ID: 1006131147

View in Genome Browser
Species Human (GRCh38)
Location 6:31870254-31870276
Sequence ACTGCCACACACACCTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006131147_1006131151 10 Left 1006131147 6:31870254-31870276 CCTTGGCAGGTGTGTGTGGCAGT 0: 1
1: 0
2: 3
3: 25
4: 279
Right 1006131151 6:31870287-31870309 GAGCAAGCTGCTGCCCCTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 286
1006131147_1006131152 15 Left 1006131147 6:31870254-31870276 CCTTGGCAGGTGTGTGTGGCAGT 0: 1
1: 0
2: 3
3: 25
4: 279
Right 1006131152 6:31870292-31870314 AGCTGCTGCCCCTCCTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006131147 Original CRISPR ACTGCCACACACACCTGCCA AGG (reversed) Intronic
900980875 1:6045464-6045486 ACTGCCACTCACTCCAGGCAGGG - Intronic
902331471 1:15733033-15733055 AGTCCCACACCCACCTCCCAGGG - Intronic
902331995 1:15735280-15735302 AGTCCCACACCCACCTCCCAGGG - Intergenic
902439677 1:16421369-16421391 ACAGCCACACACACCTTCCTTGG + Intronic
902470748 1:16646448-16646470 TCTGCCACATCCTCCTGCCAAGG - Intergenic
902488053 1:16761000-16761022 TCTGCCACATCCTCCTGCCAAGG + Intronic
903423848 1:23238511-23238533 ACTGCCAGGCCCACCTCCCATGG - Intergenic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
906096285 1:43226377-43226399 CCTCCCAGACACCCCTGCCAAGG - Intronic
906255393 1:44345241-44345263 ACATCCACACACACAGGCCAAGG + Intronic
906950826 1:50333459-50333481 ACTGGCACCCACACCTCCCGCGG + Intergenic
907262834 1:53234345-53234367 ACTGCGACACCCACATGCCCTGG + Intronic
907388549 1:54141420-54141442 GCCGCCACACACATCTGCAAGGG + Exonic
907515220 1:54989538-54989560 ACTGCCCCACACAGCTGCCGAGG + Intronic
913100590 1:115560554-115560576 AGTGCCATACTCACCTTCCAGGG + Intergenic
914802663 1:150972684-150972706 TCTCTCACACACACCTGCCTTGG + Intronic
916242991 1:162658257-162658279 ACTGCCACCCCCACCTCCAATGG - Intronic
916727875 1:167539674-167539696 ACTCCCCCACATACCTGTCAAGG + Intronic
918487248 1:185043008-185043030 ACAGCCCCACACATCTGCAAAGG - Intergenic
921732127 1:218590411-218590433 TGTTCCAAACACACCTGCCATGG - Intergenic
922033987 1:221830708-221830730 ACTTGCACACACACCATCCACGG - Intergenic
922406404 1:225318204-225318226 ACTTGCACACACCCCTTCCAAGG - Intronic
1062794840 10:336887-336909 ACACACACACACACCTGCCTAGG - Intronic
1063066326 10:2612911-2612933 AAAGCCACACACACAGGCCAAGG + Intergenic
1064300629 10:14119726-14119748 CCTGCCCCACAGACCTTCCAAGG + Intronic
1065186935 10:23177634-23177656 ATAGCCACACAGAGCTGCCATGG + Intergenic
1065252504 10:23830567-23830589 CATGCCACACATACCTGCAAGGG - Intronic
1065907494 10:30271192-30271214 ACTGCAACATCCACCTACCAGGG - Intergenic
1066006511 10:31150825-31150847 ACCTCCACACAGGCCTGCCAGGG - Intergenic
