ID: 1006116843

View in Genome Browser
Species Human (GRCh38)
Location 6:31780146-31780168
Sequence CCCTCTCTCCCCAAGCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 406}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006116843_1006116852 3 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116852 6:31780172-31780194 ATCAGCCGGCGGGCCAGGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1006116843_1006116850 -1 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116850 6:31780168-31780190 GTGTATCAGCCGGCGGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1006116843_1006116851 0 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116851 6:31780169-31780191 TGTATCAGCCGGCGGGCCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1006116843_1006116848 -7 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116848 6:31780162-31780184 GAGAGGGTGTATCAGCCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1006116843_1006116857 21 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116857 6:31780190-31780212 GGAGGGTGCCAGAACCCCATGGG 0: 1
1: 0
2: 0
3: 15
4: 112
1006116843_1006116853 4 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116853 6:31780173-31780195 TCAGCCGGCGGGCCAGGGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 213
1006116843_1006116858 22 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116858 6:31780191-31780213 GAGGGTGCCAGAACCCCATGGGG 0: 1
1: 0
2: 1
3: 15
4: 152
1006116843_1006116849 -2 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116849 6:31780167-31780189 GGTGTATCAGCCGGCGGGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 62
1006116843_1006116847 -8 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116847 6:31780161-31780183 AGAGAGGGTGTATCAGCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 100
1006116843_1006116860 27 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116860 6:31780196-31780218 TGCCAGAACCCCATGGGGGCAGG 0: 1
1: 1
2: 1
3: 22
4: 209
1006116843_1006116859 23 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116859 6:31780192-31780214 AGGGTGCCAGAACCCCATGGGGG 0: 1
1: 0
2: 0
3: 15
4: 179
1006116843_1006116856 20 Left 1006116843 6:31780146-31780168 CCTCCGGGCTTGGGGAGAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 406
Right 1006116856 6:31780189-31780211 GGGAGGGTGCCAGAACCCCATGG 0: 1
1: 0
2: 4
3: 25
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006116843 Original CRISPR CCCTCTCTCCCCAAGCCCGG AGG (reversed) Exonic
900134082 1:1106881-1106903 CCCTCACTGCCCAGGGCCGGGGG - Intronic
900193173 1:1360020-1360042 CCCTCTCTCCCCATGGAGGGAGG + Intronic
901201549 1:7470087-7470109 TCTTCTCTGCCCAAGCCTGGGGG + Intronic
901470133 1:9450316-9450338 CCCTGTGTCCCCATGCCCTGCGG + Intergenic
902394345 1:16124570-16124592 CCCTCTGTCCCCAGCCCTGGCGG + Exonic
902530968 1:17090431-17090453 CCAGCTCTCCCCAAGGCCAGGGG - Intronic
902601213 1:17540858-17540880 CCCTCTCTCCCCAGAACCCGAGG - Intronic
902609337 1:17588130-17588152 CCCGCTGTCCCCAAGCCTGCAGG - Intronic
903471773 1:23592251-23592273 CCCAGCCTCCCCAAGCCTGGAGG - Intronic
904013993 1:27406454-27406476 CACTCTCTCCTCAAGCCGGAGGG + Exonic
904536339 1:31201993-31202015 CCCTGGCTCCCCAGGCCCAGCGG - Intronic
904858044 1:33514753-33514775 CCCTCTCCCTCCAGGCCCAGGGG + Exonic
905416797 1:37809101-37809123 CTCTCCCTCCCCAGGGCCGGTGG + Exonic
905867256 1:41382823-41382845 CCCTCCCTCCCCTTCCCCGGCGG - Exonic
906047953 1:42846953-42846975 CTCTCTGGCCCCAAGCCCGCCGG + Intronic
906376990 1:45303888-45303910 CCCTCTCTCCCCAATCCCAGGGG - Intronic
908517058 1:64903400-64903422 CCCTCTGTCCCCATGCCATGAGG - Intronic
909579980 1:77222652-77222674 CCCTCTCATCACAAGCCAGGAGG - Intergenic
913329398 1:117654596-117654618 CCCTCTCTCAACAAACCCTGAGG + Intergenic
913486565 1:119337099-119337121 CCCTCCCCACCCAAGCCCCGTGG + Intergenic
915148169 1:153807841-153807863 CTCCCTCTCCCCAAGCTCAGAGG - Exonic
915245976 1:154556681-154556703 CCCTCTCTGCCCAAACCAAGGGG + Intronic
915473415 1:156138850-156138872 CCTTCTCTTCCGCAGCCCGGGGG + Intronic
915856683 1:159396339-159396361 ACCTCTCTCCCTGAGCCTGGTGG - Intergenic
916940068 1:169668162-169668184 CCCTCACTGCCCAGGGCCGGTGG - Intronic
917348870 1:174056625-174056647 CCCTCACTGCCCAGGGCCGGCGG + Intergenic
918542710 1:185649180-185649202 CCCTCACTGCCCAGGGCCGGTGG + Intergenic
