCAGAGGG - Intronic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972449743 4:39184367-39184389 CCCAGGCTCTGGAGTGCAGTGGG - Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
973754226 4:54057450-54057472 CCCTGGATCTGGAGAACAGCAGG - Intronic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
976743775 4:88383321-88383343 AGCTGGTTCTGAAGGGCAGCTGG + Exonic
978019087 4:103786202-103786224 CCCTTGGTCTGGAGAGCATATGG + Intergenic
978169149 4:105648343-105648365 CCTTGTTTCTGGAGGTCAGTGGG + Intronic
979456406 4:120930392-120930414 CCCAGTTTCTGGTGGCCAGAAGG - Intergenic
979626734 4:122853350-122853372 CTCTGATTCTGGAGGGTGGAGGG - Intronic
982068785 4:151676803-151676825 CCCTGGCTCTGGGGTGCTGAAGG + Intronic
982485365 4:155959343-155959365 CCCCTGTTCAGGAGGGCATAAGG - Intergenic
984579207 4:181490929-181490951 CGCTTGTTTTGGAGGGTAGAGGG - Intergenic
985773046 5:1825009-1825031 CCCTTGTGCTGGTGGGCAGAAGG + Intergenic
986199082 5:5565130-5565152 CCCTGGTTTTGCAGAGCTGAGGG - Intergenic
987535636 5:19184377-19184399 CCCTGTTTCATGAGGGCAAAGGG - Intergenic
987693369 5:21297214-21297236 TCCTGGTTATGGAAGGCAGAGGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
991092976 5:62710578-62710600 CCCAGGTTCTGAATGGCAGCTGG + Intergenic
991746905 5:69752338-69752360 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
991750800 5:69802904-69802926 TCCTGGTTATGGAAGGCAGAGGG - Intergenic
991798507 5:70332280-70332302 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
991809079 5:70459339-70459361 CCCTTGTTCTGGAAAGCACATGG + Intergenic
991826282 5:70627650-70627672 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
991830088 5:70677801-70677823 TCCTGGTTATGGAAGGCAGAGGG - Intergenic
991890838 5:71331603-71331625 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
993416180 5:87635411-87635433 CCCTGGTTCTGGGGGTCAATGGG + Intergenic
993963963 5:94337102-94337124 CCGTGGTTCTTTAGGGCTGAGGG + Intronic
995581410 5:113606685-113606707 CCCTTGGGCTGGAGGGCACATGG + Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996477434 5:123937400-123937422 CCCTTGGTCTGGAGAGCACATGG - Intergenic
996505528 5:124263970-124263992 CCCTGGTGCTGGGTGCCAGAAGG - Intergenic
998601347 5:143588365-143588387 TCATGGTTCTGCAGGGCTGAGGG - Intergenic
999095341 5:148973065-148973087 CACCAGTTCTGGAGGGCACAGGG - Intronic
1000004072 5:157166767-157166789 CCCTGGTTCTGTAGTTCTGATGG - Intronic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001454274 5:171848702-171848724 GCCTGGCTCTGGAGGGCACATGG - Intergenic
1001741288 5:174055071-174055093 CCCTGTTTCCGGAGGTCACAGGG + Intronic
1001791491 5:174461215-174461237 CCTGGCTTCTGGGGGGCAGAGGG + Intergenic
1001872707 5:175170685-175170707 CCCTGGTTCTGTGGGTGAGAGGG - Intergenic
1002373945 5:178775135-178775157 CCCTGGTGCTGGAGTGGAGTGGG + Intergenic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1005999996 6:30956995-30957017 CCTGGGTTCTAGAGGGCAGATGG - Intergenic
1006061384 6:31422782-31422804 CCCTTGGTCTGGAGTGCACATGG - Intergenic
1006105056 6:31711396-31711418 CCCTATTTCTCGGGGGCAGAGGG + Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006164906 6:32058344-32058366 GCCTGGTTCTGTAGGGCTGGGGG + Intronic
1006368947 6:33632788-33632810 GGCTGGTCCTGGAGGGGAGAAGG + Intronic
1006574890 6:35037846-35037868 TCCTGGTTCTGGAGGGAACATGG + Intronic
1006799698 6:36752130-36752152 GCCTGGTTCTCCAGGGCAGAGGG - Intronic
1007364122 6:41378547-41378569 CCCTTGATGTGGAGGACAGAAGG + Intergenic
1008823005 6:55656547-55656569 TCCTGGATCTGGCTGGCAGATGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010096192 6:72049085-72049107 CACTGATTCAGGAGGGCACAGGG + Intronic