1067000009 10:42601992-42602014 ACTGAAACACCCACCTCCCAAGG + Intronic
1067159660 10:43814154-43814176 ACATGCACACACACCTGCCTAGG + Intergenic
1069756865 10:70778805-70778827 ACTGCCACAACCACCACCCATGG - Intronic
1069773062 10:70911501-70911523 CCTGCCAGACATACCTGCCAGGG - Intergenic
1070843645 10:79505169-79505191 AGGGCCACACAGAGCTGCCATGG - Intergenic
1070930021 10:80254431-80254453 AGGGCCACACAGAGCTGCCATGG + Intergenic
1072246324 10:93547328-93547350 ACTGCCACCCCCACATGTCAGGG + Intergenic
1073470117 10:103717000-103717022 AGTGCCAAACAAACCTGGCACGG - Intronic
1073928948 10:108551764-108551786 ACTGCCACAGACACCAGTGATGG + Intergenic
1073986200 10:109212258-109212280 AGGGCCACACACACTTGTCATGG + Intergenic
1075072624 10:119328766-119328788 ACAGCCACGCTCACCTGGCAGGG + Intronic
1075428524 10:122361855-122361877 AATGGGACACACACCTGGCAGGG + Intergenic
1076941761 10:133614806-133614828 ACAGCCAAAAACACCTGCCCTGG - Intergenic
1077312342 11:1894852-1894874 AGTTTCACACACACCTCCCACGG - Intergenic
1077614268 11:3663943-3663965 ACTGATACACAAAACTGCCACGG - Intronic
1079109738 11:17598558-17598580 TCTGCCCCATAGACCTGCCAGGG - Intronic
1079211157 11:18461774-18461796 ACTGCAACCCACACCTTCCCGGG - Intronic
1083262274 11:61529709-61529731 ACTGCCACCTCCACCTCCCAAGG + Intronic
1083618500 11:64037572-64037594 CCTGCCCCTCACACCTACCAGGG - Intronic
1084492813 11:69487682-69487704 ACACCCACCCACACCTGCCTGGG - Intergenic
1084524507 11:69687152-69687174 CCTGCCACCGACACCTGCCGGGG - Intergenic
1085278624 11:75315809-75315831 ACCCCCACAAACACCTGCCCTGG + Intronic
1085697868 11:78721204-78721226 ACTGGCACAGACATCTGTCAAGG - Intronic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1089750709 11:120649198-120649220 TCTGCCCCACACACCTGGGAGGG + Intronic
1091330639 11:134728684-134728706 AGGGCCACACACACGTGTCATGG - Intergenic
1091687618 12:2574816-2574838 TTTGCCACAGACCCCTGCCAGGG - Intronic
1092779006 12:11968114-11968136 CCTGCCACTCTCACCTCCCAGGG - Intergenic
1092853972 12:12655793-12655815 AGTGCCACCCACACTTGCCAGGG - Intergenic
1094375580 12:29784294-29784316 ACCCCCACACCCACCTTCCAGGG + Intronic
1094414206 12:30201100-30201122 ACCCCCACACCCACCTTCCAGGG - Intergenic
1094510604 12:31094146-31094168 ACTTCCACAGACGCCTTCCAAGG - Intronic
1098953632 12:76666747-76666769 TCTGCCACACACTCTTTCCAAGG + Intergenic
1099569925 12:84304516-84304538 ACTGCCACCCACACCCTGCATGG + Intergenic
1099704037 12:86127810-86127832 ACTGCCCCAAAGACCTTCCAGGG - Intronic
1101719774 12:107341336-107341358 ACTGCTAGACTCCCCTGCCAGGG - Intronic
1102370868 12:112381821-112381843 GCGCCCACACACACCTGCCCCGG + Intronic
1102615377 12:114149548-114149570 CCTGCCTCACACACCTTCCCAGG - Intergenic