919464342 1:197912065-197912087 CTCTCTCTCCCCCACCCCGTTGG - Intronic
920021128 1:202957796-202957818 CCCTCCCTCCCCACGCGCGGCGG + Intronic
921487731 1:215734363-215734385 CCCTCTCAACACAAGCCCAGAGG - Intronic
922546845 1:226464305-226464327 CTCTCACTGCCCAAGGCCGGTGG - Intergenic
923650185 1:235866698-235866720 CCCTCGCGCCCTCAGCCCGGCGG + Intronic
924501217 1:244639644-244639666 CCCTCTGTCACCCAGCCTGGAGG - Intronic
1062937635 10:1400118-1400140 CCCTCTCTGCCCACGCTCAGCGG - Intronic
1063437203 10:6044020-6044042 CCCCCTCTCCCCAAACTCAGTGG + Intronic
1064965101 10:21007205-21007227 CCCTCTCTCCCCACAGCCGCTGG + Intronic
1067172870 10:43922296-43922318 CCCTTCCTCCCCAAACACGGAGG + Intergenic
1068216663 10:53990919-53990941 CCCTCACTGCCCAGGGCCGGTGG - Intronic
1068755087 10:60643708-60643730 CCCCATCTCCCGAAGCCCAGTGG + Intronic
1069719168 10:70539036-70539058 CCCTCCCTCCCCAAACCCACTGG - Intronic
1069724885 10:70571255-70571277 GTCTCTCTCTCCAAGCCCTGTGG + Intergenic
1070172715 10:73944710-73944732 CCCTCACTGCCCAGGGCCGGTGG - Intergenic
1070345932 10:75541886-75541908 CTCTCTCTCCCCAAGCCAAAGGG + Intronic
1070570980 10:77638820-77638842 TCCTCACTCCCGAAGCCCGAGGG - Intergenic
1070591160 10:77802095-77802117 GGCTCTCTCCTCAAGCCCGGAGG + Intronic
1070768516 10:79069595-79069617 CCCTCGCTCCCTACACCCGGGGG + Intronic
1070835758 10:79445862-79445884 CCCTCTCTCCCCACCCCTGACGG - Intergenic
1070967608 10:80539033-80539055 CCCTCTCTCCGGATGCCCAGTGG - Intronic
1071519380 10:86319567-86319589 CCCTCTCCCCCCAACTCCTGTGG + Intronic
1072642248 10:97220596-97220618 CCCTCTCTCCCCAGCCCCCAAGG - Intronic
1072808161 10:98438843-98438865 CCCTCTCGCCACAGGCCTGGAGG + Intronic
1073487827 10:103832063-103832085 CACTCTCTCCCCATGCCCCAGGG + Intronic
1074188495 10:111116378-111116400 CCCTCTCTACACAAGCCTGCCGG - Intergenic
1074223583 10:111462029-111462051 CCCTCCCATCACAAGCCCGGAGG + Intergenic
1074535315 10:114324813-114324835 CCCTCTCCCCCAAAGCACAGGGG - Intronic
1075079171 10:119371240-119371262 CCCACTCTCCCCTAGCCCGGTGG + Intronic
1076164731 10:128272671-128272693 CCCTCCCTTCCCAGGCCCGGGGG - Intergenic
1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG + Intergenic
1076275247 10:129192975-129192997 CCCTCTCTCCCCAACAGGGGAGG + Intergenic
1077096582 11:801622-801644 TCCTCTCTCCCCCATCCCAGCGG - Exonic
1077169688 11:1160660-1160682 CCCTCTCTCCTATCGCCCGGGGG + Exonic
1077423401 11:2463350-2463372 CCCTCTATCCCCCAGATCGGCGG + Intronic
1077764586 11:5144522-5144544 CCCTCACTGCCCAGGGCCGGTGG - Intergenic
1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG + Intronic
1078372538 11:10761283-10761305 CCCCCCTTCCCCAGGCCCGGGGG - Intronic
1079190982 11:18276346-18276368 CCCTCACTGCCCAGGGCCGGTGG + Intergenic
1080223509 11:29934270-29934292 CCCTCACTGCCCAGGGCCGGCGG - Intergenic
1080822646 11:35821885-35821907 CACTCTGTCCCCAAGGCTGGAGG - Intergenic
1081789383 11:45772072-45772094 CCGCCTCTCCCGGAGCCCGGAGG - Exonic
1082175246 11:49050256-49050278 AGCTCCCTCCCCCAGCCCGGCGG + Intergenic
1083552138 11:63598006-63598028 CCCTCTCTTCCCAGCCCCTGGGG + Intronic
1083624266 11:64064100-64064122 CCCTATCTCTCCAAGCCCCTCGG + Intronic
1083793723 11:65002376-65002398 TCTTCTCTCCCCACGCCCTGGGG - Intergenic
1084186647 11:67476199-67476221 CCCTCACTGCCCAGGGCCGGCGG - Intergenic
1084240697 11:67817869-67817891 CCCTCACTGCCCAGGGCCGGCGG + Intergenic
1084461788 11:69300322-69300344 ACCCCTCTCCCCAAGCCAGCTGG + Intronic
1084483372 11:69434602-69434624 CCCTCCCTCCCCAGGGCCTGGGG - Intergenic
1084534984 11:69751261-69751283 CACTCTCTCCCCAGTCCTGGTGG - Intergenic
1084678087 11:70648627-70648649 CCTTCTCTCCCCAGGCCCACTGG - Intronic
1086690519 11:89785827-89785849 AGCTCCCGCCCCAAGCCCGGCGG - Intergenic
1086715278 11:90053832-90053854 AGCTCCCGCCCCAAGCCCGGCGG + Intergenic
1088850212 11:113698058-113698080 CCCTCTCTCCTCAAGAGCAGAGG + Intronic
1089023445 11:115242228-115242250 CCCTCTCACTGCAAGCCCGGTGG - Intronic
1089175726 11:116547648-116547670 CCCTCTCTCCCAAAGCCCAGAGG + Intergenic
1089596777 11:119585486-119585508 CCCACCCTCCCCCAGCCCCGAGG - Intergenic
1091062332 11:132475060-132475082 CCTTCTCTCCACCAGCCCTGAGG + Intronic
1091528319 12:1328889-1328911 CCCTCCCTCCCCAAGAACAGAGG - Intronic
1091721653 12:2818340-2818362 CCCTCTCACCCCAATCCCTTGGG - Intronic
1092010921 12:5111917-5111939 CCCCCTCTCCCCCAGACTGGTGG + Intergenic
1092057181 12:5517071-5517093 GCCTCTCTCCCCAAGACAGCTGG - Intronic
1094716560 12:33019932-33019954 CTCTCTTTCCCCAAGCCTGATGG - Intergenic
1096109470 12:49020476-49020498 CCCTCTCCCCCCACCCCCCGGGG - Exonic
1096595411 12:52692004-52692026 CCTTCTCTCCTCAGGCCCTGTGG - Intronic
1098356319 12:69616249-69616271 CCTTCTGTGCCCAAGCCTGGAGG + Intergenic
1098792046 12:74836733-74836755 CCCTCTCATCACAGGCCCGGAGG + Intergenic
1099204346 12:79711042-79711064 CCCTCACTGCCCAGGCCGGGAGG - Intergenic
1103063100 12:117874936-117874958 CCCTCTAACCCCAGGCCCAGGGG - Intronic
1103224476 12:119274922-119274944 CCTTCCCTCCCCAAGCCTAGGGG + Intergenic
1103497552 12:121374572-121374594 CCCTCACTGCCCAAGGCCGGCGG - Intronic
1103522993 12:121548814-121548836 CCCCACCTCCCCAAGCCTGGGGG + Intronic
1103561909 12:121797320-121797342 CCCTCTCTCTGCAAGCCCTGGGG + Intronic
1103918904 12:124389432-124389454 CCCTCTCTCCCCATCCGCGGCGG + Intronic
1105401812 13:20102911-20102933 CCTTCTCTCCCCAAGTCTGATGG + Intergenic
1107546189 13:41435667-41435689 CTCTCTCTCGCCCACCCCGGGGG + Intergenic
1107905327 13:45056354-45056376 CCTCCTCACCCCAAGCCCTGTGG + Intergenic
1109721037 13:66277077-66277099 CCCTCTCATCACAAGCCCTGAGG + Intergenic
1109848697 13:68032498-68032520 CCCTCTGTCGCCCAGCCTGGAGG - Intergenic
1112291160 13:98144439-98144461 CCCTGTCTCTCCCAGCCCTGGGG + Intronic
1114661280 14:24346764-24346786 CCCTCTCTCCTCAAGACCACAGG - Intergenic
1115641289 14:35337158-35337180 CTCTGTCTCCCCAAGACCTGAGG + Intergenic
1116311003 14:43326712-43326734 CCCTCACTGCCCAGGGCCGGTGG - Intergenic
1117291974 14:54343304-54343326 GCCTCTCTCCCCAGGCCATGGGG - Intergenic
1119720444 14:76886210-76886232 TCCTCTCTCCCCAAGATGGGTGG - Intergenic
1120279292 14:82419434-82419456 CCCTTTCTCCCCATTCCCAGGGG + Intergenic
1121214759 14:92239244-92239266 CCCTCTCTCCTAAAGCCAGAAGG + Intergenic
1122087320 14:99316873-99316895 CCCTCTTTCCCCGAACCCAGGGG - Intergenic
1122726226 14:103755067-103755089 CCCTCTCTCACCGGGCGCGGTGG - Intronic
1122858347 14:104570902-104570924 CCCTCTCCCCACAGGCCCGGAGG + Intronic
1122978710 14:105181551-105181573 CCCTCCCTCCCCCAGCCAAGAGG - Intergenic
1123628878 15:22247190-22247212 CCCTCCCATCACAAGCCCGGAGG + Intergenic
1124269267 15:28265967-28265989 CCCTTTCTCCCCAAGGCCTTTGG - Exonic
1125516678 15:40324545-40324567 ACCATTCTCCCCAAGCCCAGAGG + Intergenic
1126997573 15:54462562-54462584 CCCTCACTCCCCGGGGCCGGGGG - Intronic
1127864875 15:63024078-63024100 CCCTCTCAGCCCAGGCCCTGTGG - Intergenic
1128322005 15:66701108-66701130 CCCTCTCCCCCCGCGCGCGGCGG - Intergenic
1128511354 15:68315806-68315828 CTCCCTCTCCCCAAGCCAGCAGG - Intronic
1128727987 15:70001843-70001865 CCCTCTTCCCCCAAGCCAGGTGG - Intergenic
1129002157 15:72343941-72343963 CCCTTTCTCTCCAAGCACAGGGG + Exonic
1129852583 15:78802414-78802436 CTCTGTCTCCCCAATCCAGGAGG - Intronic
1130649038 15:85751712-85751734 CCCTCTCTCCCCATGCCTTTGGG + Intergenic
1131470011 15:92688699-92688721 CCCTCTCATCACAAGCCCAGAGG + Intronic
1131734170 15:95314409-95314431 CCCTCCCTCCCTAAGCCTGTTGG + Intergenic
1132164023 15:99566626-99566648 CCTTTTCCCTCCAAGCCCGGGGG + Intronic
1132483918 16:180615-180637 CCCTCCCTCCCCAAGCCCCCCGG + Intronic
1132618423 16:853302-853324 TCCCCTCTCCCCCAGCCTGGGGG - Intergenic
1132737386 16:1393699-1393721 CCCTCTCTCCACAAGGGAGGTGG + Intronic
1133215284 16:4288517-4288539 CCTCCTCTCCCCAAGTCAGGGGG + Intergenic
1133232522 16:4373289-4373311 TCCTCCCTCCCCAGGCCCAGGGG - Intronic
1133352162 16:5108763-5108785 CCCTCACTGCCCAGGGCCGGCGG + Intergenic
1134124896 16:11609925-11609947 CCTTCTCTCTCCAGGCCCAGAGG + Intronic
1134539744 16:15055375-15055397 CTCTCTCTCCCCTACCCCCGGGG - Intronic
1135016184 16:18926487-18926509 GCCTCTCTCCCCAGGCCCGGCGG - Intergenic
1135229361 16:20691232-20691254 CCATCTCTTCCCAAGGCAGGTGG - Exonic
1135321797 16:21502313-21502335 GCCTCTCTCCGCAGGCACGGCGG - Intergenic
1135437171 16:22436952-22436974 GCCTCTCTCCCCAGGCCCGGCGG + Intronic
1136333276 16:29595420-29595442 GCCTCTCTCCCCAGGCCCGGCGG - Intergenic
1136395572 16:29990980-29991002 CCCTCCCTCCCCAGTCCTGGAGG - Intronic
1136413720 16:30091403-30091425 CCCTCCCTCCCCACCCCGGGAGG + Intronic
1136447960 16:30335451-30335473 GCCTCTCTCCCCAGGCCCGGCGG - Intergenic
