ID: 1006119344

View in Genome Browser
Species Human (GRCh38)
Location 6:31794954-31794976
Sequence CAGCAGGCCTGGGGGGCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 599}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006119344_1006119363 29 Left 1006119344 6:31794954-31794976 CCCTGGGCCCCCCAGGCCTGCTG 0: 1
1: 0
2: 7
3: 56
4: 599
Right 1006119363 6:31795006-31795028 CCCCACACCCAGAGCCCACCGGG 0: 1
1: 0
2: 4
3: 65
4: 565
1006119344_1006119356 4 Left 1006119344 6:31794954-31794976 CCCTGGGCCCCCCAGGCCTGCTG 0: 1
1: 0
2: 7
3: 56
4: 599
Right 1006119356 6:31794981-31795003 CAGCAGCTGGGCCACAGCCGTGG 0: 1
1: 0
2: 2
3: 39
4: 353
1006119344_1006119361 28 Left 1006119344 6:31794954-31794976 CCCTGGGCCCCCCAGGCCTGCTG 0: 1
1: 0
2: 7
3: 56
4: 599
Right 1006119361 6:31795005-31795027 CCCCCACACCCAGAGCCCACCGG 0: 1
1: 0
2: 3
3: 82
4: 1099
1006119344_1006119353 -8 Left 1006119344 6:31794954-31794976 CCCTGGGCCCCCCAGGCCTGCTG 0: 1
1: 0
2: 7
3: 56
4: 599
Right 1006119353 6:31794969-31794991 GCCTGCTGGCCACAGCAGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 299
1006119344_1006119352 -9 Left 1006119344 6:31794954-31794976 CCCTGGGCCCCCCAGGCCTGCTG 0: 1
1: 0
2: 7
3: 56
4: 599
Right 1006119352 6:31794968-31794990 GGCCTGCTGGCCACAGCAGCTGG 0: 1
1: 0
2: 2
3: 45
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006119344 Original CRISPR CAGCAGGCCTGGGGGGCCCA GGG (reversed) Exonic
900131931 1:1090915-1090937 GGACAGGCCTGGGGGGCTCAGGG + Intronic
900206037 1:1432290-1432312 CAGCAGGCCTGAATGACCCAGGG - Intergenic
900212077 1:1461050-1461072 CAGGAGCCCTGTGGGCCCCAAGG + Intronic
900370051 1:2328270-2328292 CAGCGGGGCTGTGAGGCCCAGGG + Intronic
900412343 1:2518432-2518454 CTCCAGGCCAGGGCGGCCCAGGG - Intronic
900572657 1:3366391-3366413 GAACAGGCATGGAGGGCCCAGGG - Intronic
900605754 1:3522863-3522885 CAGGGGGCCTGAGGGGACCAGGG + Intronic
900642077 1:3692546-3692568 CAGCAGGCCTGGGGCTCCTGGGG + Intronic
900643639 1:3698899-3698921 CTGCAGGACTGCGAGGCCCAGGG - Intronic
900691353 1:3982424-3982446 CAGCAGGCGTGCGGGGACCTGGG + Intergenic
901050295 1:6422893-6422915 CAGCAGCCCTAGGGAGCTCACGG - Intronic
901152428 1:7112767-7112789 CAGAGGGCCTGGGAGACCCAGGG - Intronic
901235459 1:7665117-7665139 CAGCATGCCTAGGGTGCCCTGGG - Exonic
901910199 1:12451052-12451074 CAGCAAGCATGGGGTGCCAAAGG - Intronic
901954614 1:12775217-12775239 CAGAAGGAGTGGGAGGCCCAAGG + Intronic
902549895 1:17212929-17212951 CAGCAGGCCAGGGAGGCCTAGGG - Intronic
902686829 1:18082855-18082877 GACCAGGCCTGGGGGCCCCATGG + Intergenic
902752397 1:18526162-18526184 CAGCAGGTCTGGGTGTCCCAAGG + Intergenic
902824331 1:18962630-18962652 CAGCAGCCCTGGGGGAGCCCTGG + Intergenic
904331573 1:29761344-29761366 CAGCACACCCAGGGGGCCCAAGG - Intergenic
904392279 1:30193932-30193954 CAGCAGCCTTGGAGGGGCCAGGG + Intergenic
904600052 1:31668165-31668187 AGGCAGTCCTGGGGGGCCCGTGG + Exonic
905174312 1:36126292-36126314 TAGAAGGCCAGGGAGGCCCACGG + Intergenic
905442465 1:38004229-38004251 CCTCAGCCCTGGGGGACCCAGGG - Intronic
905874086 1:41421377-41421399 CAGCAGGCCTGGGAAGCAGACGG + Intergenic
906117791 1:43367487-43367509 CGGCAGGCCAGGAGGGACCAAGG + Exonic
906209049 1:44002217-44002239 AAGGAGGCCTCGTGGGCCCATGG + Intronic
907237898 1:53063885-53063907 CGGGAGGCCTGGGTGGCCAAGGG - Intronic
907400802 1:54223643-54223665 CGGCCGGCCTGGGGGGCCAGAGG - Intronic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
908398338 1:63746692-63746714 CAGCAGCCCTGGGAGGCACAGGG + Intergenic
909086056 1:71171599-71171621 CTACAGGCCTGGGAGGCCTAAGG + Intergenic
911087383 1:93990209-93990231 CAGCCGGCCTGCGGGGACTATGG - Intergenic
914431183 1:147621019-147621041 CAGCATGGCTGGGGAGGCCATGG - Exonic
914864028 1:151410587-151410609 CAACAGGGTTGGGGGGCCCATGG + Intronic
916108712 1:161448114-161448136 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916110300 1:161455495-161455517 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916111885 1:161462905-161462927 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916113472 1:161470286-161470308 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916651588 1:166839382-166839404 CAGCAGGCCTCGGCGGCGCCGGG - Intergenic
917482618 1:175424968-175424990 CAGCAGACCTGGGGGGCCTGGGG + Intronic
917619916 1:176785414-176785436 CAGAAGTCCTGGGAGGCCCATGG + Intronic
917925619 1:179786968-179786990 CAGCAGGCCTGATGCGGCCAGGG - Intronic
920018657 1:202935933-202935955 CAGCATGCCTGGGGAGGCCTAGG + Intergenic
920051202 1:203166096-203166118 CAGGAGGCCTGGGAGGGCAAGGG + Exonic
920336648 1:205249510-205249532 CAGCCGGCCGTGGGGGCCCCTGG + Intronic
921946093 1:220887091-220887113 CGGCAGAGCTGGGGGGCTCAGGG + Intergenic
922057710 1:222057221-222057243 CACCAGGGCTCTGGGGCCCATGG - Intergenic
922746514 1:228047303-228047325 AAGCAGGCCCGAGGGGCTCAGGG + Intronic
922883911 1:229003527-229003549 CACCAGGCCTCGGGGGCACCAGG - Intergenic
923006135 1:230051600-230051622 GACCAGGCCTGGGAGGGCCAAGG + Intergenic
923432426 1:233936191-233936213 CTGCAACCCTGGGGGGGCCATGG - Intronic
923525490 1:234769435-234769457 CAGCTGGCCTGGGGGGCATGTGG - Intergenic
924421094 1:243910875-243910897 CAGCAGGCCTGGAGGGTTCGGGG + Intergenic
1062794088 10:329653-329675 CAGCAAGGCTGGAGGGCTCAGGG + Intronic
1062980334 10:1717315-1717337 CAGCTGCCCTGGGGTCCCCAGGG - Intronic
1065082052 10:22138810-22138832 CAGCACTTCGGGGGGGCCCAAGG - Intergenic
1067102472 10:43343030-43343052 CACCAGGCTTGGTGGGCCCGGGG + Intergenic
1067687901 10:48478844-48478866 CAGCAGGCCAGGAGAGTCCATGG - Intronic
1069707792 10:70469562-70469584 CAGCAGGCAGGGGTGGCCCAGGG - Intergenic
1069896252 10:71681954-71681976 AGGGAGGCCTGGAGGGCCCAAGG + Intronic
1072539324 10:96386153-96386175 CACCAGCCCTGGGTGGCCGAAGG - Exonic
1072551097 10:96478215-96478237 CTGCTGTCCTTGGGGGCCCAAGG - Intronic
1072682265 10:97516110-97516132 CACCAGGCTTGGGGAGCCCCTGG - Intronic
1073046831 10:100644367-100644389 GAGCAGGACTGTGGGGCACAGGG - Intergenic
1073510267 10:104038463-104038485 CCGGAGGCCCAGGGGGCCCAGGG + Exonic