1102695844 12:114798770-114798792 ACACACACACACACCTGCCCGGG - Intergenic
1102824502 12:115936712-115936734 ACTGCTACAAAGAACTGCCAGGG + Intergenic
1102885615 12:116519499-116519521 CCTGCCACACCTACCTCCCAGGG - Intergenic
1103113228 12:118301168-118301190 TTTTCCACACACACCTGCCAGGG + Intronic
1104545833 12:129712046-129712068 CCTGCCACAGAGCCCTGCCAAGG - Intronic
1104946029 12:132415253-132415275 GCCCCCACACACACCTGGCATGG + Intergenic
1105703158 13:22948835-22948857 ACTCACTCACACGCCTGCCACGG + Intergenic
1105855856 13:24371319-24371341 ACTCACTCACACGCCTGCCACGG + Intergenic
1106148051 13:27069498-27069520 ACTCTCACACACAGCTGGCAGGG + Intronic
1109603715 13:64664002-64664024 ACTGGATCCCACACCTGCCAAGG - Intergenic
1110002979 13:70229271-70229293 ACCCCCACACCCACCAGCCAGGG - Intergenic
1111690602 13:91558616-91558638 ATTGCCACTCAAACGTGCCAGGG - Intronic
1113308049 13:109099624-109099646 GCTGGGAAACACACCTGCCATGG - Intronic
1114742420 14:25111424-25111446 ACTGCATCACACATCTGGCATGG - Intergenic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1117022506 14:51585916-51585938 ACACACACACACACATGCCATGG - Intronic
1118269326 14:64327650-64327672 AATGCCACACACTCCAGCCTGGG + Intronic
1119266045 14:73263836-73263858 GCTGTCACACACACCTGTCAGGG - Intronic
1119411251 14:74432132-74432154 ACACACACACACACCTTCCAAGG - Intergenic
1119642944 14:76328541-76328563 CCCGCCCCACACACCTCCCAGGG + Intronic
1120484004 14:85087239-85087261 GCTTCCACACACACATTCCAAGG + Intergenic
1122488276 14:102095992-102096014 CCTGCAACACACACCTTCCTTGG + Intronic
1124340876 15:28888513-28888535 TCTGCCACGCATACCTGCCCCGG + Intronic
1125322808 15:38506897-38506919 TCTGAGACACAGACCTGCCAAGG + Intronic
1125884701 15:43220094-43220116 ACTGCCTCACTCCCCTGCCCTGG - Intronic
1127393593 15:58526304-58526326 ACTGCAAAACACTCCAGCCAGGG - Intronic
1128738849 15:70069781-70069803 ACTGGCCCCCACACCTGTCAGGG - Intronic
1129740877 15:77989013-77989035 GCTGGCGCTCACACCTGCCAGGG + Intronic
1129816909 15:78563282-78563304 ACTGCTACACACTCCAGCCTGGG + Intergenic
1131233794 15:90679346-90679368 ACTGCCATGCACTCCAGCCAAGG - Intergenic
1132057411 15:98662818-98662840 ACTGCCACCCACACCACACATGG - Intronic
1132058354 15:98669701-98669723 GCTTCCACACCCACCTGACAAGG - Intronic
1132652267 16:1026852-1026874 GCTGCCAATTACACCTGCCAAGG - Intergenic
1134609557 16:15597629-15597651 TCTGCCACTCTCACCTTCCATGG - Intronic
1136552801 16:30990419-30990441 ACTGACACACACACAGGACAAGG + Exonic
1141459657 16:84170380-84170402 ACAGACACACACACCTCTCAGGG + Intronic
1142249146 16:88983202-88983224 TCTGCCCCACACACATCCCAGGG + Intergenic
1142328299 16:89432907-89432929 ACAGCCCCACACTCCAGCCATGG + Intronic
1142432662 16:90038636-90038658 TCTGAGTCACACACCTGCCAGGG + Intronic
