ID: 1006119334

View in Genome Browser
Species Human (GRCh38)
Location 6:31794921-31794943
Sequence CGGCTGTCCTTGTCCAACAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006119334_1006119353 25 Left 1006119334 6:31794921-31794943 CCACTGTTGGACAAGGACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1006119353 6:31794969-31794991 GCCTGCTGGCCACAGCAGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 299
1006119334_1006119352 24 Left 1006119334 6:31794921-31794943 CCACTGTTGGACAAGGACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1006119352 6:31794968-31794990 GGCCTGCTGGCCACAGCAGCTGG 0: 1
1: 0
2: 2
3: 45
4: 369
1006119334_1006119346 11 Left 1006119334 6:31794921-31794943 CCACTGTTGGACAAGGACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1006119346 6:31794955-31794977 CCTGGGCCCCCCAGGCCTGCTGG 0: 1
1: 0
2: 7
3: 80
4: 768
1006119334_1006119337 -6 Left 1006119334 6:31794921-31794943 CCACTGTTGGACAAGGACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1006119337 6:31794938-31794960 CAGCCGCCCGGCTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 269
1006119334_1006119341 3 Left 1006119334 6:31794921-31794943 CCACTGTTGGACAAGGACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1006119341 6:31794947-31794969 GGCTGCCCCCTGGGCCCCCCAGG 0: 1
1: 0
2: 3
3: 60
4: 597
1006119334_1006119336 -7 Left 1006119334 6:31794921-31794943 CCACTGTTGGACAAGGACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1006119336 6:31794937-31794959 ACAGCCGCCCGGCTGCCCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006119334 Original CRISPR CGGCTGTCCTTGTCCAACAG TGG (reversed) Exonic
902782897 1:18716128-18716150 CGGGTGTCCTTGGCCACCAGGGG + Intronic
910714056 1:90210731-90210753 AGGCACTGCTTGTCCAACAGAGG - Intergenic
918449321 1:184643644-184643666 CAGCTGTCCTTATTCAGCAGAGG + Intergenic
922513292 1:226186983-226187005 CGGCTGTCAGTGCCCAGCAGGGG + Intergenic
1063212510 10:3893967-3893989 CGGCTGACTTTGTTCATCAGTGG + Intergenic
1075672119 10:124269995-124270017 CTGCTCTCCTTCTCCAGCAGAGG + Intergenic
1080491500 11:32769379-32769401 CAGTTGTCCTTGTACCACAGTGG - Intronic
1088359770 11:108978064-108978086 TGGAGGTCCTAGTCCAACAGGGG - Intergenic
1091676971 12:2498670-2498692 GGGCTGTCCTGCTCCCACAGAGG - Intronic
1091854710 12:3730163-3730185 AGGCTGTCTTTTTCCAGCAGAGG - Intronic
1099865826 12:88279458-88279480 GGGTTCTCCTTGGCCAACAGGGG - Intergenic
1106420735 13:29583450-29583472 CTGCTGGCCTTGACCCACAGAGG - Intronic
1118040192 14:61908084-61908106 AGGCTGGTCTTGTCCTACAGGGG - Intergenic
1118161236 14:63292597-63292619 AGGCTGGCTTTTTCCAACAGTGG - Exonic
1118276913 14:64393671-64393693 TGTCTGTCCTTGTCCATCAGGGG + Intronic
1119729538 14:76942216-76942238 CTGCTGTCCTTAGCCAGCAGAGG + Intergenic
1123994694 15:25710287-25710309 CGACTGTCCCTGCCCAGCAGGGG - Intronic
1125606795 15:40944043-40944065 TTGCTGTCCTTTTCCCACAGTGG + Intergenic
1128331605 15:66759892-66759914 TGGCTCTCCTTGCCCAACACAGG + Intronic
1132092238 15:98956125-98956147 CGGCTTTCCTTGTCCACGTGTGG + Intronic
1142008615 16:87702274-87702296 CGGCCCTCCTTGCCAAACAGTGG - Intronic
1143723445 17:8829773-8829795 CAGGTGACCTTGTCCAAGAGCGG - Exonic
1143733627 17:8895358-8895380 TGGATGTCCTTGGTCAACAGAGG - Intronic
1144301465 17:13925710-13925732 AGGATATCCTTGCCCAACAGAGG - Intergenic
1149357617 17:55859157-55859179 CAGCTGTCCTTGCCCCTCAGAGG + Intergenic
1153145052 18:2021800-2021822 CTGCTGTCCCAGTACAACAGAGG - Intergenic