1010574330 6:77512801-77512823 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1011525810 6:88263756-88263778 CACTGATGCTGCAGGGCAGAAGG + Intergenic
1012845328 6:104381179-104381201 CCCTGGGTCTTGAGGGTAAAGGG - Intergenic
1014198042 6:118580929-118580951 CCCTTGGTCTGGAGAGCACACGG + Intronic
1015306588 6:131715624-131715646 GCCTGGTTGTGGAGTGGAGAGGG - Intronic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1016841919 6:148533509-148533531 CCCTGGTTCTGCAGGGCAGGAGG + Intronic
1017962459 6:159233705-159233727 TCCTGGTTCTGGAGGGCCGTGGG - Exonic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1018555780 6:165049471-165049493 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1018555788 6:165049553-165049575 CCCTTGTTCCGGAGCGCACATGG + Intergenic
1018849083 6:167574909-167574931 CCCTGGCTGTGGAGGGCGGCGGG - Intergenic
1018862780 6:167723002-167723024 CCCTGGTCTTGGAGGACAGGAGG + Intergenic
1019365948 7:632884-632906 CCCAGGCTCAGGAGGGCTGACGG - Intronic
1019714048 7:2530233-2530255 CCCGGGTGCTGGAGGTCAGGGGG + Intergenic
1019730792 7:2628314-2628336 TCACGGTTCTGGAGGCCAGAAGG + Intergenic
1019928708 7:4209500-4209522 CCCTGGGTCTGGAGCGGGGAGGG - Intronic
1019996532 7:4728089-4728111 CCCTGGCCCTGGATGGCAGCCGG + Intronic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1021044609 7:15906986-15907008 CCCTTGTCCTCCAGGGCAGAGGG + Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022519271 7:30995344-30995366 ACCTGGCTCTGTGGGGCAGAAGG + Intergenic
1023982156 7:45076544-45076566 CCCAGGTGCTGCAGGGCAGATGG - Intergenic
1024113913 7:46174077-46174099 CCCTGGCTCTGGAGTGAGGATGG + Intergenic
1024247872 7:47484032-47484054 CCCAGGTTCTGCAGAGCAAATGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027199510 7:76054352-76054374 CCCTTGTGCAAGAGGGCAGATGG - Intronic
1028351651 7:89857197-89857219 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351657 7:89857240-89857262 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351671 7:89857326-89857348 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1029124393 7:98286616-98286638 CCCCAGCACTGGAGGGCAGAAGG - Intronic
1029221092 7:98991080-98991102 CCATGGTTCTCAAGGGCAGTGGG + Intronic
1029223803 7:99010409-99010431 CCCTTGTTCTTGCCGGCAGAAGG + Intronic
1030102751 7:105960852-105960874 CCCTGGTTCTAGGGAGCAAAAGG - Intronic
1031360706 7:120845173-120845195 CCAAGGTTCTGCAGGGCAGCAGG + Intronic
1031414625 7:121480669-121480691 CCACAGTCCTGGAGGGCAGAAGG + Intergenic
1032336588 7:131030452-131030474 ACCTGGTGCTGGAGGACAAAGGG + Intergenic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033679844 7:143583569-143583591 GCCTGGTTGTGGAGTGGAGAGGG - Intergenic
1033691990 7:143745874-143745896 GCCTGGTTGTGGAGTGGAGAGGG + Intergenic
1033730961 7:144178876-144178898 GCCTGGTTGTGGAGTGGAGAGGG + Intergenic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1035006966 7:155671180-155671202 CCCTGCCTCTGGAGGGTAGTTGG + Intronic
1035443347 7:158922086-158922108 CCCGGCTTCTGGTGGGCAGCTGG + Intronic
1035546556 8:486277-486299 CCCTGGCCCAGGAGGGCAGGTGG + Intergenic
1036429309 8:8675079-8675101 CCCAGGTTCTGGAGGGCCATGGG + Intergenic
1037921775 8:22811666-22811688 CTCTGGTTCAGGAGGTCACAGGG + Intronic
1039183413 8:34891293-34891315 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1039798641 8:40935949-40935971 CCCTGGTCCTGGAGGGAGGGTGG + Intergenic
1040526030 8:48226014-48226036 CCCTTGATCTGGAGAGCACATGG + Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1041167162 8:55101968-55101990 CCCTGGCTCGGGAGGGGCGAGGG - Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043313505 8:78891990-78892012 CCCTGGTTCTGGGATCCAGAAGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044115387 8:88328134-88328156 CCCTGGTCCTGGAGAGCGGTCGG + Intergenic