1143090697 17:4447752-4447774 TCTGCCACACAGTCCTGCCCTGG - Intronic
1143604219 17:7972136-7972158 ACTGCCACCCCCACCAGCCCAGG + Intergenic
1144835158 17:18153011-18153033 TGTGCCACCCACACCTGCCATGG + Intronic
1146006232 17:29162441-29162463 ACTGTCACAAACACATGCCAAGG - Intronic
1146658235 17:34647913-34647935 ACTACCAGACACACCAGCCTGGG + Intergenic
1147988143 17:44318253-44318275 AGTGCCAGCCCCACCTGCCAGGG + Exonic
1149555734 17:57572106-57572128 TCTGCTGCACACACCTGTCAGGG - Intronic
1150758131 17:67934440-67934462 ACTGCAACCCCCACCTCCCAAGG - Intronic
1151023925 17:70655100-70655122 ACACACACACACACCTGCAAAGG - Intergenic
1152704528 17:81835932-81835954 CCTGCCTCACACACCTGCAGGGG + Intergenic
1153012213 18:549375-549397 AGTAGCACACACACCTGCCCAGG - Intergenic
1153320556 18:3770124-3770146 ACTGCCACACACACAGACCCTGG - Intronic
1155045829 18:22102149-22102171 ACTCCCACCCTCACCTACCAAGG + Intergenic
1155238742 18:23846244-23846266 ACTCCCATACACACCTCCCCAGG + Intronic
1155835700 18:30581248-30581270 ACTGCCAGACTAATCTGCCAAGG - Intergenic
1156220515 18:35046499-35046521 ACTGCCCAACACACCTGGCCAGG - Intronic
1156646987 18:39175732-39175754 ACAGGCATACACACCTGCCTTGG + Intergenic
1158350942 18:56563841-56563863 ACTGTCCCACACCCCTGACACGG + Intergenic
1160168720 18:76535058-76535080 ACTGAGACACCCACCTGCCGGGG - Intergenic
1160509063 18:79443297-79443319 ACTGTCACACACACTTGCCTCGG + Intronic
1161452623 19:4354950-4354972 ACTTCCACAGTCACCTGACACGG + Exonic
1161843670 19:6697543-6697565 AGTTCCACCCTCACCTGCCAGGG + Exonic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162539240 19:11284143-11284165 ACTGCAACATCCACCTCCCAAGG + Intergenic
1163538881 19:17894696-17894718 CTTGGCCCACACACCTGCCATGG + Exonic
1165406733 19:35635595-35635617 ACTGCAACCTCCACCTGCCAGGG + Intronic
1166068953 19:40376797-40376819 ACTGCCCCACACAGGGGCCAAGG - Intronic
1166271927 19:41719793-41719815 TGTGATACACACACCTGCCATGG + Intronic
1166277003 19:41761111-41761133 TGTGACACACACACCTGCCAGGG + Intronic
1166277420 19:41763653-41763675 TCTGACACACACACCTGCCCTGG + Intronic
1166419704 19:42626842-42626864 TCTGACATACACACCTGCCATGG - Intronic
1166424184 19:42661511-42661533 TGTGACACACACACCTGCCATGG + Intronic
1166431694 19:42733178-42733200 TGTAACACACACACCTGCCATGG - Intronic
1166444684 19:42848417-42848439 TGTAACACACACACCTGCCATGG - Intronic
1166447666 19:42872161-42872183 TGTATCACACACACCTGCCATGG - Intronic
1166452119 19:42910974-42910996 TGTAACACACACACCTGCCATGG - Intronic
1166454576 19:42929836-42929858 TGTAACACACACACCTGCCATGG - Intronic
1166464373 19:43019164-43019186 TGTAACACACACACCTGCCATGG - Intronic
1166470529 19:43075748-43075770 TGTAACACACACACCTGCCATGG - Intronic
1166481656 19:43179273-43179295 TGTAACACACACACCTGCCATGG - Intronic
1166491236 19:43262254-43262276 TGTAACACACACACCTGCCATGG - Intronic
1166516469 19:43450913-43450935 AGTGCCACACACACATCTCAGGG - Intergenic
1166566851 19:43770712-43770734 TCTGCCCTACACACTTGCCAGGG - Intronic
1167140515 19:47647612-47647634 TGGGCCACACACACGTGCCAAGG - Intronic
1168319300 19:55499795-55499817 CCTGCCCCACTCACCTTCCAGGG + Exonic
1202703146 1_KI270713v1_random:3240-3262 TCTGCCACATCCTCCTGCCAAGG - Intergenic
925040583 2:730614-730636 ACTGCTTCAGACACCTTCCACGG - Intergenic
925540388 2:4960276-4960298 ACTGCAATACCCACCTGTCAAGG - Intergenic
925670243 2:6303281-6303303 CCTGCCACACAGAGCTTCCATGG - Intergenic
926076181 2:9944900-9944922 ACTGTCACTAGCACCTGCCACGG + Intergenic
927518038 2:23683260-23683282 CCTCTCCCACACACCTGCCAAGG + Intronic
927929509 2:27035126-27035148 TCTGCCACATCCAGCTGCCAGGG - Exonic
932404448 2:71504057-71504079 CCGGCCTCACACACCCGCCACGG - Intronic
932586876 2:73036049-73036071 TCTGGCCCACACACCTGCAAAGG + Intronic
933728455 2:85439345-85439367 ACTGCCCCTCACACTTGCGAAGG - Intergenic
936125923 2:109789174-109789196 TCTGACACACACACCTGCAGTGG - Intergenic
936218770 2:110582294-110582316 TCTGACACACACACCTGCAGTGG + Intergenic
938702525 2:133892478-133892500 ACTGACACAAACCCCTGGCAGGG + Intergenic
938997562 2:136696654-136696676 ACAGGCACACACACCAGCTAGGG - Intergenic
943067094 2:183099918-183099940 ACTGCCACCTCCACCTCCCAGGG - Exonic
943679932 2:190757700-190757722 ACACACACACACACCCGCCAAGG + Intergenic
944849791 2:203706609-203706631 ACTGAAAGACGCACCTGCCAAGG - Exonic
945926236 2:215807365-215807387 TCTTCCACACACTCCAGCCATGG + Intergenic
948304411 2:236935959-236935981 ATTGGCACAGACACCTGCAAAGG + Intergenic
948313411 2:237007778-237007800 CCAGCCACACACACATCCCAAGG - Intergenic
948670336 2:239564417-239564439 GCTGCCTCACACAGGTGCCAGGG + Intergenic
948877565 2:240837773-240837795 AATGCCACCCACACCTCCCTTGG + Intergenic
1168855651 20:1005841-1005863 ACGGCCACACCTACCTGCAAGGG + Intergenic
1169140282 20:3223867-3223889 ACTGAGACAGACACCTGCCTGGG - Exonic
1170698536 20:18682550-18682572 GGTTCCACACACAGCTGCCAAGG - Intronic
1170900256 20:20455571-20455593 ACTGCCACAGAGGACTGCCAAGG + Intronic
1171305768 20:24104577-24104599 ACTGCCTCACAGCCCTGCCCTGG - Intergenic
1171495942 20:25555299-25555321 CATGCCACACACACCTGCCGAGG + Intronic
1171502548 20:25604830-25604852 ACTGGCACACGTTCCTGCCATGG - Intergenic
1172958798 20:38782390-38782412 CCTCCCTCCCACACCTGCCAGGG + Intergenic
1173704749 20:45101394-45101416 CCTGGCACACACACTTGACAGGG + Intergenic
1174414344 20:50357198-50357220 ACTCCCACACTCAGATGCCAGGG - Intergenic
1174810104 20:53638204-53638226 ACACACACACACACCTGCCATGG - Intergenic