1073942640 10:108715617-108715639 AAGCATGGCTGGGGGGCCCCAGG + Intergenic
1074473271 10:113746398-113746420 GAGCAGGCATGGGGGAGCCAGGG - Intergenic
1074562430 10:114546066-114546088 CAGGAGGCCTCCGGAGCCCAGGG + Intronic
1075096289 10:119473772-119473794 CAGCAGGGCTGCGGCTCCCAGGG - Intergenic
1075198731 10:120383436-120383458 CACCAGGCCTGGGGAGCCTTTGG + Intergenic
1075699105 10:124457112-124457134 CAGGAGGTCTGGGTGGCCCTAGG - Intergenic
1075927644 10:126266158-126266180 CTGTAGGCCTGTGGAGCCCAGGG - Intronic
1076404184 10:130201384-130201406 CCTCAGGCCTGGGGGACACATGG + Intergenic
1076547353 10:131254170-131254192 CATCAGGCCTGGGGGACAAATGG + Intronic
1076591854 10:131588906-131588928 GAGCAGGCCTGGGAGGCACCAGG - Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1076692835 10:132232520-132232542 GACCAGGCCTGGGGGGCTGAGGG + Intronic
1076740608 10:132481839-132481861 AAGCAGGCCTGTGGGGCTGAGGG + Intergenic
1076742418 10:132493302-132493324 CAGCAGGCCCTGGGGGCCCATGG - Intergenic
1076774586 10:132687656-132687678 ATGCAGGGCTGGGAGGCCCATGG + Intronic
1076889179 10:133275604-133275626 CAGCAGGCATGAGGGGCCGGGGG + Intronic
1076983275 11:216880-216902 CAGCAGGCCTGGGCAGAACAGGG + Intronic
1077005855 11:355839-355861 CAGAAGGCCTGGAGGGGCCCGGG + Intergenic
1077229036 11:1450501-1450523 CCGCAGGGCAGGCGGGCCCAGGG - Intronic
1077437449 11:2549704-2549726 CACCAGGCCTGGGGAGCCCAGGG - Intronic
1077461683 11:2714007-2714029 CTGCAGGCCTGGGTGCCCCAAGG - Intronic
1077465179 11:2730593-2730615 CAGGGGGCCTGGGAGGCCCCAGG + Intronic
1077467239 11:2739166-2739188 CAGCATGTCTGGGAGGGCCAGGG + Intronic
1077889824 11:6411006-6411028 TATCAGGCCTTTGGGGCCCAAGG + Exonic
1078164214 11:8868909-8868931 GAGCCGTCCTGGGCGGCCCATGG - Intronic
1078184163 11:9037603-9037625 CAGCAGCCCTGGGGCACCCTGGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1080614746 11:33936083-33936105 CTGCAGGGCTGGGAGGCCCCAGG - Intergenic
1080640231 11:34154393-34154415 GAGCAGGTCTTGGGGACCCATGG + Intronic
1080641762 11:34162479-34162501 CAGCAGGCCTGAGAGGGCCAGGG - Intronic
1081676618 11:44973799-44973821 CAGCAGCCCAGGCGAGCCCAGGG + Intergenic
1082228809 11:49740284-49740306 CAGCAGGCTTAGGGGGTCCTGGG + Intergenic
1083322643 11:61856854-61856876 CCCCAGGCTTGGTGGGCCCAGGG + Intronic
1083667615 11:64284478-64284500 CAGGAGGCCTGGCGGGCCTGGGG - Exonic
1083780118 11:64913427-64913449 CTCCAGGCCTGGGGTGGCCAGGG - Intronic
1083792275 11:64993747-64993769 CATGAGGCCAGGTGGGCCCAGGG - Intronic
1083894375 11:65612877-65612899 CAGCTGACCAGGGGTGCCCATGG - Intronic
1083958445 11:66000241-66000263 CTGCAGCCCTGGAGGGCCCCTGG - Intronic
1084289357 11:68151906-68151928 CAGCAGGGCTGGGGGCCCTAGGG - Intergenic
1084465378 11:69320260-69320282 CAGCAGGTCTGGGGGTCCTCAGG - Intronic
1084479692 11:69412436-69412458 CAGCAGAGCTGGGGAGCGCAAGG + Intergenic
1084524477 11:69687068-69687090 CACCAGGCATGGGAGGCTCAAGG - Intergenic
1084550005 11:69835476-69835498 CAGCAGGGCTGTGGGGCCCTCGG - Intergenic
1084599432 11:70136156-70136178 CCACAGGCCTGGGGGCCACAGGG - Intronic
1084652884 11:70499423-70499445 CAGCAGGCCACAGGCGCCCACGG + Intronic
1084711757 11:70847930-70847952 CAGGAGACCTGGGGAGCCCAGGG + Intronic
1085397759 11:76215620-76215642 GAGCAGGCCTGGGGGCACCACGG + Intergenic
1085463097 11:76706963-76706985 AGGCAGTCCTGGGGGGCCCCAGG + Intergenic
1085469055 11:76745215-76745237 CAGGAGGCCCAGGAGGCCCAGGG - Intergenic
1086080717 11:82900382-82900404 CAGGAGGGCTCGGCGGCCCATGG + Exonic
1086621257 11:88888839-88888861 CAGCAGGCTTAGGGGGTCCTGGG - Intronic
1089396246 11:118137847-118137869 AGGAAGGCCTGGGGGGCCCTGGG - Intronic
1089572737 11:119420977-119420999 CACCAGGGCTGGGGGTCCCTGGG + Intronic
1089772553 11:120814265-120814287 CCCCAGGCCTTGGGAGCCCAAGG + Intronic
1089785395 11:120903677-120903699 CAGCAGGGCTGGGGGTCCCAGGG - Intronic
1089922641 11:122224784-122224806 CAGCATGTCTGGAGTGCCCAAGG + Intergenic
1090188622 11:124753831-124753853 CACCAGGCCTGGGAGGGCCATGG + Exonic
1091393241 12:138691-138713 CTCCAGGCCTGGGGGCCCCGCGG - Exonic
1092531727 12:9350644-9350666 CAGCAGGCCCATGGGCCCCAGGG - Intergenic
1092593678 12:9976079-9976101 CTGCAGGCATGGGGTGCTCATGG + Intronic
1094201073 12:27794998-27795020 CAGGGGGACTGAGGGGCCCATGG - Intronic
1095414594 12:41962479-41962501 CAACAGGCCTGGGTCGGCCAGGG - Intergenic
1095939687 12:47717943-47717965 CAGCCAGCCTGGGGGGCCATGGG - Intronic
1095985001 12:47993636-47993658 CAGCAGGCCTGGAGAGCTCAGGG - Intronic
1096235203 12:49921715-49921737 CAGCTGGCCTGGGGGGTCCTTGG + Intergenic
1096239173 12:49950474-49950496 CAGCAGCCCTGGGGTAACCAAGG + Intergenic
1096573650 12:52539604-52539626 CTGCAGGCCTGGGAAGGCCAAGG + Intergenic
1097054300 12:56240658-56240680 CACTAGGGCTGGGGAGCCCAGGG + Exonic
1098613029 12:72485482-72485504 CAGGAGGCCTGAGGTCCCCAGGG - Intronic
1100434825 12:94561817-94561839 TTGAAGGCCTGGGGTGCCCAAGG - Intergenic
1102000172 12:109552622-109552644 CAGCAAGCCTGAGGGGCCAGAGG + Intergenic
1103457800 12:121080015-121080037 CTGCAGGCCTGGGGGGTTCCGGG - Intergenic
1103621771 12:122191343-122191365 GGGCAGGACAGGGGGGCCCATGG - Intronic
1103701110 12:122849166-122849188 CAGCAGGTCTGGGGGAGCCCAGG - Intronic
1104799087 12:131541111-131541133 CAGCTGGCCTGGGTTGCCCCAGG - Intergenic
1104886751 12:132114784-132114806 GAGCGGGCCTGGGGAGGCCACGG + Intronic
1104899651 12:132181964-132181986 CTCCAGGCCTGGGGGCCCCGGGG + Intergenic
1104954065 12:132455177-132455199 CAGCAGGTCAGGGGGACCCCTGG + Intergenic
1108047196 13:46394422-46394444 CAGCAGGGCTGGGAGTCCCAAGG - Intronic
1110569706 13:76991011-76991033 CAAGAGACCTGGAGGGCCCAAGG + Exonic
1112422497 13:99265355-99265377 CAGCTGGCCTGTGGGTCTCAGGG - Intronic
1113543092 13:111123890-111123912 CAGCAGGCCTGGCAGCCGCAGGG - Intronic
1113947289 13:114051364-114051386 CAGCAGGCGTGGGAGGCTGAGGG - Intronic
1114461398 14:22888209-22888231 CAGCAGGCGTGGGCGTCCCCAGG - Intergenic
1115113894 14:29856704-29856726 CAGCAGGCCTTCAGGACCCATGG - Intronic
1116523538 14:45877438-45877460 CAGCAGCCCTCGGGGGTCTACGG + Intergenic
