ID: 1006123688

View in Genome Browser
Species Human (GRCh38)
Location 6:31823439-31823461
Sequence CCATGCTGCTAGAAATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006123681_1006123688 8 Left 1006123681 6:31823408-31823430 CCAGGATTTTCCCTTCCCAGATT No data
Right 1006123688 6:31823439-31823461 CCATGCTGCTAGAAATGGCCAGG No data
1006123682_1006123688 -2 Left 1006123682 6:31823418-31823440 CCCTTCCCAGATTTTTTCTTTCC No data
Right 1006123688 6:31823439-31823461 CCATGCTGCTAGAAATGGCCAGG No data
1006123684_1006123688 -7 Left 1006123684 6:31823423-31823445 CCCAGATTTTTTCTTTCCATGCT No data
Right 1006123688 6:31823439-31823461 CCATGCTGCTAGAAATGGCCAGG No data
1006123683_1006123688 -3 Left 1006123683 6:31823419-31823441 CCTTCCCAGATTTTTTCTTTCCA No data
Right 1006123688 6:31823439-31823461 CCATGCTGCTAGAAATGGCCAGG No data
1006123685_1006123688 -8 Left 1006123685 6:31823424-31823446 CCAGATTTTTTCTTTCCATGCTG No data
Right 1006123688 6:31823439-31823461 CCATGCTGCTAGAAATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006123688 Original CRISPR CCATGCTGCTAGAAATGGCC AGG Intergenic
No off target data available for this crispr