1155270770 18:24139331-24139353 CGCCTGGACTTGTCCAAGAGAGG - Intronic
1157298872 18:46465433-46465455 CAGCAGTCCCTGTCCAGCAGGGG + Intergenic
1157983287 18:52407396-52407418 CGGTTGTCCAGGTCCAAAAGAGG + Intronic
1158437268 18:57442290-57442312 AGGCTGAGCTTTTCCAACAGCGG + Intronic
1160958669 19:1707224-1707246 TTGGTGTCCTTGTCCAGCAGTGG + Intergenic
1161376130 19:3939901-3939923 CGGCTGTACAAGTCCACCAGGGG - Exonic
1168498426 19:56873529-56873551 CGGCTGGGCTTGGCCACCAGAGG + Intergenic
928214563 2:29350490-29350512 CAGCTGTCTCTGTCCCACAGAGG - Intronic
928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG + Exonic
933318405 2:80742331-80742353 TGGCTGTGTTTGTGCAACAGTGG - Intergenic
946892545 2:224293161-224293183 CATCTGTCCTTGGCCAAAAGAGG + Intergenic
947195336 2:227559507-227559529 CATCTGTGCTTGTCCAACACAGG + Intronic
1179152632 21:38822014-38822036 AGGCTGCCCTTGTCCATCGGGGG + Intronic
1179985799 21:44919768-44919790 CTGCTGTCCCTGTCCATCCGGGG - Intronic
1181534833 22:23536031-23536053 AGGCAGTCCTTGTCCCACAGGGG - Intergenic
950188305 3:10958866-10958888 CGGCTGGCCATGTCCTACTGAGG + Intergenic
952628734 3:35439529-35439551 GGGCTCCCCTTGGCCAACAGGGG + Intergenic
959894588 3:111591956-111591978 AGGATGTCCTTGTGTAACAGTGG - Intronic
966143360 3:176782383-176782405 TAGCTGTCCTTTTCCATCAGAGG + Intergenic
968303068 3:197630769-197630791 GCGCTGTCCTGGTCCATCAGGGG + Intergenic
971255143 4:25007777-25007799 CAGCTGTCCATGTGCACCAGGGG - Intronic
979855707 4:125631482-125631504 AGGCTGTCCCTCTACAACAGGGG + Intergenic
983195781 4:164804844-164804866 CGGCTGTTCTTATTCAAAAGGGG + Intergenic
983207803 4:164929752-164929774 CGACTATACTTGTCCAACAGCGG - Intergenic
984887521 4:184463856-184463878 CTACTGTCATTCTCCAACAGGGG + Intronic
985507679 5:293169-293191 GCGCTGTCCTGGTCCATCAGGGG - Intronic
985740293 5:1611960-1611982 GCGCTGTCCTGGTCCATCAGGGG + Intergenic
985772540 5:1821906-1821928 CGGCTGTCCTTGGCCATCTTTGG + Intergenic
985772558 5:1821997-1822019 CGGCTGTCCTTGGCCATCTTTGG + Intergenic
991260139 5:64658243-64658265 CGGCTGTCTTTGGCGAAGAGAGG - Intergenic
1006119334 6:31794921-31794943 CGGCTGTCCTTGTCCAACAGTGG - Exonic
1019276989 7:180991-181013 CCTCTGTTTTTGTCCAACAGAGG + Intergenic
1023865793 7:44237808-44237830 GGTCTCTCCTTGTCCCACAGAGG - Intronic
1024038822 7:45533479-45533501 CGGCTGTCCCAGGCCAACACTGG + Intergenic
1024904403 7:54360037-54360059 AGGCTTTCCTTGATCAACAGTGG + Intergenic
1026237223 7:68537864-68537886 TAGCTATCCTTGTCCAGCAGGGG - Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1036759652 8:11498612-11498634 CGGCTGGCCTTGTCAACCAGAGG + Intronic
1038446464 8:27607819-27607841 GGGTTGTCCTTGCCCAGCAGGGG - Intronic
1043091636 8:75912092-75912114 AGGGTGTCCTTGGCCAAGAGAGG + Intergenic
1048800312 8:138188704-138188726 AGGCTGTGCTTGTGGAACAGTGG - Intronic
1049317588 8:141977505-141977527 GGGCTGTCCTGGCCCCACAGGGG + Intergenic
1050259136 9:3822691-3822713 CGGCTGTTCTTGAACTACAGTGG + Intergenic
1054715850 9:68557211-68557233 CGAATGTCCTTGTCCAGAAGTGG - Intergenic
1059398880 9:114056343-114056365 TGTCTGTTCTTGTCCAAAAGTGG + Exonic
1061245577 9:129399840-129399862 AGGCAGTCCTTGTCCCACAGGGG + Intergenic
1062101881 9:134732825-134732847 GGGGTGTCCTTGTCCCATAGGGG + Intronic
1062645663 9:137546896-137546918 GGGCTGTGCTTGTCCTGCAGGGG + Exonic
1188176334 X:26995344-26995366 CTGCTGTGCTTGTTCCACAGTGG - Intergenic
1189736304 X:44073142-44073164 AGGCTGTCCTCATCCAACATTGG + Intergenic
1194176954 X:90662208-90662230 TGGCTGTTTTTGTCCAAAAGAGG - Intergenic