ID: 1006123446

View in Genome Browser
Species Human (GRCh38)
Location 6:31821829-31821851
Sequence CCGCGCAGACGGGTGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006123440_1006123446 -6 Left 1006123440 6:31821812-31821834 CCATCAGTCGCGCGTCCCCGCGC No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123439_1006123446 -5 Left 1006123439 6:31821811-31821833 CCCATCAGTCGCGCGTCCCCGCG No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123435_1006123446 9 Left 1006123435 6:31821797-31821819 CCATCCCCTACTCTCCCATCAGT No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123438_1006123446 3 Left 1006123438 6:31821803-31821825 CCTACTCTCCCATCAGTCGCGCG No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123436_1006123446 5 Left 1006123436 6:31821801-31821823 CCCCTACTCTCCCATCAGTCGCG No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123433_1006123446 19 Left 1006123433 6:31821787-31821809 CCAACCGACTCCATCCCCTACTC No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123434_1006123446 15 Left 1006123434 6:31821791-31821813 CCGACTCCATCCCCTACTCTCCC No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data
1006123437_1006123446 4 Left 1006123437 6:31821802-31821824 CCCTACTCTCCCATCAGTCGCGC No data
Right 1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006123446 Original CRISPR CCGCGCAGACGGGTGCGCGC TGG Intergenic