1175146872 20:56903610-56903632 ATTGCCTCACTCACCTGCCTGGG - Intergenic
1176268953 20:64225506-64225528 GCAACCACACACACCTGCCAGGG + Intronic
1177417184 21:20808980-20809002 CCTGCCACACGCACCATCCATGG + Intergenic
1177856179 21:26403141-26403163 GCTGCAACACTCACTTGCCAAGG - Intergenic
1178976946 21:37228156-37228178 ACTGCCACCCTCACGTTCCATGG - Intronic
1179201109 21:39221825-39221847 ACTGCAACCTCCACCTGCCAGGG - Intronic
1179247577 21:39647022-39647044 ACTGCCACCTCCACCTCCCAGGG - Intronic
1179883523 21:44303572-44303594 ACGTCCAAACACACCAGCCAGGG - Intronic
1181345210 22:22215024-22215046 ACCGCCACACTCACCTGCACTGG + Intergenic
1181899473 22:26141089-26141111 ACTGCCTTACTCCCCTGCCAAGG + Intergenic
1182044668 22:27264891-27264913 ACAGACACATCCACCTGCCATGG + Intergenic
1182550503 22:31098537-31098559 ACTGCCACAAACGCCTGCCAGGG - Intronic
1183347949 22:37318317-37318339 CCTGGCACACAGAGCTGCCAGGG + Intergenic
1183590474 22:38776700-38776722 CCTGGGAAACACACCTGCCATGG + Intronic
1184022320 22:41829077-41829099 ACTGCTACAGGCACCTGGCAGGG - Intergenic
1185142072 22:49108115-49108137 GCTTCCACCAACACCTGCCAAGG - Intergenic
1185274855 22:49946083-49946105 GCTGCCAGCCACACCTGCCAGGG - Intergenic
1185366822 22:50440647-50440669 ACAGGCTCACGCACCTGCCATGG - Intronic
950544180 3:13629103-13629125 CCCTCCACACACACCTCCCAGGG - Intronic
950817564 3:15722344-15722366 ACTGTCACACACTGATGCCAGGG + Intronic
953327303 3:42023393-42023415 AATGCCACCCAACCCTGCCATGG - Intronic
954298683 3:49687795-49687817 TCTGCCACATCCTCCTGCCAAGG + Exonic
954569347 3:51627559-51627581 AGTGCCACACATGCCTTCCAGGG - Exonic
955367960 3:58327616-58327638 ACTGACACACACATCTGGCCTGG - Intergenic
955496888 3:59542707-59542729 ACTGCCACACCACCCTGCCCAGG + Intergenic
956710596 3:72035429-72035451 TCTGCCACACAGACCTGCCATGG + Intergenic
957418031 3:79930398-79930420 CCTGGATCACACACCTGCCAAGG - Intergenic
960496047 3:118376415-118376437 ACAGACACACACACCTCACATGG - Intergenic
961417914 3:126774739-126774761 ACTGCCACCCTCACCAGCAAAGG - Intronic
962429481 3:135306288-135306310 AATGCTATGCACACCTGCCAGGG - Intergenic
965132696 3:164722315-164722337 ACACACACACACACATGCCATGG - Intergenic
965985692 3:174750505-174750527 ACTGCAACTTCCACCTGCCAGGG + Intronic
966568439 3:181410462-181410484 ACAGGCACACACACCTGGCTAGG + Intergenic
966927817 3:184657007-184657029 TCTGCCGCAAACATCTGCCAGGG - Intronic
967999606 3:195195806-195195828 ACCGCCAGCCACACCTGCCATGG + Intronic
968883717 4:3315831-3315853 CCTGCCAGGCCCACCTGCCACGG - Intronic
969266416 4:6066906-6066928 CACCCCACACACACCTGCCATGG + Intronic
969637992 4:8380547-8380569 CCTGCTAGACACACCTGCCCTGG - Intronic
973873267 4:55188054-55188076 ACTCCCACACATACCAGCAAAGG + Intergenic