1136719624 16:32310001-32310023 CCCACTCTCCCCAGTCCCCGTGG - Intergenic
1136837998 16:33516281-33516303 CCCACTCTCCCCAGTCCCCGTGG - Intergenic
1137236821 16:46624183-46624205 CCCTCCCTCCCTAAGCCCTGAGG + Intergenic
1137275341 16:46929692-46929714 CCCTCATTCCCAAAGCCCGCCGG - Exonic
1138307388 16:55989628-55989650 CCCTCTCTTCCCATGCAGGGCGG - Intergenic
1138660112 16:58511805-58511827 CCCTCTCATCCCACTCCCGGCGG + Exonic
1141664905 16:85461051-85461073 CCCTCTCTCCCCACACCCTTAGG + Intergenic
1141694740 16:85614047-85614069 CTCTCTCCCCCCACCCCCGGCGG + Intronic
1141830059 16:86505565-86505587 CCCTCCCTTCCGAAGCCCCGAGG + Intergenic
1142000232 16:87660141-87660163 CCGTCTCTCCCCAGGCTCGGAGG - Intronic
1142045871 16:87924937-87924959 CCTTCTCTCCCCAATCACAGAGG + Intronic
1142200333 16:88758051-88758073 TGCTCTGTCCCCAACCCCGGAGG - Intronic
1203006807 16_KI270728v1_random:207768-207790 CCCACTCTCCCCAGTCCCCGTGG + Intergenic
1203148178 16_KI270728v1_random:1816565-1816587 CCCACTCTCCCCAGTCCCCGTGG - Intergenic
1142668479 17:1475822-1475844 CCCTCTCTCACCCAGCCCTTCGG - Intronic
1142808372 17:2383572-2383594 CCCTCTGTGCCCAATCCCTGGGG + Intergenic
1142978328 17:3657990-3658012 TCCTCTCGCCCCCAGCGCGGTGG + Exonic
1143768073 17:9150619-9150641 CCTTCTCTCCGCCTGCCCGGCGG - Intronic
1144944102 17:18961052-18961074 GCCTCTCACCCCAAGGCTGGTGG + Intronic
1145829820 17:27906941-27906963 CCCTCCCTCCCCAAGCCAGGAGG - Intergenic
1145990214 17:29074727-29074749 CCCTCTCACCCCAGGGCCTGTGG - Exonic
1146125021 17:30224618-30224640 GCCTCTCTACCCAGGCCCAGAGG + Intronic
1147042029 17:37726710-37726732 TCCTCCCTCTCCAAGCCCAGTGG - Intronic
1147981984 17:44280427-44280449 TCCTCTCTCCTGAAGCCCGTCGG + Intergenic
1148246302 17:46033037-46033059 CCCTCTCTCCACAGGCCCTGGGG + Intronic
1149314069 17:55422105-55422127 GCCTCGCTGCCCGAGCCCGGCGG - Intergenic
1149585161 17:57781598-57781620 CCCTCTCTCCCCTAGACAAGGGG + Intergenic
1149754576 17:59176388-59176410 GAGTCTCTCCCCAAGCCTGGGGG - Intronic
1149774493 17:59346514-59346536 CCCTCCCTCTCCAAGCAAGGAGG - Intronic
1149908589 17:60549777-60549799 CCCTCTGTCACCAAGGCTGGAGG - Intergenic
1150168338 17:62966164-62966186 CCCTCCCCACCCCAGCCCGGAGG + Intergenic
1150236987 17:63601183-63601205 CCCTCCCACCCCGAGCCCCGGGG + Exonic
1151955266 17:77376911-77376933 CCCTCGGTCCCCAAGACGGGAGG - Intronic
1152264317 17:79285241-79285263 CCCTTTCTGCCCCAGCCAGGTGG + Intronic
1152318778 17:79596363-79596385 CCCTCTGCCCCCAGGCCCTGGGG + Intergenic
1152498111 17:80688874-80688896 CCCTTCCACCCCAAGCCTGGTGG + Intronic
1152593227 17:81223632-81223654 CCCTCTCTCCGGGAGCCCTGGGG + Intergenic
1152747784 17:82049212-82049234 CCCCCTCTCCCCAGGCCCTCGGG + Intronic
1152897406 17:82920799-82920821 CCCTCTCCCCCCAACACAGGAGG + Intronic
1154093026 18:11382249-11382271 CCCTCTCCCCCCATGCACAGAGG - Intergenic
1154169752 18:12042771-12042793 CCCCCTCTCTCCATGCCAGGAGG + Intergenic
1156472883 18:37388496-37388518 CTCTCCCTCCCCAAGGCCAGTGG + Intronic
1156508046 18:37611196-37611218 CACTCTCTCCCCAACCATGGTGG - Intergenic
1157403595 18:47405751-47405773 CCCTATCTCCCCAGGCCATGTGG - Intergenic
1159960195 18:74549745-74549767 CCCTCTCACCACAGGCCCAGAGG + Intronic
1160395003 18:78564369-78564391 CCTCCTCTCCCTAAGCCAGGGGG + Intergenic
1160796434 19:947854-947876 CCCAATTTCCCCACGCCCGGCGG + Intronic
1160801788 19:973795-973817 CCCACTTTCTCCAAGCCAGGGGG - Exonic
1160927934 19:1555954-1555976 CCCACGCTGCCCGAGCCCGGCGG - Exonic
1161393071 19:4031394-4031416 CCCTCCATCCCCGAGCCTGGAGG - Intronic
1162312591 19:9915803-9915825 CCCTTTCTCGCCAGGCGCGGTGG - Intronic
1162789512 19:13055616-13055638 CCCCCCCTCCCCCAGCCCTGAGG - Intronic
1162797758 19:13095482-13095504 CCCTCTCTCTGCAGGCCAGGAGG + Exonic
1162894557 19:13757535-13757557 CCCTCCCACCCCCACCCCGGCGG - Intronic
1163021424 19:14482812-14482834 CCCCCCCTCCCCCAGCCCTGCGG - Exonic
1163374710 19:16923024-16923046 CCCTCTGTCCCCAGGCGTGGGGG + Intronic
1163554179 19:17983223-17983245 CCCTCACACCCCAGGCCTGGCGG - Intronic
1165108621 19:33488535-33488557 CTCTCTCTCCCCAGGCCCCCAGG - Intronic
1165157250 19:33796220-33796242 CGCCCCCTCCCCGAGCCCGGAGG + Intronic
1165390182 19:35534278-35534300 CCCTCACTTCCCAAGGGCGGGGG + Intronic
1165393340 19:35550636-35550658 CCCTCTCTCTCCCAGGCTGGTGG - Exonic
1166074346 19:40404991-40405013 CCCTGTCCCCCCAATCCCAGAGG - Intronic