1116595993 14:46845294-46845316 CAGCAAGGCTGGGAGGCCTAAGG - Intronic
1116991989 14:51286477-51286499 CTGCAGGCCAGGGGTGCTCATGG + Intergenic
1117500297 14:56344615-56344637 CAGCAGCACTAGCGGGCCCAGGG - Intergenic
1117788631 14:59314534-59314556 CAGAAGCCCTGGGGGGCTTAGGG + Intronic
1118324958 14:64774424-64774446 CAGCTGGCCAGCCGGGCCCAGGG - Exonic
1118617076 14:67581214-67581236 CAGAAGGCCTGAGCTGCCCAGGG - Intronic
1119743104 14:77026928-77026950 GAGCAGGCGTCGGGGGCCCACGG + Exonic
1119775637 14:77246685-77246707 CAGCAGCCCTGGTGGACACATGG - Intronic
1121436914 14:93926410-93926432 CCGCAGGCCAGGGGGAGCCATGG + Intronic
1121782699 14:96632062-96632084 CATCAGGCCAGGGAGGTCCAGGG + Intergenic
1122292888 14:100688861-100688883 GAGCAGGCGAGGGGGACCCAAGG + Intergenic
1122411778 14:101529313-101529335 CAGAGGGCATGGAGGGCCCAGGG + Intergenic
1122505167 14:102227414-102227436 CAGAGGGCCTGGGAGTCCCAGGG - Intronic
1122649299 14:103216851-103216873 CAGCAGGCCTGGAGCCTCCAGGG + Intergenic
1122690848 14:103531593-103531615 CAGCAGGCTGGGGGCACCCAGGG + Intronic
1122701052 14:103589440-103589462 CGGCAGGCCTGGGGTTTCCAAGG + Intronic
1122785597 14:104162006-104162028 CAACAGCCCTTGAGGGCCCACGG - Intronic
1122813901 14:104302951-104302973 CAGCCTGCCTGGAGGGCTCATGG - Intergenic
1122929589 14:104927229-104927251 CGGTAGGACTGGGGGGCCCCAGG + Exonic
1122960393 14:105091462-105091484 CAGGAGGCCTGGGGGTCCTGAGG - Intergenic
1122980637 14:105191011-105191033 CAGCAGGAGGGTGGGGCCCAAGG - Intergenic
1123063916 14:105606681-105606703 GAGCAGGCCTGCTGGGCCCCAGG - Intergenic
1123069082 14:105632368-105632390 GAGCAGGCCTGGTGGGCCCCAGG - Intergenic
1123073230 14:105652324-105652346 GAGCAGGCCTGCTGGGCCCCAGG - Intergenic
1123093158 14:105751095-105751117 GAGCAGGCCTGCTGGGCCCCAGG - Intergenic
1123439797 15:20282060-20282082 CATCACACCTGGGAGGCCCAGGG + Intergenic
1123921461 15:25072734-25072756 CAGCAGGCCTGCGCCTCCCATGG - Intergenic
1123941029 15:25216760-25216782 CTCCAAGCCTGGGGGGCCCCTGG - Intergenic
1123989689 15:25674184-25674206 CAGCAAGCCTGAGGGGACCTGGG - Intergenic
1124237681 15:28004033-28004055 TTGCAGACCTGTGGGGCCCAGGG - Intronic
1124270027 15:28271806-28271828 GAGCAGGCGTGCGGGGCCCTGGG - Intronic
1124366160 15:29072810-29072832 CAGCAGGACTGGGGGAGGCAGGG + Intronic
1124434485 15:29635610-29635632 CAGCACACCTAGGGGGTCCACGG + Intergenic
1124618004 15:31256500-31256522 CAGCTGCCCTGGGGAGCCCGGGG + Intergenic
1125501190 15:40241168-40241190 CAGCAGGGGTGGGGAGACCAAGG - Intronic
1125501248 15:40241411-40241433 CACCAGGCCTGGGGGCCACACGG - Intronic
1125512183 15:40298072-40298094 CAGCAGGGATTGGGGGCCAATGG - Intronic
1125554029 15:40569541-40569563 CAGCCGGCTTCGGGGGCCCGGGG - Exonic
1125739788 15:41954224-41954246 CAGCAGGCACAGGGTGCCCAGGG - Intronic
1126169919 15:45686640-45686662 TTGCAGGCCTTGTGGGCCCACGG - Intronic
1128578174 15:68790298-68790320 GAGCAGTGCTGGGGAGCCCAGGG + Intronic
1128648912 15:69396506-69396528 CTGCAGCCCTGTGGGCCCCAAGG + Intronic
1129231656 15:74200396-74200418 CAGCAAGCATGGGAGGCCCCAGG + Intronic
1129298097 15:74610790-74610812 TACCAGGCCTGGGGGACCCTTGG - Intronic
1129385385 15:75193359-75193381 CAGGAGCCCTGGGGAGCCAATGG - Intergenic
1129455510 15:75674456-75674478 CAGGAGGTCTGGGAGGCCCCAGG + Exonic
1129740144 15:77986107-77986129 CAGCCGGCCTGGCTGGGCCAAGG - Intronic
1130990585 15:88873490-88873512 AAGGAGGCCTGGGGGACGCAAGG - Intronic
1131179234 15:90228767-90228789 CAGCAGGCCAGCTGGCCCCAAGG - Exonic
1131262144 15:90893032-90893054 CATCATCCCTGGGGGGCCCTGGG + Intronic
1131515564 15:93074048-93074070 CAGCAGAACTGCAGGGCCCAGGG - Exonic
1132464554 16:71713-71735 AAGCAGGCCCTGGGGGGCCAGGG + Intronic
1132502044 16:288761-288783 CTGCAGGGCTGAGTGGCCCAGGG + Intronic
1132546066 16:534066-534088 CAGCAGGGTTGGAGTGCCCACGG + Intronic
1132717937 16:1301383-1301405 CCGCAGGTCTGGGTGGCCGAGGG - Intergenic
1132743426 16:1427202-1427224 CAGCATGCCTGCTGTGCCCACGG - Intergenic
1132796216 16:1724463-1724485 CCGCAGGCTTTGAGGGCCCAGGG - Intronic
1132872767 16:2123087-2123109 AACCAGGCCTGGGGGTGCCATGG + Intronic
1132897069 16:2234112-2234134 CAGGCGGCCTGGCGGGCCCGCGG + Intronic
1133115766 16:3577177-3577199 CAGCAAGACTGGGGGGCCTGGGG + Exonic
1133226460 16:4343120-4343142 CGCCAGGCCTGAGGTGCCCATGG + Intronic
1133230926 16:4366178-4366200 CAGCAGGCCTGGGGTGTGCAGGG - Intronic
1133593831 16:7271903-7271925 CAGCAGGACTGGGGCACTCATGG - Intronic
1134551854 16:15142266-15142288 AACCAGGCCTGGGGGTGCCATGG + Intergenic
1134629233 16:15745081-15745103 AAGCAGGGCTGGGGGCCCCTGGG + Intronic
1135496211 16:22953741-22953763 CAGCGGACCAGGTGGGCCCAGGG - Intergenic
1135947445 16:26877441-26877463 CAGCAGGCCTAGGTGGCCAGTGG - Intergenic
1136111658 16:28067298-28067320 AAGCAGACCTGTGGGGCACAGGG + Intergenic
1136114692 16:28087353-28087375 GGGCAGGCCTGGGTGTCCCAGGG - Intergenic
1136671887 16:31865895-31865917 CAGCAGGCCTGAAGCCCCCAGGG - Intergenic
1136705021 16:32180176-32180198 GAGCAGGCATGTGGGGCCCTGGG - Intergenic
1136762890 16:32749229-32749251 GAGCAGGCATGTGGGGCCCTGGG + Intergenic
1136805210 16:33121157-33121179 GAGCAGGCATGTGGGGCCCTGGG - Intergenic
1137564864 16:49526604-49526626 CAGGAGGACAGAGGGGCCCAGGG + Intronic
1137694816 16:50454516-50454538 CAGCAGCCCTGGCGTGCCCACGG - Intergenic
1138121486 16:54403975-54403997 CTTCAGGCCTGGTGGGCACAGGG + Intergenic
1138383107 16:56617358-56617380 CAGCAGGCCGGCCGGGCGCAAGG - Intergenic
1138584804 16:57962789-57962811 CAGCAGGGCTGAGGGGCTGAGGG - Intronic
1139645176 16:68324228-68324250 CTGCAGCTCTGAGGGGCCCAAGG + Intronic
1140719819 16:77761447-77761469 CAGCAGGCCTGGAAGGCACCTGG + Intergenic
1141146346 16:81532916-81532938 CAGCAGGCTTGGCGTGTCCAAGG - Intronic
1141171982 16:81697302-81697324 CAGAAGGCCTGTGGGACCCCAGG - Intronic
1141172810 16:81701836-81701858 CAGCAGGCCAGGGGGGGCCAGGG + Intronic
1141512953 16:84524609-84524631 CAGCAGGGCAGCGGGGCTCAGGG - Intronic
1141593916 16:85086206-85086228 CAGCGGGCCTTGGTGGCCCAGGG - Intronic
1142031197 16:87839397-87839419 CAGAATGCCTGGGGAGTCCAGGG - Intronic