1044820469 8:96152824-96152846 GCCTGGGTCTGGAGGCCTGAGGG - Intronic
1044950515 8:97431409-97431431 CACTGTTTCTGGAGGCTAGAAGG - Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1048052154 8:130828364-130828386 CCCTTGGCCTGGAGGGCACATGG + Intronic
1048052161 8:130828407-130828429 CCCTTGGTCTGGAGAGCACATGG + Intronic
1048887868 8:138923101-138923123 ACCTGGTTAAGGAGGGGAGAGGG + Intergenic
1048951962 8:139504056-139504078 CCCAGGTTCTAGAAGGAAGAGGG - Intergenic
1049406020 8:142452192-142452214 GCCTCGATCTGGGGGGCAGAAGG + Intronic
1049412841 8:142481140-142481162 CCCTGTTTCTGGGGGCCACAGGG + Intronic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049686049 8:143939738-143939760 TCCTGTTTCTGGCGGGCCGAGGG - Intronic
1050160272 9:2711611-2711633 ACCTAGTTCTGAAAGGCAGAGGG - Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1051819606 9:21149481-21149503 CCCTGGTTGGGGAGGGCTGTGGG + Intergenic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1052418184 9:28204887-28204909 TCCTGGGTTTGGAGGGCATATGG + Intronic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1053083122 9:35194064-35194086 CCCTTGGTCTGGAGAGCAAACGG - Intronic
1053105232 9:35403225-35403247 CCCTGGTACTGGGGAGCACAAGG + Exonic
1053354126 9:37432168-37432190 CACTGGTCCTGCAGGGCAGCAGG - Intronic
1053380893 9:37649450-37649472 CCGTGGATCTGGGTGGCAGAGGG + Intronic
1055490899 9:76804554-76804576 GCCTGGCTCTGGAGGGCACATGG - Intronic
1055577174 9:77671743-77671765 CCCTGGTTCCTGAGGGTGGAGGG - Intergenic
1056852561 9:90096705-90096727 CCCTGGTTGAGCAGGGAAGAGGG + Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1059976524 9:119723852-119723874 CTCAGGCTCTGGAGGGCAGCAGG + Intergenic
1060246729 9:121952739-121952761 ACCAGGCTCTGGAGGGCAGCAGG - Intronic
1060929433 9:127479619-127479641 CCCAGGTGCTGGGGGACAGAAGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061417667 9:130455943-130455965 CCCGAGTGCTGGAGAGCAGAGGG + Intronic
1061797777 9:133098359-133098381 CTCTGGTTCCAGAGAGCAGAAGG + Exonic
1061872470 9:133528209-133528231 CCCAGAGTCTGGAGGGCATATGG - Intronic
1062021127 9:134319890-134319912 CCCTGGAGCTGGAGGGCTGCAGG + Intronic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062569805 9:137179820-137179842 CCCCGGTTCTGAGAGGCAGAGGG + Intronic
1062650778 9:137576045-137576067 CACTTGTTCTGTGGGGCAGAAGG - Intronic
1188747423 X:33863377-33863399 TCATGATTCTGGAGGGTAGAAGG + Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1191716177 X:64195210-64195232 CCCTGGGTCTGGTGGGAATAGGG + Intronic
1193659460 X:84239195-84239217 GCCTGGTTCTGGAGGCAAGCAGG + Intergenic
1193790777 X:85813167-85813189 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1195290584 X:103429023-103429045 AACTGGTTCTTGAGGGTAGAGGG - Intergenic
1195553727 X:106197517-106197539 CACTGGTTCTGGTATGCAGAAGG - Intronic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1197326723 X:125103644-125103666 CCCTAATTCTGGAAGTCAGACGG - Intergenic
1198691733 X:139292203-139292225 CCCTGGTTGTGCATGGAAGAGGG + Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199764613 X:150931995-150932017 CCTAGGTTCTGGAGGGGAGGTGG - Intergenic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1200049854 X:153422983-153423005 CCCTGTTTCTGCAGGGCTAAGGG - Intergenic
1200069350 X:153520055-153520077 CCCTGGATCTGGAATGGAGAAGG - Intronic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1200252180 X:154559568-154559590 CCCAGGCTCTGATGGGCAGAGGG + Intronic
1200265588 X:154644848-154644870 CCCAGGCTCTGATGGGCAGAGGG - Intergenic