1166996472 19:46721943-46721965 CCCCTTCTCCCCAACCCTGGTGG + Intronic
1167671561 19:50856491-50856513 CCCTCTCTCCCCCAGTCCCAAGG - Intronic
925519348 2:4724797-4724819 CACTCTGTCACCAAGCCTGGAGG + Intergenic
926242780 2:11101152-11101174 CCCACGCTCTCCAAGCCAGGAGG + Intergenic
926418612 2:12675354-12675376 CCCTCTCGCTCCGAGCCAGGAGG + Intergenic
926526911 2:13992317-13992339 CCCTCTCACCACAGGCCCAGAGG - Intergenic
927490352 2:23517159-23517181 GCCACTCTCCTCCAGCCCGGGGG + Intronic
927926116 2:27014848-27014870 CCCTTCCTGCCCAGGCCCGGGGG - Intronic
929129077 2:38548507-38548529 CACTCTGTCACCAAGGCCGGAGG + Intergenic
929147329 2:38718230-38718252 CCCTCTCTCGCCCAGGCTGGAGG + Intronic
930016692 2:46975565-46975587 CCCTCCCTCCCCACTCCCTGTGG + Intronic
930593383 2:53356542-53356564 CCCTCACTGCCCAGGGCCGGCGG - Intergenic
932129791 2:69177604-69177626 GCCTCCCTCCCCAATCCCTGCGG + Intronic
932332395 2:70905097-70905119 GCCGATCTCCCCAAGCCCAGTGG - Intronic
933511468 2:83246178-83246200 CCCTCACTGCCCAAGGCCAGTGG + Intergenic
935178349 2:100668940-100668962 CCCTCTCTGCCCATGCTCTGTGG + Intergenic
935549845 2:104441338-104441360 CCCTCTCTCCCCAGGCCGCACGG - Intergenic
936172708 2:110190441-110190463 CCCTCACTGCCCAGGGCCGGTGG + Intronic
936994392 2:118398282-118398304 CCCTCTCATCACAGGCCCGGAGG + Intergenic
938070720 2:128306842-128306864 CCCTCACTCCCCAGGCCCCTTGG - Intronic
939664840 2:144938317-144938339 CCCACACTCCCCAAGCCAGCAGG - Intergenic
940144193 2:150528129-150528151 CCCACTTTCCCCATGCCCAGGGG + Intronic
942620013 2:177835781-177835803 CCCTCACTGCCCAGGGCCGGCGG - Intronic
944824844 2:203472163-203472185 CCCTCTCTCACCCAGACTGGAGG + Intronic
945009097 2:205442586-205442608 CCCGTTCTTCCCAGGCCCGGCGG - Intronic
946012192 2:216574179-216574201 CCCTCTTTCCCCACCCCTGGAGG - Intronic
946149298 2:217753385-217753407 CCCTCTTTGCCCCAGCCTGGAGG - Intronic
946226747 2:218267916-218267938 CGCTCTGTACCCAACCCCGGTGG - Intronic
946282194 2:218673787-218673809 CCCTGTCTCCCCAAGCACAAGGG + Intronic
948094799 2:235325128-235325150 CCCTCCCTCCCCCAGCCCAGAGG + Intergenic
948466755 2:238155918-238155940 CTCTCTGTCCCCAACCCAGGCGG + Intergenic
949025093 2:241764011-241764033 CCCTCTGTCACCCAGGCCGGAGG - Intronic
1168795158 20:606340-606362 CCCTCCCACCCCAAGTCTGGAGG + Intronic
1168856037 20:1009783-1009805 CCCTCCCTCACCAACCCCAGTGG + Intergenic
1168877283 20:1180476-1180498 CCCTCACTCCCCAAGGCATGAGG + Intronic
1169083933 20:2815524-2815546 CTCTCTCTCCACAGGCCCGCAGG + Exonic
1169227095 20:3863754-3863776 CCCTCTCTTCCCAAGCCTCCGGG + Intronic
1169424346 20:5484741-5484763 CCCTCTCTCCCCCACACTGGGGG + Intergenic
1169557730 20:6768115-6768137 CCCTCGCTCTCCTAGCCCTGGGG - Exonic
1170210067 20:13839216-13839238 CTCTCTCTCCCCATCCCCAGTGG - Intergenic
1171814934 20:29777799-29777821 CCCTCTCTTGCCCAGCCAGGCGG - Intergenic
1172033722 20:31997843-31997865 CCCACTCTCCACAACCCCTGAGG - Exonic
1172125746 20:32624259-32624281 TCCTCTCTCCCCTAGGCTGGAGG + Intergenic
1172801782 20:37581171-37581193 CCCAGTCTCCCCAAGGCTGGGGG - Intergenic
1173168149 20:40700656-40700678 CCCTCTCTTCCCAAACACTGGGG - Intergenic
1173794162 20:45847332-45847354 CCCTCTCTCCCCCAGGCCCCTGG - Intronic
1174189287 20:48728699-48728721 CCTTCTCACGCCAAGCCCTGGGG - Intronic
1175108109 20:56628727-56628749 TCCTCTCTCCTCCCGCCCGGGGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175760980 20:61562097-61562119 CCCTCTCTCCGGGAGCCCTGGGG - Intronic
1175814376 20:61875892-61875914 CCCTCTCTCCCCAGGGCAGGCGG - Intronic
1175910612 20:62403610-62403632 CCCCCTCCTCCCAAACCCGGTGG - Intronic
1176160261 20:63644017-63644039 CCCCCTCTCGCCCAGCCCTGGGG - Intronic
1177394142 21:20511140-20511162 CCCTCCCACCACAAGCCCAGAGG - Intergenic
1178297006 21:31418516-31418538 TCCACTCTCCCCTACCCCGGTGG + Intronic
1178843598 21:36156871-36156893 GTCTCTCTCCCCCAGCCCGGAGG + Intronic
1179600981 21:42476988-42477010 CCCTCTGTCCCACAGCCCGGGGG + Intronic
1179600994 21:42477021-42477043 CCCTCTGTCCCACAGCCCGGGGG + Intronic
1179601076 21:42477217-42477239 CCCTCTGTCCCACAGCCCGGGGG + Intronic
1180318374 22:11298349-11298371 CACTCTCTTCCCCAGCCAGGCGG - Intergenic
1180661286 22:17469489-17469511 CTGTCTCTCCCCAAGCAGGGGGG + Intronic
1181443645 22:22951932-22951954 CCCTCTGTCCACAAGCCCACTGG - Intergenic
1181495340 22:23284419-23284441 CCTTGTCTCCCCGAGCCTGGTGG + Intronic
