ID: 1006123842

View in Genome Browser
Species Human (GRCh38)
Location 6:31824765-31824787
Sequence GTGTTGGGACCCCAAATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006123842_1006123846 -6 Left 1006123842 6:31824765-31824787 CCCAAGATTTGGGGTCCCAACAC No data
Right 1006123846 6:31824782-31824804 CAACACCACATCTACTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006123842 Original CRISPR GTGTTGGGACCCCAAATCTT GGG (reversed) Intergenic