1142249323 16:88983892-88983914 CAGCCTCCCTGGGGGTCCCAGGG + Intergenic
1142251928 16:88995989-88996011 CCGCAGACCCGGGGAGCCCAGGG - Intergenic
1142276958 16:89123808-89123830 CAGCTGGCCTGCCAGGCCCAGGG + Intronic
1203065043 16_KI270728v1_random:1009549-1009571 GAGCAGGCATGTGGGGCCCTGGG + Intergenic
1143259138 17:5585068-5585090 AAGCAGGCCTCGGGGAGCCAGGG + Intronic
1143328649 17:6118374-6118396 CAGCAGGCATGGGGGGCAAGGGG - Intronic
1143404422 17:6667775-6667797 CAGGAAGCCTGGGGGGTCCCAGG + Intergenic
1143781470 17:9231735-9231757 CTGCAGGCCTGGTGGGCCTCTGG + Intronic
1143995334 17:11001771-11001793 CAGCAGGCCAGATTGGCCCACGG - Intergenic
1144626558 17:16846976-16846998 CAGCGGGCCTGGCGGGACCCTGG - Intergenic
1144637631 17:16920370-16920392 CAGCAGGTCTGTGGGGGGCAGGG + Intergenic
1144638864 17:16926811-16926833 CCCCTGGCCTGTGGGGCCCAGGG + Intergenic
1144872899 17:18381535-18381557 CGGCAGGGCTGGGGGTCCCTGGG + Intronic
1145014299 17:19386774-19386796 CCGGAGACCTGGGGGGCACACGG + Exonic
1145152360 17:20518649-20518671 CAGCGGGCCTGGCGGGACCCTGG - Intergenic
1145272607 17:21412779-21412801 CTGCAGAGCTTGGGGGCCCATGG + Intronic
1145310816 17:21700242-21700264 CTGCAGAGCTTGGGGGCCCATGG + Intronic
1145378942 17:22376587-22376609 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145379899 17:22381327-22381349 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145380379 17:22383702-22383724 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145380858 17:22386049-22386071 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145381337 17:22388424-22388446 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145382545 17:22394563-22394585 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145382825 17:22395926-22395948 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145383398 17:22398749-22398771 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145383912 17:22401217-22401239 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145384350 17:22403419-22403441 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145384669 17:22404881-22404903 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145385450 17:22408954-22408976 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145736188 17:27233407-27233429 CTGCAGGGCTGGGGGGCCTCAGG + Intergenic
1146009116 17:29180043-29180065 CAGCCAACCTGGGGGGCGCAGGG - Intronic
1146022517 17:29292601-29292623 CAGGAGGCCTGGGGGGGCGGCGG - Intronic
1146053425 17:29569088-29569110 TAGGAGCCCTGGAGGGCCCAGGG + Intronic
1146163705 17:30572852-30572874 CAGCGGGCCTGGTGGGACCCTGG - Intergenic
1146944881 17:36866813-36866835 GAGCAGCCCTGGGGGGACCTGGG + Intergenic
1147311182 17:39596923-39596945 CAGGAGGCCCGGGAGGCCCGCGG + Intergenic
1147339280 17:39744300-39744322 TGGCTGGCCTGGGGGGCCCAGGG - Intronic
1147580700 17:41625663-41625685 CAGCGGGCCTGGCGGGACCCTGG - Intergenic
1148441032 17:47711679-47711701 CAGGAGGCCAGGGGGTCCCCAGG + Exonic
1148794209 17:50189412-50189434 CAGCAGGGCCAGGGGGACCAGGG + Exonic
1148868351 17:50641033-50641055 CAACAGGCCTGGGGCCCCCAGGG + Intronic
1149655655 17:58308500-58308522 CAGCAGGCAGGGGCTGCCCAGGG + Intronic
1149682779 17:58517578-58517600 GATCAGGCCTGGGAGGCCCAGGG + Intronic
1149962687 17:61129510-61129532 CAGCAGGACTGGGAGACACATGG - Intronic
1150267842 17:63842510-63842532 CAGGAGGCGTGGGGGGCCCCGGG - Exonic
1150723558 17:67633790-67633812 CAGCAGCCCGGGGGGGCCCGAGG - Intronic
1151746730 17:76015524-76015546 CTGCAGGGCAGCGGGGCCCACGG + Exonic
1151748351 17:76023464-76023486 CGGCAGGGCTGGGGGTCCCTGGG - Intronic
1151815205 17:76468327-76468349 CAGCAGGGTTGGGGTGCCCCAGG + Intronic
1151967550 17:77439358-77439380 CTGCAGCCCTGGGGGCCCCAGGG + Intronic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1152206341 17:78976554-78976576 CAGCAGGCCTAGGGACCCCTGGG + Intronic
1152218634 17:79048847-79048869 CTGCAGGCCTGGGGGACCCAGGG - Exonic
1152636974 17:81434221-81434243 CAGCCAGCCTGGGAGGCCCTGGG - Intronic
1152718102 17:81909468-81909490 CAGGAGGGCTGGGGGGCCGCGGG + Intronic
1152741841 17:82021888-82021910 CAGCAGGCGTGGGGGGCGGGGGG - Intronic
1153027304 18:683429-683451 CAGCAGGGCTGCGGCTCCCAGGG + Intronic
1153482087 18:5556966-5556988 CAGCACAGCTGGGGGGCCCCGGG + Intronic
1154123328 18:11669412-11669434 CAGCAGGGCTGTGGAGCCTAAGG + Intergenic
1156508107 18:37611732-37611754 AATCAGGCCTGAGGAGCCCATGG - Intergenic
1157028823 18:43879870-43879892 CATCATGCCTTGGGGGACCAGGG + Intergenic
1157727984 18:49979363-49979385 CAGCAGGCCAGACAGGCCCAGGG + Intronic
1160463878 18:79059508-79059530 CAGAAGCCCTGGGGGGTCTAAGG - Intergenic
1160797510 19:952839-952861 CAGCAGCTGCGGGGGGCCCAGGG - Intronic
1160820043 19:1053685-1053707 GGGAAGGCCTGGGGGACCCATGG + Intronic
1160855130 19:1213842-1213864 GAGCAGGACTGGGAGGCACATGG - Intronic
1160896085 19:1402489-1402511 CAGCGGGCTTGGGGGCCCCCAGG - Intergenic
1161001663 19:1913977-1913999 CTGCAGGCCTGGCGGGCTCCTGG - Intronic
1161055817 19:2190207-2190229 CAGCAGGACCGGGGTGCCCAAGG - Intronic
1161313381 19:3607011-3607033 CCGGTGGCCTGGGGGTCCCAAGG - Intergenic
1161726731 19:5933638-5933660 CAGCAGGCCTGGAAGGCGCCTGG + Intronic
1162015571 19:7844900-7844922 CAGGAGGACTGGGGTGGCCAGGG + Intronic
1162205766 19:9054930-9054952 CTGCAGGCCTGGGGCGCCTCAGG - Intergenic
1162966447 19:14158446-14158468 AAGCAGGCCCGGGTGGCCCTGGG - Exonic
1163008611 19:14411251-14411273 CAGGAGGCCTCAGGGGACCAAGG + Intronic
1163119818 19:15210660-15210682 CAGCAGGCCTTGTGCTCCCATGG + Intergenic
1163234431 19:16022585-16022607 GGGCAGGCCTGGGAGCCCCAAGG + Intergenic
1163393332 19:17043997-17044019 CAGGAGACCAGGGTGGCCCAGGG + Intergenic
1163455338 19:17403175-17403197 GAGCAGGTCTGGAGGGGCCATGG - Exonic
1163472451 19:17505454-17505476 CAGTTGGCCTGGGGGACCCCCGG - Exonic
1163475120 19:17521317-17521339 CAGCAGGCCTGGGGGCGCCCTGG + Intergenic
1164072460 19:21780692-21780714 CAGCAGGGCTGGGAGCTCCATGG + Intergenic
1164555147 19:29245678-29245700 CAGCAGGCCTGGGAGGCAGATGG + Intergenic
1165069899 19:33249115-33249137 CAGCAGGCGGGGGGCGCCCAAGG + Intergenic
1165257651 19:34589400-34589422 CAGGAGTCCTGGGAGGCCCCTGG + Intergenic
1165423619 19:35733822-35733844 CAGCAGGTCTGGGGGACCATCGG - Exonic
1165460228 19:35939933-35939955 CAGCTGCCCTGGGAGGCCCTGGG + Exonic
1165707612 19:37987662-37987684 CAGCTGGCCTAGGGGGTCCCAGG - Intronic
1165792202 19:38499360-38499382 CAGCAGGCCTGGGGCTGGCAGGG + Intronic
1166364810 19:42273003-42273025 GAGCAGGGCTGGGGTACCCAGGG - Intronic
1166741328 19:45116523-45116545 CAGCAGGCCTGAGGAGGGCACGG + Intronic
1166808334 19:45499987-45500009 CAGAAGGCCTAGGGGCCCCAGGG - Exonic
1167019220 19:46861431-46861453 CAGCAGGGCTGGGGCGGGCAGGG - Intergenic
1167166413 19:47802769-47802791 CACCAGGCCTGGGGTGGCCCTGG - Exonic
1167435103 19:49474612-49474634 CAGGAGGCATGAGGGGCCCCCGG + Exonic
1167503500 19:49859971-49859993 CAGCCGGCCTGGCAGGCACAGGG - Exonic
1167520468 19:49951674-49951696 GGACAGGCCTGGGGGGCCCTTGG + Intronic
1168156219 19:54474196-54474218 CTGCAGGCGTGGGGGGACCGCGG + Intergenic
1168273399 19:55262559-55262581 CAAGAGGCCTGGGGTTCCCACGG + Exonic
1168316413 19:55486607-55486629 CGGGTGGCCTGGGGGGCCCCTGG + Exonic
925380147 2:3419038-3419060 GAGCAGGCATGGGGGGCACAGGG - Intronic
925969284 2:9095765-9095787 AAGCAGGCCTGGGCGGCCGCAGG - Intergenic
926346740 2:11953960-11953982 CAGCATGGCTGGGGAGCCCTCGG + Intergenic
926712385 2:15891666-15891688 CCCCAGGCCTGCGGGTCCCAGGG - Intergenic
927485895 2:23488226-23488248 CAAAAGGCCAGGGGCGCCCAGGG - Intronic
927487217 2:23496664-23496686 GAGCTGCCCTAGGGGGCCCAGGG + Intronic
927520651 2:23696159-23696181 GACCAGGCATGGGGGTCCCAAGG + Intronic
927644774 2:24870660-24870682 CAGGAGCCCTGGGGCACCCAGGG + Intronic
927671565 2:25072792-25072814 CAGCAGTCCTGTGGGCCCCAAGG - Intronic
927956841 2:27212639-27212661 CGGCAGGACTGGGGCGCCGAAGG - Intronic
928283178 2:29966438-29966460 CAGCAGGACTGGGCAGGCCAGGG - Intergenic
928683774 2:33727881-33727903 CAGCAGGCGGAGGAGGCCCAGGG + Intergenic
929138014 2:38643257-38643279 CAGCACTGCTGGGGGACCCAGGG + Intergenic
929533752 2:42767843-42767865 CAGCTGGCAAGTGGGGCCCAGGG - Exonic
930024171 2:47020375-47020397 CAGCCGGCCAGGTGGACCCAAGG - Intronic
930028443 2:47044001-47044023 CAGCAGGGCTGGCCTGCCCAGGG + Intronic
931752815 2:65346152-65346174 GAGCAGGGCTGTGGGGCACAGGG - Intronic
932145214 2:69310156-69310178 CTGCAGGCTTGGGAGGCCCAAGG - Intergenic
932494567 2:72140034-72140056 CAGCCAGCATGGGGGGCCCAGGG + Intronic
933760454 2:85668554-85668576 GAGGGGGCCTGGGAGGCCCAGGG - Intronic
933939694 2:87234976-87234998 CAGCAGCCCCGGGGGTCTCAAGG + Intergenic
934225070 2:90125160-90125182 CTGCAGGGGTGGGGTGCCCATGG - Intergenic
934569132 2:95357550-95357572 CATAAGGCCTGTGGGGACCAGGG - Intronic
935112389 2:100105035-100105057 CAGCAGCCCTGGGGTGCCCGGGG + Intronic
936086999 2:109476212-109476234 TAGCAGGCCTGGTGGGGGCAGGG - Intronic
936285601 2:111178881-111178903 CAGCAGGCCAGGGCAGCCCTGGG + Intergenic
936353443 2:111730797-111730819 CAGCAGCCCCGGGGGTCTCAAGG - Intergenic
936387253 2:112041368-112041390 CAGCAGGACTGAGGGGGCCTGGG - Intergenic
936529118 2:113263009-113263031 CAGCAGGCTTGGGCAGCCCCTGG + Intronic
937126526 2:119478353-119478375 CAGGAGGCCAGGGGCTCCCAGGG + Intronic
937145317 2:119639234-119639256 CAGCAGGCAGCGGGGACCCACGG - Intronic
937262853 2:120597478-120597500 CCACAGGCCTGGGGCTCCCAGGG + Intergenic
938097515 2:128473304-128473326 AAGGAGGACTGGGAGGCCCAGGG - Intergenic
938245241 2:129771681-129771703 CTCCATGCCTGGGGAGCCCAGGG + Intergenic
938376974 2:130814352-130814374 CACCTGGCCTGCGGGGCCCAGGG + Intergenic
938554503 2:132412194-132412216 CAGCAGGCCTGGGTGATCCCAGG + Intergenic
938701624 2:133885043-133885065 CAGCAGCCATGGGGGTCCCTAGG + Intergenic
938707473 2:133945010-133945032 CAACAGGCCTGAGAGGGCCATGG - Intergenic
939617861 2:144380551-144380573 CAGGAGGCCTCGGGCTCCCACGG + Intergenic
940639096 2:156329479-156329501 CTGCAGGCCCGGGAAGCCCATGG + Exonic
941673933 2:168324100-168324122 CAGCAGGTCTGAAGGGACCAGGG + Intergenic
943427032 2:187750119-187750141 AAGGAGGCCTGGGGGGCTGAGGG - Intergenic
945990480 2:216391936-216391958 CAGCAGCCCTGGGAGGCCTTGGG + Intergenic
946404402 2:219484739-219484761 CACCCGGCCTGGGAGGCCCGCGG + Exonic
947636227 2:231681812-231681834 GATCAGGCCTGGGGTGCCCGCGG - Intergenic
947740210 2:232481465-232481487 CACCAGGCCTGAGGGGCACAAGG + Intronic
948055202 2:235005581-235005603 CAGCAGCTCTGAGGGGCTCAAGG - Intronic
948268456 2:236656316-236656338 CAGAGGGTCTGAGGGGCCCAGGG - Intergenic
948309224 2:236972534-236972556 CAGCAGCCCTGGAGGGTGCAAGG + Intergenic
948385559 2:237578529-237578551 CGGTAGGCCGGGGGTGCCCAGGG - Intronic
948496414 2:238352565-238352587 CAGGAGGCCTGGGCAGCACAGGG + Intronic
948575983 2:238950015-238950037 CAGTGGGCATGTGGGGCCCACGG - Intergenic
948613009 2:239181387-239181409 CAGGAGGCCTGGGTGGGCCGAGG + Intronic
948953064 2:241267454-241267476 CCGCAGGGGTGGGGGGACCATGG + Intronic
949059489 2:241948883-241948905 GAGCAGGGCTGCGGGGCACAGGG + Intergenic
1169144085 20:3241062-3241084 CAGCAGGCGTGTGGGCCTCAGGG - Intergenic
1171444895 20:25196116-25196138 CAGCAGGGCTGGGGCCCCCTGGG - Intronic
1171449779 20:25227170-25227192 CTGCAGCCCTGGGAGGCCCTAGG - Intergenic
1171457567 20:25280660-25280682 CAGCAGCCCTGTGGGTCCCTGGG + Intronic
1172091591 20:32436651-32436673 CCGCAGGCCTGGGGCGCTGAAGG - Exonic
1172573280 20:35986939-35986961 CAACAGGCCAGGGGGACACAAGG + Intronic
1172626452 20:36350212-36350234 CCGAAGGGCTGGGGGGCCTAAGG - Intronic
1172640100 20:36435726-36435748 CACCAGGCCTGAGGGACGCAAGG - Intronic
1172699236 20:36842871-36842893 AAGCAGGGGTGGGGGGTCCAAGG + Intronic
1173606760 20:44337177-44337199 GAGCAGGCCTGCCAGGCCCACGG - Exonic
1173949571 20:46979349-46979371 CAGCAGGCCAAGGGGGCCAGAGG + Intronic
1174105700 20:48160978-48161000 CAGGAGGCCTGGGAGGAGCATGG - Intergenic
1174135310 20:48375039-48375061 CAGCCGTCCTGGGAGCCCCACGG + Intergenic
1174553628 20:51378817-51378839 CACCAGCTCTGGGTGGCCCAGGG + Intergenic
1175092251 20:56513947-56513969 CAGCAGGCCTGGGTGGGCCTGGG + Intronic
1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG + Intergenic
1175240204 20:57541887-57541909 CAGAAGGCCTGGGGGTCACCTGG + Intergenic
1175609455 20:60338478-60338500 CATAAGGCCTGGGGGGCCGCAGG + Intergenic
1175717975 20:61268169-61268191 GAGCGGGCCTGGCTGGCCCAGGG + Intronic
1175818611 20:61896503-61896525 CAGCAGGGCAGGGGGGCTCTAGG + Intronic
1176068069 20:63210323-63210345 CAGGAAGCCTGGGGGGCCAGCGG + Intronic
1176255639 20:64151315-64151337 GAGGAGGCCTGGGGGGCTCCTGG + Intergenic
1176304456 21:5115911-5115933 GAGAGGGCGTGGGGGGCCCATGG - Intergenic
1178597029 21:33963407-33963429 CAGCATGCCTGGTGTGTCCAAGG - Intergenic
1179577953 21:42319519-42319541 CAGCACCCGTGGGTGGCCCAGGG + Intergenic
1179580240 21:42338827-42338849 CTCCACGCCTGGGGGCCCCAAGG + Intergenic
1179646526 21:42779427-42779449 CAGCAGGGCAGGGAGTCCCAGGG - Intergenic
1179852600 21:44146119-44146141 GAGAGGGCGTGGGGGGCCCATGG + Intergenic
1179942342 21:44648328-44648350 CAGGAGGCTGGGAGGGCCCAGGG + Intronic
1180040645 21:45277614-45277636 CAGCAGGCCTGCTGTGTCCACGG + Intronic
1180078010 21:45472971-45472993 CAGCCGGCATGGGGAGCCCCAGG + Intronic
1180085267 21:45505386-45505408 CAGGGGGCCCAGGGGGCCCAGGG - Exonic
1180090336 21:45530997-45531019 CAGCGGCCCTGGGGGGCCACGGG + Intronic
1180177442 21:46097704-46097726 CAGCTGCCCTGGGGGGTGCAGGG - Intergenic
1180185757 21:46138476-46138498 CAGGAGGCCTGGGGTCCCCCGGG + Intronic
1180612289 22:17105780-17105802 GAGCAGGGCTGGGGGCCTCAGGG + Intronic
1180998128 22:19975582-19975604 AAGCAGGCCTGGAGGGCCTCAGG - Intronic
1181432150 22:22888148-22888170 CAGCAGGCCATGGGCGACCATGG - Exonic
1181490345 22:23257461-23257483 CAGGCGGCCTGTAGGGCCCAGGG - Intronic
1181630637 22:24149383-24149405 GGGCAGGCCCTGGGGGCCCATGG - Intronic
1181818900 22:25460403-25460425 CGGGAGGCCCGGGAGGCCCAGGG - Intergenic
1182149086 22:28016130-28016152 CAGCAGGACTTGGAGGGCCAGGG + Intronic
1182424799 22:30266350-30266372 AGCCAGGCCTGGGGGCCCCAGGG - Intronic
1183084925 22:35480902-35480924 CAGCAGGCAGGGGTGGGCCAGGG - Intergenic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
1183585523 22:38750955-38750977 CAGCGGGCTTGTGGGGCGCAAGG - Exonic
1183875387 22:40775865-40775887 CAGCATGGCTGGGGGGCCTCAGG - Intronic
1184467725 22:44678684-44678706 CCGCAGGCCAGGCGGACCCACGG + Intronic
1184518863 22:44980455-44980477 CTGCAGACCTTGGAGGCCCAGGG + Intronic
1184550920 22:45203748-45203770 AAGCAGGCTGGGGGGCCCCATGG + Intronic
1184607511 22:45582524-45582546 AGGCAGGTCTGGGGGTCCCAGGG - Intronic
1184614924 22:45631516-45631538 CACCAGGCCCAGGGTGCCCAGGG + Intergenic
1184782475 22:46656094-46656116 CAGCTGCCCTGGGGGGCTCTCGG + Intronic
1184890020 22:47373844-47373866 GGGCAGGACTGTGGGGCCCAGGG - Intergenic
1185066840 22:48636703-48636725 CAGCAGCCCTGGGGGCTCCTGGG - Intronic
1185234038 22:49700740-49700762 CAGCATGGCTGGGGAGCCCTCGG - Intergenic
1185296813 22:50058616-50058638 TGGCGGGCCTGGGGGGCCCGAGG - Intergenic
1185394402 22:50579338-50579360 CAGGAGGCCTGGGGAGTCCCGGG - Intronic
950157205 3:10730679-10730701 GAGCAGGGCTGGGGGTCACAAGG - Intergenic
950449719 3:13058869-13058891 CGGCAGGCCTTGGGTGCCCTCGG + Intronic
950533600 3:13567109-13567131 CTGGGGGCCTGGGGGGCCAAGGG + Intronic
951291996 3:20882596-20882618 CAGCATGCCTGGGAGGCCTCAGG + Intergenic
951492726 3:23290802-23290824 CAGCAGTTCTGGGGAGGCCAAGG + Intronic
953793511 3:45966213-45966235 GGGCAGGCCTGGTGGGTCCATGG - Intronic
953905774 3:46867644-46867666 CGGCAGGCCAGGGCGGGCCATGG - Intronic
953912472 3:46899896-46899918 CAGCAGGCCTGCGGGGTCCATGG + Intronic
954134297 3:48575072-48575094 CAGGGGGTCCGGGGGGCCCAGGG + Exonic
954220993 3:49153897-49153919 CAGCAGGCATGGGGGTGCCCAGG + Intergenic
954224225 3:49172202-49172224 CAGCAGGCGTGGGGACCCCCAGG + Intronic
954412390 3:50376487-50376509 CAGCAGACCTGTGGGGCCGGTGG - Intronic
954665543 3:52249517-52249539 CAGCAAGTCTGGGAGGGCCACGG - Intronic
954693161 3:52406588-52406610 CAGCAGACCTGGGCTGCCTAAGG + Intronic
955412083 3:58662168-58662190 CAGCAGGCCTGCAGGGGCCAGGG - Intronic
956193494 3:66629760-66629782 CAGCAGGCCAGGGGAGAGCAAGG + Intergenic
956468531 3:69542168-69542190 CAGCACGCTTGGGGAGCCCGGGG + Intronic
960517996 3:118623469-118623491 CTGCAGGCTTTGGGGGACCAGGG - Intergenic
961020897 3:123505993-123506015 GAGCTGGCCTGGGGCGGCCAGGG + Intronic
961244561 3:125440350-125440372 CAGCAGGTCTGAGGGCCCCTAGG + Intergenic
961348069 3:126277764-126277786 CATCTGGCCTGGGGAGCTCAGGG - Intergenic
961358992 3:126356034-126356056 CAGCAGGCCTGGCCGGGCCAGGG - Intronic
961506638 3:127374732-127374754 CAGCAGGTCCTGGGGGCCCTGGG - Intergenic
961650243 3:128413519-128413541 CTGCTGGCCTGGGTGGGCCAGGG - Intergenic
961784838 3:129341483-129341505 CAGCAGCCCACAGGGGCCCAGGG + Intergenic
963073914 3:141328936-141328958 GAGGAGGCCTGGAGGGCTCAGGG - Intronic
963811537 3:149781637-149781659 CTGCAGGACTGGGGGGGCCCTGG - Intronic
965083305 3:164063801-164063823 CAGCATGGCTGGGAGGCCCCAGG - Intergenic
966881876 3:184355109-184355131 TGGGAGGCCTGGGGGTCCCAGGG - Intronic
967037136 3:185656251-185656273 CAGCAGGACTGCTGGGCACAAGG + Intronic
968084979 3:195870166-195870188 CAGGAGGTCGGGGGGGTCCATGG + Exonic
968382775 4:109739-109761 CAGAAGTCCAGGGGTGCCCAAGG + Intergenic
968461112 4:725520-725542 CAGCAGCCCTCGGCAGCCCACGG - Intronic
968563686 4:1298142-1298164 GGGCAGGCATGGGGGGCTCATGG - Intronic
968654506 4:1772746-1772768 GAGCAGGCTTGGGGGACCCAAGG - Intergenic
968904427 4:3444945-3444967 CAGCAGGGCCGCGGCGCCCACGG - Exonic
969375966 4:6763422-6763444 CAGCTGGCCTGGGAGGGGCAAGG - Intergenic
969613281 4:8238583-8238605 CGGCAGGCCTGGGGCTGCCAGGG + Intronic
969632822 4:8348278-8348300 GTGCAAGCCTGGGAGGCCCAGGG - Intergenic
969652777 4:8477765-8477787 CTGCAGGACTGGGGGGCCGAGGG - Intronic
969664789 4:8550998-8551020 CAGCTGGCCTGGGAGGCTGAGGG + Intergenic
973623696 4:52751191-52751213 AAGCAGCCCTCGGCGGCCCAGGG - Intronic
974697705 4:65397167-65397189 CAGCAGGACTGATGGGCCCTGGG + Intronic
977666299 4:99650172-99650194 TAGCAGGCCTGGGGCTTCCAGGG - Exonic
977693807 4:99946335-99946357 CTGGAGGCCTGCGGGGCCCCCGG - Intronic
978809093 4:112830971-112830993 CAGCAGTGCTGGGGGACCCGGGG - Intronic
983997557 4:174204287-174204309 CAGCAGGCCTGGGAGGATGAAGG - Intergenic
985353826 4:189096269-189096291 CAGCCGGCCAGTGGAGCCCACGG - Intergenic
985540662 5:485978-486000 CCGCAGGGCTGCGGGGCACACGG + Intronic
985602012 5:840384-840406 CCCCAGGCGTGGGGGGCTCAGGG + Intronic
985693201 5:1325009-1325031 CATCAGGCTTGTGGGACCCAGGG - Intronic
986284188 5:6347850-6347872 GTGAGGGCCTGGGGGGCCCAGGG + Intergenic
987153730 5:15066926-15066948 CCGCAGGGCTGGGGGGCCTCAGG + Intergenic
988019790 5:25608156-25608178 CAGCAGGACTGAGGGGTCCTGGG - Intergenic
988983051 5:36590649-36590671 CAGCAGGGATGTGGGGTCCAGGG + Intergenic
990003986 5:50923710-50923732 CACGAGGCCTGGGGACCCCATGG - Intergenic
992003589 5:72457636-72457658 CTGCAGTTCTGGTGGGCCCATGG + Intronic
995743743 5:115381992-115382014 CCAAAGGCCTGGGGTGCCCAGGG + Intergenic
997337525 5:133118705-133118727 CAGGAGCACTGGGGGGCCCTGGG + Intergenic
997475576 5:134140542-134140564 AAGCAGGCTGGAGGGGCCCAGGG + Intronic
997601607 5:135142362-135142384 CAGCAGCCCCGCTGGGCCCATGG + Intronic
999148594 5:149412181-149412203 GAGCAGGGGTGGGGGGCCAAAGG - Intergenic
999424518 5:151475684-151475706 CTGCAGGCCTGGTGCTCCCAGGG - Intronic
999633564 5:153596990-153597012 CAGAATGCCTGGGGAGGCCACGG - Intronic
1001005532 5:168046606-168046628 TTGGAGGCCTGGGGTGCCCATGG + Intronic
1001382056 5:171311652-171311674 CAGCCCGCCTGGGGGGTCCGGGG - Exonic
1001838244 5:174850740-174850762 CAGCAAGCCTGGGGTTTCCATGG - Intergenic
1002049286 5:176560847-176560869 CAGCAGGTCTGTGGGGAGCATGG + Intronic
1002081619 5:176740853-176740875 CCACAGGCCTGGGGGGCCCCGGG + Intergenic
1002096675 5:176835281-176835303 AAGCAGGCCCTGGGGGCTCAGGG + Intronic
1002299157 5:178247775-178247797 CATCGGGCCTGGGGGGCCAGGGG + Exonic
1002538761 5:179892680-179892702 CAGGACCCCTGGGGGTCCCATGG + Intronic
1003427452 6:6007230-6007252 CGGCGGGGCTGGGGGGCCCCCGG - Intronic
1005661066 6:28000307-28000329 CTGCAGGCCTGAGGGGTTCAAGG - Intergenic
1006119344 6:31794954-31794976 CAGCAGGCCTGGGGGGCCCAGGG - Exonic
1006407430 6:33853324-33853346 GCCCTGGCCTGGGGGGCCCACGG + Intergenic
1006798576 6:36745602-36745624 CAGCAGGCCTGGGCTCCCCCAGG + Intronic
1006833454 6:36982885-36982907 AAGCAGGCCAGCTGGGCCCATGG + Intronic
1007177391 6:39906318-39906340 CTCCAGGCCTGGGTGGGCCATGG + Exonic
1007363304 6:41373440-41373462 CAGGAGGGCTGGGGATCCCAGGG - Intergenic
1007746183 6:44044155-44044177 CTGGAGGCCTGGAGGGGCCATGG - Intergenic
1007764561 6:44152900-44152922 CAGCTGGCATGTGGGCCCCAGGG + Intronic
1012211374 6:96522150-96522172 CAGCTGGGCTGGGGGGCTCCAGG - Intronic
1013170599 6:107634250-107634272 CAGCAGGCCTGGGGGGTTCCCGG - Exonic
1013170769 6:107634814-107634836 CAGCCGGGCTCGGTGGCCCACGG - Exonic
1013174938 6:107668943-107668965 CAGCAGGGCTGGGGCTTCCAGGG + Intergenic
1014109245 6:117602241-117602263 CAGCAGCCGGAGGGGGCCCAGGG - Exonic
1014141173 6:117944917-117944939 CAGCAGGCTTAGGGGGCAGAGGG + Intronic
1017719927 6:157236762-157236784 CCGCGGGCCTGGCGGGCCCCGGG - Intergenic
1017856393 6:158353132-158353154 CAGGAGGCCTGGGAGGTCGATGG - Intronic
1018691354 6:166346568-166346590 CAGCAGGACTGAGGGTACCAGGG - Intergenic
1018940755 6:168307851-168307873 CCACGGGCCTGGGGGGCCCCAGG + Exonic
1019143576 6:169962858-169962880 CAGCAGGCTGGGGGCGCCCGGGG - Intergenic
1019509948 7:1412781-1412803 GCGCAGGCCTGTGCGGCCCACGG - Intergenic
1019532763 7:1511826-1511848 GAGCTGGCCTGAGGGGCCCTGGG - Intergenic
1019571284 7:1713663-1713685 CAGCAGGGCCTGGGAGCCCATGG + Intronic
1019597602 7:1865381-1865403 CAGCAGGGCTGGGATGCCCCGGG - Intronic
1022350959 7:29565884-29565906 CAGCGTGCCCGGGGGACCCAAGG - Intronic
1022795310 7:33727222-33727244 CAGCAGGCCTGGGGTGAGCCCGG - Intronic
1023563307 7:41497925-41497947 GAGCAGGCCTGGATGGACCAAGG + Intergenic
1023861817 7:44221276-44221298 GGCCAGGCCTGGTGGGCCCAGGG - Intronic
1024241689 7:47440620-47440642 CACCAGCCCTGTGGGCCCCAGGG + Intronic
1024472236 7:49775715-49775737 AAGCAGGCCTGGGTCTCCCAGGG + Exonic
1024632611 7:51262138-51262160 CAGCAGCCCTGGCTGGCTCAGGG + Intronic
1025261927 7:57425643-57425665 CAGCAGGACGGGGGGGCCTCTGG + Intergenic
1025262042 7:57426128-57426150 CCCCAGACCTGGGGGGTCCAAGG + Intergenic
1025603827 7:63024543-63024565 AAGGAGGCCTGGGAGGCCGAAGG - Intergenic
1029436886 7:100568590-100568612 CAGCAGGCAGGTGGGACCCAGGG - Intergenic
1029441538 7:100589656-100589678 CAGCAGGAACGGGGGGGCCAAGG + Exonic
1029458846 7:100684220-100684242 CAGCAGGTATGGGGGGCCTGGGG - Exonic
1032090999 7:128911508-128911530 CAGCAGGCAGAGGGGGCCAAAGG + Intergenic
1032322995 7:130901347-130901369 CCGCAGGCCTGCGGGGAGCAGGG - Intergenic
1032423536 7:131802242-131802264 CAGCAGCCCTGGGGGGCTGGTGG - Intergenic
1032785535 7:135196881-135196903 CAGGAGGGCTGGTGGGCCTAGGG - Intronic
1033152321 7:138926023-138926045 GGGCTGGCCTGGGAGGCCCAAGG + Intronic
1033422539 7:141216734-141216756 CACCAGGCCTGGGTGGACTAAGG - Intronic
1033648538 7:143322943-143322965 CAGGCGCCCTGAGGGGCCCAGGG - Intronic
1034239100 7:149596108-149596130 CAACCGGCCTTGGGGGCTCAGGG - Intergenic
1034466608 7:151233438-151233460 CGGCAGGCCCGGTGGGCACAAGG - Exonic
1034496692 7:151427474-151427496 GGGCAGTCCTGGGGGTCCCAGGG + Intergenic
1034496937 7:151428653-151428675 CAGCAGGGCAGGGGGACCTAGGG + Intergenic
1034939003 7:155218453-155218475 CCCCAGGCCTGGCAGGCCCAGGG - Intergenic
1035203788 7:157281891-157281913 CCACAGGGCTGGGTGGCCCAGGG + Intergenic
1035252755 7:157607865-157607887 CAGCAGGGCTCAGGTGCCCATGG - Intronic
1036752957 8:11454874-11454896 CAGCAGCTCTGTGGGGCCCAGGG - Intronic
1036781369 8:11650177-11650199 AAGGAGGCCTGGGAGGCCGAGGG + Intergenic
1037824712 8:22154491-22154513 CCCCAGGCCTGGGAGGCCGAGGG - Intronic
1037993701 8:23338412-23338434 CAGCGGGGTGGGGGGGCCCAAGG + Intronic
1038312496 8:26455361-26455383 CAGCAGGCCTGCGGGGAGTATGG - Intronic
1038337681 8:26658781-26658803 TGATAGGCCTGGGGGGCCCAAGG - Intergenic