1182043884 22:27259450-27259472 CCATCGCTCCCCCAGCCTGGAGG + Intergenic
1182755607 22:32676402-32676424 CCCTATCTGCAGAAGCCCGGAGG + Intronic
1182759222 22:32708603-32708625 CCCTCTCTCCCCAAACCACCGGG - Intronic
1182904124 22:33921312-33921334 CCTTCTTCCCCCAACCCCGGCGG + Intronic
1183132817 22:35855852-35855874 CCATCTCTACCCAGGCCTGGTGG + Intronic
1183407297 22:37636580-37636602 ACCTCCCTCCCCAAGCCCAAAGG - Intronic
1183465814 22:37979956-37979978 CCCTCCCTCCCCAGGCTGGGCGG + Intronic
1183683553 22:39349367-39349389 CCCTCCCACCCCCAGCCTGGAGG - Intergenic
1183696718 22:39427875-39427897 GCCTGGCTCCCCAAGCCCAGTGG - Intronic
1184070126 22:42142193-42142215 CCCTCTCTCTCCTTGCCCAGAGG + Intergenic
950829626 3:15860277-15860299 CCCACCCTCCCCAAACCCAGGGG - Intergenic
951024867 3:17817938-17817960 CCCTCACTGCCCAGGGCCGGTGG + Intronic
952076306 3:29701684-29701706 CTCTCACTGCCCAAGGCCGGTGG - Intronic
952348960 3:32516031-32516053 CCCTCTGTCCCCCAGACTGGAGG - Intergenic
954699412 3:52443532-52443554 ACCTCCCTAGCCAAGCCCGGAGG - Intronic
954757983 3:52852494-52852516 CACCCTCTCCCCAAGCCAGAGGG + Intronic
959049735 3:101513179-101513201 CCCTCCCTCTCCAAGCCGGAGGG - Exonic
961298224 3:125904041-125904063 CCCTCACTGCCCAGGGCCGGCGG - Intergenic
961700803 3:128743174-128743196 CCCTCACTGCCCCAGGCCGGTGG + Intronic
961749940 3:129088880-129088902 CCCTCCCTCCCTAAGCCCTGAGG + Exonic
964195889 3:154063799-154063821 TCCTCTGTCACCAAGCCCAGTGG + Intergenic
964265387 3:154889492-154889514 CCCTCACTGCCCGAGGCCGGCGG + Intergenic
964548114 3:157857612-157857634 CCCTCTCTCCCCTCACCCGTGGG + Intergenic
965199029 3:165632719-165632741 CTCTCTCTGCTCAAGCCCAGTGG + Intergenic
966853980 3:184181538-184181560 CCCTCTCATCCCAAGCTCTGGGG + Intronic
967849539 3:194071404-194071426 CCCGCCTTCCCCACGCCCGGCGG + Intergenic
967953360 3:194857957-194857979 CCCTCTCTCTCCATGTCTGGTGG + Intergenic
968362283 3:198155695-198155717 AACTCGCTCCCCAAGCCCGTAGG - Intergenic
968726758 4:2251424-2251446 CCCTCCCTGCCCCAGCCAGGCGG + Intronic
971161694 4:24140060-24140082 CCCTCTCTCCCCATGACCTCTGG - Intergenic
971744805 4:30566190-30566212 CCCTCTCATCACAAGCCTGGAGG + Intergenic
973317876 4:48780251-48780273 CGCTCTCTCCCAGAGCCCGACGG + Exonic
973333587 4:48934001-48934023 CCCTCTCTCCTCCAACACGGGGG + Intergenic
975483439 4:74907494-74907516 CCCTCTCTCCCCAAGATAGGAGG - Intergenic
977606943 4:98993738-98993760 CCCTCACTGCCCGAGGCCGGCGG + Intergenic
980880599 4:138706553-138706575 TCTTCTCTCCCAAAGCCCTGAGG - Intergenic
981096925 4:140791687-140791709 CCCTCTGTCACCAAGGCTGGAGG + Intergenic
983843191 4:172482124-172482146 CCCTCACTGCCCAGGGCCGGTGG + Intronic
984031693 4:174612300-174612322 CCCTCTCATCCCAGGCCCTGAGG - Intergenic
985674682 5:1224875-1224897 CCCTCTGCCCCCACGCACGGTGG + Exonic
986256976 5:6108781-6108803 CCCCCACTCCCCAGGCCCAGAGG - Intergenic
986347171 5:6846198-6846220 CCCCCTCCCCCCAAGCCCCGAGG + Intergenic
986412414 5:7493941-7493963 CGCTCTCTCCCCGGTCCCGGTGG + Intronic
986439595 5:7768134-7768156 CCCCCTCTTCCCAAGCCCAAGGG - Intronic
992115370 5:73534113-73534135 TTCTCTCTCCCCAAGCCCACAGG + Intergenic
992681945 5:79162334-79162356 CCCTCTATGGCCAAGCGCGGTGG + Intronic
994140573 5:96336355-96336377 CCCTCTCTCCCTAAGCATGAAGG - Intergenic
996236937 5:121141801-121141823 CCCTCTCAACACAAGCCCAGTGG - Intergenic
996698342 5:126423325-126423347 GCCTCTTTCCCCAACCCAGGAGG - Intronic
998039986 5:138945773-138945795 CCCACTCTGCCCTAGCCCTGAGG + Intergenic
998461976 5:142316508-142316530 CCCTCCCTCCCCATTCCCTGGGG - Intronic
999262734 5:150247662-150247684 CTCCCTCTCCCCAGGCCCAGTGG + Intronic
999384700 5:151145939-151145961 CCCTCTCTCCTCAACCTAGGTGG + Intronic
999394353 5:151217608-151217630 CCCTCTCTCCCAGATCCTGGTGG + Intronic
999460924 5:151757326-151757348 CCTTCACTCCCCAAGCCCCAGGG + Intronic
1000668386 5:164027572-164027594 TCCTCTATCCCCCAGCCCAGTGG - Intergenic
1001097523 5:168787281-168787303 CCCTCTTGCCCCAAGCCCCGTGG - Intronic
1002065934 5:176651645-176651667 CCTTCTCACCCCAGGCCCAGAGG - Exonic
1002817701 6:694734-694756 CCCTCACTGCCCAGGGCCGGCGG - Intergenic
1003901586 6:10659995-10660017 CCCTCACTGCCCAAGGCCGGCGG - Intergenic
1005153558 6:22779209-22779231 CCCTCTCACCACAGGCCTGGGGG + Intergenic
1006116843 6:31780146-31780168 CCCTCTCTCCCCAAGCCCGGAGG - Exonic
1006136116 6:31897339-31897361 CCCGCTGCCCCCCAGCCCGGTGG + Intronic
1006432013 6:34002854-34002876 CCCCAGCTCCCCAAGCCCTGTGG - Intergenic
1006459721 6:34151408-34151430 CTCTCTCTCCACATGTCCGGGGG + Intronic
1006517525 6:34553169-34553191 CTCTCCCTCCCCAAGTCTGGAGG + Intronic
1007738730 6:43998208-43998230 CCCTCACTGCCCAGGGCCGGTGG - Intergenic
1009471411 6:64031266-64031288 CCCTCACTGCCCAGGGCCGGTGG - Intronic
1009642923 6:66361621-66361643 CCCTCTCTCCTCAAGAGCAGAGG - Intergenic
1010270363 6:73910097-73910119 CCCTCACTGCCCAGGGCCGGTGG - Intergenic
1014402454 6:121007385-121007407 ACCTCTCTCCCAAACCCCAGAGG - Intergenic
1015832421 6:137384857-137384879 CTCTCTCTCCTCCAGCCCTGAGG - Intergenic
1016470511 6:144370212-144370234 CCCTCCCATCCCAAGCCAGGAGG + Intronic
1016589456 6:145728870-145728892 CCCTCTCACCACAAGCCTGGAGG + Intronic
1018247374 6:161835798-161835820 CCCTGTCTCTCTAAGCCTGGAGG + Intronic
1018857594 6:167685722-167685744 CCCTCCCTCCCTGAGCCCTGGGG - Intergenic
1019015061 6:168874059-168874081 CCCTCTTTCTCCAAGCCCAGCGG - Intergenic
1019452539 7:1107226-1107248 CCCACTATCCCCAAGCTCAGTGG + Intronic
1019704984 7:2493333-2493355 GTCTCTCTCCCCAAGCCCTGGGG - Intergenic
1020044864 7:5033242-5033264 GAGTCTCTCCCCAAGCCAGGGGG - Intronic
1020064836 7:5179880-5179902 TCCTCTCTCCCCACTCCCTGGGG + Intergenic
1020290262 7:6717580-6717602 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1020313183 7:6885051-6885073 CTCTCTCTCGCCCAGCCCTGGGG + Intergenic
1022505617 7:30907300-30907322 CCAGCCCTCTCCAAGCCCGGGGG - Intergenic
1023016144 7:35970204-35970226 CCCTCTCTCTCCATTCCCAGAGG + Intergenic
1023825475 7:44005968-44005990 GAGTCTCTCCCCAAGCCAGGGGG + Intronic
1025140721 7:56461190-56461212 CACTCCCTCCCCCAGCCCAGGGG - Intergenic
1026089026 7:67284741-67284763 GAGTCTCTCCCCAAGCCAGGGGG + Intergenic
1026290109 7:68998472-68998494 CCCTCTCTCCCCAGGCCACAGGG - Intergenic
1026725228 7:72865609-72865631 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1026747364 7:73023818-73023840 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1026751014 7:73051961-73051983 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1026754663 7:73080071-73080093 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1026758315 7:73108105-73108127 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1027033467 7:74908403-74908425 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1027089090 7:75285381-75285403 GAGTCTCTCCCCAAGCCAGGGGG + Intergenic
1027092733 7:75313309-75313331 GAGTCTCTCCCCAAGCCAGGGGG + Intergenic
1027096376 7:75341276-75341298 GAGTCTCTCCCCAAGCCAGGGGG + Intergenic
1027118616 7:75500067-75500089 GAGTCTCTCCCCAAGCCAGGGGG + Intergenic
1027273183 7:76535401-76535423 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1027326627 7:77054472-77054494 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1027605403 7:80292910-80292932 CCCTCTCATCACAAGCCTGGAGG - Intergenic
1028036328 7:85988628-85988650 ACCTCTCTGCCCAAGCCCTTTGG + Intergenic
1028719426 7:94012119-94012141 CCCTCACTCCCCGAGGCCTGCGG + Intergenic
1029191595 7:98775995-98776017 CACTCTCTCCCCACTCCCTGGGG + Intergenic
1029281513 7:99438768-99438790 CCCCCTCTCCCCAAGCGCGCAGG + Exonic
1029441086 7:100586900-100586922 CCCGCCCGCCCCCAGCCCGGGGG - Intronic
1029513002 7:101008483-101008505 CCCTGTCTCCCAAAACCCTGAGG - Intronic
1029718874 7:102349954-102349976 GAGTCTCTCCCCAAGCCAGGGGG - Intergenic
1029753741 7:102559303-102559325 GAGTCTCTCCCCAAGCCAGGGGG + Intronic
1029771689 7:102658390-102658412 GAGTCTCTCCCCAAGCCAGGGGG + Intronic
1030772193 7:113488222-113488244 CCCTCTTTCCCCCCGCCCCGTGG - Intergenic
1033459576 7:141533218-141533240 CCCTCAGTCCCCAAGTCTGGCGG - Intergenic
1034054655 7:148021794-148021816 CCCTCTCCCCCAAAACCTGGAGG + Intronic
1034227390 7:149494562-149494584 CCCTCTCTCCCTAGGCACGGGGG + Intronic
1034242568 7:149621618-149621640 CCCTCTCTCCCTAGGCACGGGGG + Intergenic
1034960243 7:155360250-155360272 TCCTGTCTCCCCAGGGCCGGTGG + Intronic
1035453741 7:158996249-158996271 CCTTCTGTCCTCCAGCCCGGTGG + Intergenic
1035590527 8:809735-809757 CGCTCTCTCTCCAAGGCCAGGGG - Intergenic
1036394592 8:8358434-8358456 GCCTCTCTCCCCAACCCTGTGGG + Intronic
1036799572 8:11780068-11780090 GCCTCTCTCCCCAAGACAGCAGG - Intronic
1037048777 8:14342877-14342899 CCCTCTCTTCACAGGCCTGGAGG + Intronic
