ID: 1006120054

View in Genome Browser
Species Human (GRCh38)
Location 6:31798637-31798659
Sequence GGCTTAGGAATGCCCCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006120054 Original CRISPR GGCTTAGGAATGCCCCCTTT TGG (reversed) Intronic
900941073 1:5798875-5798897 GGCTTAGGGAGGCCCCCTAAGGG + Intergenic
904015581 1:27417781-27417803 AGCTTTGGAAAGACCCCTTTGGG + Intronic
911161441 1:94686192-94686214 GTGTTAGGAATGCCCCTTTCTGG + Intergenic
912865073 1:113249269-113249291 GACTTAGAAATGTTCCCTTTTGG + Intergenic
913690379 1:121274189-121274211 GGCTTAGGATATCCCCATTTAGG - Intronic
914147162 1:145005770-145005792 GGCTTAGGATATCCCCATTTAGG + Intronic
920044991 1:203127399-203127421 GACTTCAGAATGCCCCCTCTGGG - Exonic
920477698 1:206292677-206292699 GGCTTAGGATATCCCCATTTAGG - Intronic
921816257 1:219567528-219567550 GGATAAGGAGTGCCACCTTTTGG + Intergenic
1076120316 10:127931557-127931579 GGCATAGGAATGCCCACACTTGG - Intronic
1076638515 10:131899117-131899139 GACTTAGGAATGCCTGCTCTCGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1089848805 11:121479682-121479704 GGCTTAGGAAGGGCCACTTAAGG + Intronic
1100656317 12:96649535-96649557 GTCTTAGGAATGGCCTGTTTGGG + Intronic
1113429620 13:110238302-110238324 GGCTTGGGAATGTCCCTTTTTGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1121154485 14:91670293-91670315 GGCTTAGGCATCCACACTTTTGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1126788427 15:52198369-52198391 GGATTAGCAATGCCCCATGTGGG + Intronic
1127753762 15:62069639-62069661 GGCATAGCAGTGCCTCCTTTTGG - Exonic
1128861560 15:71078422-71078444 GGATTAGGAATGCCTGCATTAGG - Intergenic
1131997056 15:98143290-98143312 AGCTTAGGAATGCACCCCTGGGG + Intergenic
1134142712 16:11735575-11735597 AGATAAGGAATGCCACCTTTGGG - Intronic
1140040779 16:71406219-71406241 GGCTTAGGAATTCCTCCTGGTGG - Intergenic
1141081025 16:81052582-81052604 GGCTTAGGGACGCAGCCTTTGGG + Intergenic
1143100715 17:4503275-4503297 GGCTTAGGCAAGAGCCCTTTGGG + Intronic
1151057505 17:71050302-71050324 GGCTTTGGAATGCAACCTATGGG - Intergenic
1152292068 17:79445679-79445701 GGCTTTGGAATGCCCCATCTTGG - Intronic
1155502781 18:26503889-26503911 GGATTAGCAATGCCCTCCTTTGG + Intronic
1157423235 18:47563426-47563448 GGCATAGGATTGCCCTTTTTCGG + Intergenic
1165461205 19:35945250-35945272 AGCTGGGGAATGCCTCCTTTGGG + Exonic
1165734962 19:38170080-38170102 GGGTTAGGGGGGCCCCCTTTGGG - Intronic
1166181340 19:41111409-41111431 GGCTTAGGTGAGCCCCCTTCTGG - Intergenic
1167604575 19:50475105-50475127 GGCTGAGGACTGTCCCCTTCAGG + Intronic
1168595067 19:57668840-57668862 GGATTAGGAATGCCTTCTCTGGG + Intergenic
925339373 2:3125728-3125750 GGCTGAGGCAGGGCCCCTTTTGG - Intergenic
928103460 2:28452730-28452752 TGCTTAGGAATGGCCCGGTTTGG - Intergenic
936806761 2:116342657-116342679 GGCTTATGAATGCTCCTTCTTGG - Intergenic
937348413 2:121142802-121142824 GGCTTAAGAATGCTGCTTTTAGG - Intergenic
937418952 2:121738830-121738852 GGGTCAGGGATGCCCCCTTGGGG - Intronic
938170283 2:129069844-129069866 GGAATATGAATGCCCACTTTGGG - Intergenic
941687612 2:168463480-168463502 GGCTCAGAAATGCCACCTCTAGG - Intronic
1171411683 20:24952100-24952122 GGCAAATGAATGCCCCCATTGGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1184672068 22:46018795-46018817 GGCTTAAGAATCACCCCCTTAGG + Intergenic