1039840528 8:41289956-41289978 CAGCTGGCCTGGGCTTCCCAGGG - Intronic
1040404387 8:47086069-47086091 CAGCTGGGGTGGGGGGGCCAGGG + Intergenic
1041084897 8:54247704-54247726 CTCCAGGCCTAGGGGTCCCATGG - Intergenic
1041260006 8:56013111-56013133 CAGCAGCCCTGGCTGTCCCAAGG + Intergenic
1044718257 8:95121240-95121262 CACCAGGCCTGGTGGGCACCAGG - Intergenic
1044754103 8:95444070-95444092 CCGCAGGCCTGCGGTCCCCAGGG - Intergenic
1045397631 8:101776627-101776649 CAGCAGGCAACAGGGGCCCAAGG + Intronic
1046578975 8:116068193-116068215 CAGCAGGCATATGGGGTCCAGGG - Intergenic
1047203179 8:122782749-122782771 CAGCAGGGCCGGGGGTCCCGCGG - Intronic
1047215391 8:122872029-122872051 CAGCAGGACTGCAGGGGCCAGGG - Intronic
1048192496 8:132302534-132302556 CAGCAGGCCTGTGTTGCCCTTGG - Intronic
1048445411 8:134489370-134489392 GAGCAGGCCTGGGGAGCACTGGG - Intronic
1048984802 8:139729722-139729744 CAGGAGGCCTGCGGGGCTGAGGG - Intergenic
1049023636 8:139974021-139974043 CGGCAGGGATGGGGGGACCATGG - Intronic
1049444422 8:142623492-142623514 GGGCAGGCCGGGGGAGCCCAGGG + Intergenic
1049446039 8:142632130-142632152 CAGCTCCCCAGGGGGGCCCAGGG + Intergenic
1049526347 8:143128582-143128604 CAGCAGGCAAGGGGGACCCTGGG + Intergenic
1049674960 8:143885254-143885276 CAGCAGGCCTGGGGGACGGAGGG + Intergenic
1049756691 8:144314005-144314027 CGGGAGGCCTGGGGGGCTCCTGG - Exonic
1049785590 8:144449222-144449244 CAGTAGCCCTGGGAGTCCCAGGG + Intergenic
1049814416 8:144591523-144591545 CCGCATGGCTGGGGCGCCCAGGG - Intronic
1051219462 9:14832930-14832952 CAGCAGGCCTATGGGGTCCTGGG - Intronic
1051427708 9:16950439-16950461 CAGCATGCCTGGGGAGAGCATGG + Intergenic
1057211955 9:93205366-93205388 CTCCAGACCTGGGGGGTCCAGGG - Intronic
1057295050 9:93829941-93829963 CAGCAGGGCCCGGGGGCCCGGGG - Intergenic
1057814855 9:98286904-98286926 CAGCAGGCTGGGGAGGCCCGAGG - Intergenic
1057870422 9:98712540-98712562 GAGCAGCCCTGGGTGGCACAGGG - Intergenic
1058795709 9:108496421-108496443 CATCAGGCCAGGGAGACCCAGGG - Intergenic
1059259950 9:112966086-112966108 CTACAAGCCTGGGGGCCCCAAGG + Intergenic
1060816967 9:126640168-126640190 CAGCAGGCATCTGGGACCCAGGG - Intronic
1060881599 9:127121927-127121949 CAGAAGGCAGGGGTGGCCCAAGG - Intronic
1061201777 9:129142207-129142229 TAGCAGGCCTTGAGGGCCAAAGG + Intronic
1061250749 9:129424928-129424950 CCTCAGGCCTGGGGGCCTCATGG + Intergenic
1061306197 9:129734627-129734649 CTGCAGGCGTGGGGGGCCACAGG + Intergenic
1061405989 9:130393367-130393389 CAGAAGGGCAGGGGGGCCAAGGG - Intronic
1061406050 9:130393627-130393649 CACCTGGCCTTGGGGGACCAGGG + Intronic
1061424918 9:130492824-130492846 CTGCAGGTCTGGGGGGTGCAGGG + Intronic
1061516119 9:131091481-131091503 CAGCAGCCCTGCAGGCCCCAGGG - Intronic
1061866777 9:133495351-133495373 CACCAGCCCTGGGGGCCCCTGGG - Intergenic
1061876607 9:133547223-133547245 CCGCAGGCCTTGGGGGCCCCAGG + Intronic
1062181834 9:135195136-135195158 CTGCAGGTCTGGGGGGTACATGG - Intergenic
1062268909 9:135699899-135699921 GCCCAGGCCTGGGGGACCCAGGG + Intergenic
1062382046 9:136291210-136291232 CAGAGGGCCTGGGGGGCCCAAGG - Exonic
1062386003 9:136311816-136311838 CAGCAGGGCTGGGGGGCCGGGGG - Intergenic
1062393085 9:136341719-136341741 TAGCAGGCCTGGGGGGCACCAGG - Intronic
1062402449 9:136378500-136378522 CAGCAGCCCTGCGGGGCCAGGGG + Exonic
1062536595 9:137023779-137023801 CAGCAGCTGCGGGGGGCCCATGG - Intronic
1185892750 X:3835415-3835437 CAGCAGGCGTGGCGGGCACGGGG + Intronic
1185897858 X:3873835-3873857 CAGCAGGCGTGGCGGGCACGGGG + Intergenic
1185902977 X:3912266-3912288 CAGCAGGCGTGGCGGGCACGGGG + Intergenic
1189355008 X:40303975-40303997 AAGCATGCCTGGGAGGCCCCAGG - Intergenic
1191184308 X:57592812-57592834 CAGCGGTCCGCGGGGGCCCAGGG - Exonic
1191213083 X:57909647-57909669 CAGCAGTCCGCGGGGGCCCAGGG + Exonic
1192504067 X:71670302-71670324 CAGCAGCCCCCGGGAGCCCAGGG + Intergenic
1192509911 X:71715585-71715607 CAGCAGCCCCCGGGAGCCCAGGG - Exonic
1192516786 X:71765968-71765990 CAGCAGCCCCCGGGAGCCCAGGG + Exonic
1192529043 X:71870692-71870714 CAGCAGCCCCTGGGAGCCCAGGG - Intergenic
1195327747 X:103771678-103771700 AAGCATGACTGGGGTGCCCAGGG + Intergenic
1195492678 X:105490231-105490253 AAGGAGGCCTGGGGGGCCTAAGG + Intronic
1196442153 X:115727704-115727726 CAGCAGGCCTGGGAAGGCCCCGG + Intergenic
1196442813 X:115730658-115730680 CAGCAGGCCTGGGAAGGCCCCGG + Intergenic
1196443409 X:115733210-115733232 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196444113 X:115736727-115736749 CAGCAGGCCTGGGAAGGCCCCGG + Intergenic
1196445733 X:115845130-115845152 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196446404 X:115848111-115848133 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196447075 X:115851092-115851114 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196447744 X:115854075-115854097 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196449083 X:115860045-115860067 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196449754 X:115863036-115863058 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196450423 X:115866019-115866041 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196451093 X:115869004-115869026 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196451764 X:115871983-115872005 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196452435 X:115874970-115874992 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196453105 X:115877939-115877961 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196453775 X:115880932-115880954 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1196455519 X:115889003-115889025 CAGCAGGCCTGGGAAGGCCCCGG - Intergenic
1197579385 X:128262937-128262959 CAGCAGGGGTGGGGGTCACAAGG + Intergenic
1198427535 X:136535080-136535102 CAGCATGTCTTGAGGGCCCACGG + Intronic
1199615416 X:149651765-149651787 TATCAGTCCTGGGAGGCCCAAGG - Intergenic
1199628625 X:149761487-149761509 CATCAGTCCTGGGAGGCCCCAGG - Intergenic
1199772480 X:150983695-150983717 CATCTGGCCTCGGGGGCCCTGGG - Intronic
1199942302 X:152638201-152638223 CAGCATGCCTCGGATGCCCATGG - Exonic