1037479453 8:19290440-19290462 CCCTCGCTTCCCAACCTCGGCGG - Intergenic
1037876452 8:22551294-22551316 CACCCTCTCCCCCAGCGCGGAGG + Intronic
1037878009 8:22558240-22558262 CCCTGTCTCTCCAAGCCCCAGGG - Intronic
1037947139 8:22996684-22996706 CCCTCCCACCCCAGGCCCTGAGG - Intronic
1038295978 8:26291457-26291479 CGCTCTCCGCCCCAGCCCGGCGG + Intergenic
1039778073 8:40756263-40756285 ACCTTTCTCCACAAGCCTGGTGG - Intronic
1040915513 8:52564148-52564170 TCTCCTCTTCCCAAGCCCGGTGG + Intronic
1041422956 8:57689778-57689800 CGCTCTGTCCCCCAGCCTGGAGG - Intergenic
1043441992 8:80284416-80284438 CCTTAACTCCCCAAGCCTGGGGG + Intergenic
1044194097 8:89353573-89353595 CCCTCTCATCACAAGCCTGGAGG - Intergenic
1047541281 8:125768781-125768803 CGCTCCCTCCCCAAACCCTGTGG - Intergenic
1048533884 8:135274502-135274524 CCCTCAATCCCCAAGTCTGGGGG + Intergenic
1048992921 8:139771890-139771912 CCCTCTCTCGGCAAGCCAGGAGG - Intronic
1049099533 8:140569032-140569054 CCTTCTCTCCCCAAGCCTTCAGG + Intronic
1049255859 8:141613460-141613482 CCCACTCTCCCCATGGCCTGTGG - Intergenic
1049602957 8:143516379-143516401 CCCTCTGGCCCCACGCCCTGAGG + Intronic
1050933792 9:11366896-11366918 CCCTCTCTGCCCACGCACGCAGG - Intergenic
1050953516 9:11627156-11627178 CCCTCTCATCACAGGCCCGGAGG + Intergenic
1053051948 9:34969352-34969374 CCCTCTTTCGCCAGGCACGGTGG + Intronic
1053443811 9:38136366-38136388 CCCTCTCTCCCCCTGCCCCTGGG + Intergenic
1055122239 9:72674734-72674756 CCCTGTCTCCCAAATCCTGGAGG - Intronic
1055588864 9:77788193-77788215 CCCTCTCACCCCAACCCCTAAGG - Intronic
1055766787 9:79672115-79672137 CCCTCTCTCCCCAGGACAGGAGG - Intronic
1055951075 9:81730307-81730329 CCCTGTCTCCCCTGGCACGGTGG + Intergenic
1056190696 9:84181387-84181409 CCCTCTCACCCCTAGGCCGGGGG - Intergenic
1059674868 9:116528665-116528687 CCCTCTCATCACAAGCCTGGAGG + Intronic
1060985779 9:127818230-127818252 CCTGCTGTCCCCAAGCCCCGAGG - Exonic
1061310013 9:129755993-129756015 CTCTCTCGCCCCCAGCCCGTGGG + Intergenic
1061354447 9:130093840-130093862 CACTCTCTCCCCTAGCCCCCAGG + Intronic
1061638936 9:131936258-131936280 CCCTATCTCCCCAAGCCTCCAGG - Intronic
1061959651 9:133981520-133981542 CACCCTCACCCCGAGCCCGGCGG - Intronic
1061971688 9:134048710-134048732 ACCTCTCTCCCTTAGCCCCGAGG + Intronic
1062132704 9:134908568-134908590 CCCTCTCCCCCCAAGCCCCATGG - Intronic
1062271850 9:135713498-135713520 CTCTCTCTCCTCAAGTCGGGAGG - Intronic
1185464789 X:347686-347708 CCCTCTCTGCCCCAGGCCTGCGG - Exonic
1185527455 X:790776-790798 CCCCCTCTCCCCACCCTCGGAGG + Intergenic
1187387804 X:18864289-18864311 CCCCCTCTCCCCATGCCTGGGGG + Intergenic
1187447927 X:19374194-19374216 CACTCTCTTCCCAATCCCGAAGG + Intronic
1188062539 X:25618462-25618484 CCCTCTCGTCACAGGCCCGGAGG - Intergenic
1188736689 X:33726334-33726356 CCCGCCCTCCCCACGCGCGGGGG + Intergenic
1189209829 X:39275725-39275747 CCCTCACTGCCCAAGGCCGGTGG - Intergenic
1190031532 X:46977866-46977888 CCCTCTCTTCCCAAGAACTGGGG - Intronic
1190137232 X:47807967-47807989 CCCTCCCTCCCCATGCCCTGAGG - Intergenic
1190153315 X:47966746-47966768 CCCTCTCATCACAAGCCCAGAGG + Intronic
1192225388 X:69223822-69223844 CTCTGTCTCCCCAAGCCAGAGGG - Intergenic
1192677533 X:73214316-73214338 CCCTTCTTCCCCAAGCCCAGCGG + Exonic
1198936375 X:141905109-141905131 CCCTCTCTCCCTCAGTCCTGTGG + Intronic
1199606442 X:149583236-149583258 CCCTCTCTCCCCAGGCCTGTGGG - Exonic
1199615165 X:149650176-149650198 CCCTCTCTCCTCAGGCCTGTGGG - Intergenic
1199623008 X:149715739-149715761 CCCTCTCTCCCCAGGCTGTGGGG + Exonic
1199632680 X:149786132-149786154 CCCTCTCTCCCCAGGCCTGTGGG + Exonic
1199643522 X:149884196-149884218 TCCTCTCTCCCCAGGCCTGTGGG + Exonic
1199894070 X:152115597-152115619 CCCTCTCTCTCCAGGCCAGTGGG - Intergenic
1199896941 X:152135677-152135699 CCCTCTCTCCCCAGGCCTGTGGG - Exonic
1199950257 X:152700754-152700776 CCCTCTCTCCCCAGGCCAGTGGG + Exonic
1199952541 X:152717028-152717050 CCTTCTCTCCCCAGGCCTGTGGG + Exonic
1199957142 X:152751420-152751442 CCTTCTCTCCCCAGGCCTGTGGG - Exonic
1199959421 X:152767707-152767729 CCCTCTCTCCCCAGGCCAGTGGG - Exonic
1199972480 X:152871447-152871469 CACTCTCTTCACAAGCCCTGTGG + Intergenic
1200018439 X:153182311-153182333 CCCTCTCTCCCCAGGCCTGTGGG + Exonic
1201072077 Y:10156116-10156138 CACTCTCTTCCCCAGCCAGGCGG + Intergenic
1201188977 Y:11430361-11430383 CCCTCTCCCCCCAGTCCCCGTGG + Intergenic