1185260845 22:49861994-49862016 TGCTTAGTAATGCCCTCTGTTGG - Intronic
949934790 3:9108316-9108338 GGGTTAAGAATGCCTGCTTTAGG + Intronic
952621902 3:35354531-35354553 GGAATGGGAATGCCCCATTTGGG + Intergenic
955636783 3:61038909-61038931 GGCTTATGAAGGCCCACATTTGG - Intronic
957861284 3:85954640-85954662 AGCTTAGGCATTTCCCCTTTGGG - Intronic
965057341 3:163738295-163738317 GGCCTAGGAATACACCCTCTAGG + Intergenic
971562206 4:28093941-28093963 GGCTCAGGAAACCCACCTTTTGG - Intergenic
973969188 4:56194207-56194229 GGCTTACAAATGCCCGCTGTTGG - Intronic
976440001 4:85062126-85062148 GGCTTAAGCATGTCCCTTTTGGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG + Intergenic
997064947 5:130549005-130549027 GGCTTATGAATGGGGCCTTTGGG + Intergenic
1000305159 5:159987913-159987935 GGCTGAAGAATGCCCCCCCTCGG + Intergenic
1003869319 6:10389791-10389813 GGCTTAGAAAAGACCCGTTTCGG + Intergenic
1005260339 6:24052255-24052277 TGCATAGTAATGCCCACTTTAGG - Intergenic
1006078936 6:31553002-31553024 GTATTAGAAATGCCCCCTTTAGG - Intronic
1006120054 6:31798637-31798659 GGCTTAGGAATGCCCCCTTTTGG - Intronic
1006777800 6:36609736-36609758 GGCTTAAGAAAGGCTCCTTTGGG + Intergenic
1008459244 6:51748713-51748735 GGCTGAAGAATGGCCCATTTTGG + Intronic
1011515133 6:88145322-88145344 CTCTTAGGATTGCCCCCTGTGGG - Exonic
1015265125 6:131284006-131284028 GGATAAGGCATGCCACCTTTTGG - Intergenic
1015986114 6:138885613-138885635 GGCCCAGGAATGCCCTCTCTGGG - Intronic
1018085586 6:160298507-160298529 GTCTTTGGAATGCCCACTGTGGG - Intergenic
1027662146 7:80999639-80999661 GTCTTAGGATTGCCATCTTTAGG + Intergenic
1031087213 7:117314601-117314623 GATTTAGGGATGCCCTCTTTGGG - Intronic
1032013106 7:128359695-128359717 GGCTGAGGACTGACCCCCTTTGG - Exonic
1032959319 7:137012795-137012817 GTCTCAGGAATGCCACATTTAGG - Intronic
1037463972 8:19140897-19140919 GTGTTAGGAATGCCCCCGTGAGG - Intergenic
1038844559 8:31216694-31216716 GGAAGAGGAATGCCGCCTTTTGG + Intergenic
1041521997 8:58767310-58767332 GGCTTAGGAGGGCTCCCATTTGG + Intergenic
1047239339 8:123072408-123072430 GGCTTGGGAATTCCGCCCTTTGG - Intronic
1048141223 8:131796573-131796595 GGCTTAGCCAAGCCCCCTTATGG - Intergenic
1053159740 9:35805776-35805798 GGCTTGGGGGTGCCCCATTTCGG + Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056961263 9:91126137-91126159 GCCTTAAGTATGCCCTCTTTGGG - Intergenic
1058911220 9:109521572-109521594 AGCTTAGGAATGATCCCTTTGGG + Intergenic
1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG + Intronic
1060058952 9:120441768-120441790 GTATTAGGAATGCTTCCTTTAGG - Intronic
1060411289 9:123402101-123402123 GGATTATGATTGCCCCCTTATGG - Intronic
1061850782 9:133413914-133413936 GGCTGAGGAATGAGCCATTTGGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185787528 X:2903494-2903516 GGCTCAAGGCTGCCCCCTTTAGG + Intergenic
1187807181 X:23133341-23133363 GGCTTAGTATTGACTCCTTTGGG - Intergenic
1188015227 X:25100975-25100997 TCCTTATGAATGTCCCCTTTTGG + Intergenic
1191250075 X:58256018-58256040 TGCTTTGGGGTGCCCCCTTTGGG - Intergenic
1191252956 X:58268097-58268119 CGCTTTGGTGTGCCCCCTTTGGG + Intergenic
1192212949 X:69139308-69139330 GGCTCAGAAATGCTTCCTTTAGG - Intergenic
1195966897 X:110437136-110437158 GGCTTAGGAATGCTCTCTAGTGG + Intronic
1199159129 X:144586991-144587013 GGCATAAGAATGCCTCCCTTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic