ID: 1006123846

View in Genome Browser
Species Human (GRCh38)
Location 6:31824782-31824804
Sequence CAACACCACATCTACTTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006123843_1006123846 -7 Left 1006123843 6:31824766-31824788 CCAAGATTTGGGGTCCCAACACC No data
Right 1006123846 6:31824782-31824804 CAACACCACATCTACTTGCTAGG No data
1006123839_1006123846 4 Left 1006123839 6:31824755-31824777 CCAGAGAGCACCCAAGATTTGGG No data
Right 1006123846 6:31824782-31824804 CAACACCACATCTACTTGCTAGG No data
1006123842_1006123846 -6 Left 1006123842 6:31824765-31824787 CCCAAGATTTGGGGTCCCAACAC No data
Right 1006123846 6:31824782-31824804 CAACACCACATCTACTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006123846 Original CRISPR CAACACCACATCTACTTGCT AGG Intergenic