976870515 4:89787778-89787800 CCTGCCAAAAACACCTACCATGG + Intronic
980097291 4:128504495-128504517 ACTGTAACACACACCTTCTAAGG - Intergenic
980931240 4:139185096-139185118 AAGGCCAAACACACCTGGCATGG - Intergenic
984550768 4:181156395-181156417 AATGCCACACACACTTGGCATGG - Intergenic
984635929 4:182109631-182109653 TCTGCCACTCACAGCTGCCTTGG + Intergenic
984727126 4:183032130-183032152 GCTGCCATAAACACCTGGCAGGG + Intergenic
986178946 5:5375883-5375905 ACTGGCTCACACACCTGCTCAGG - Intergenic
991311676 5:65249978-65250000 CTTGCCACACCCACCTCCCAAGG + Intronic
992191238 5:74294205-74294227 CCTGCCACCCACCTCTGCCAAGG + Intergenic
993060818 5:83036688-83036710 ATTGCCACACACAGAAGCCAAGG - Intergenic
995128939 5:108609465-108609487 TCAGCCACCCACACCTCCCACGG + Intergenic
997253641 5:132410705-132410727 TCCGCCACGCACACCTGCCTCGG - Intronic
998451027 5:142234932-142234954 ACTCCTGCACACCCCTGCCAAGG + Intergenic
1000534019 5:162457960-162457982 ACTGCCACACACCTCTGGGAGGG + Intergenic
1001280581 5:170383620-170383642 ACAGGCTCACACACCTGACAGGG + Intronic
1001286238 5:170426004-170426026 ACTGCCAAACTGACCTGCCCGGG - Intronic
1001396223 5:171420929-171420951 ACAGACACACACACATGCCCGGG + Intronic
1001985837 5:176073941-176073963 ACAGCCAAAAACACCTGCCCTGG - Intronic
1002169967 5:177369463-177369485 TCTCCCCCACACACCTGGCAAGG - Intronic
1002231034 5:177764183-177764205 ACAGCCAAAAACACCTGCCCTGG + Intronic
1002687488 5:181024959-181024981 ACTAGCACACTCACCAGCCAGGG + Intergenic
1002892587 6:1348479-1348501 ACTCCCACACACACCTGCTAAGG + Intergenic
1003192364 6:3885847-3885869 GCTGTCACAAAGACCTGCCATGG - Intergenic
1003402526 6:5802725-5802747 ACTGCCACACAAGCCCACCAGGG + Intergenic
1003470321 6:6423556-6423578 ACTGGCAGAGACACCTGCCTTGG + Intergenic
1004483679 6:16045426-16045448 ACTGCCACGAACGCCTGCCTGGG - Intergenic
1005225131 6:23633976-23633998 AATCCCACAGACACCTGCCTTGG - Intergenic
1005885215 6:30092266-30092288 CCTGCCACATACACCACCCAGGG - Intergenic
1006131147 6:31870254-31870276 ACTGCCACACACACCTGCCAAGG - Intronic
1008511486 6:52279649-52279671 AATGCCACACTCACCTGTCATGG + Intronic
1009041650 6:58187089-58187111 ACTGAGACACCCACATGCCATGG - Intergenic
1009217502 6:60941404-60941426 ACTGAGACACCCACATGCCATGG - Intergenic
1009324064 6:62328414-62328436 ACACACACACACACCTTCCAAGG + Intergenic
1011610645 6:89146715-89146737 GGTCCCACACACACCTGCCCCGG - Intronic
1014899776 6:126948444-126948466 AGAGACACACACACCTCCCAAGG + Intergenic
1015132479 6:129829235-129829257 ACTGCTACACAGGCCTGGCATGG - Intergenic
1015556081 6:134462865-134462887 ACTGCAACTCCCACCTCCCAGGG + Intergenic
1017036772 6:150274143-150274165 ATAGCCACACACATCTCCCAGGG + Intergenic
1017588120 6:155948555-155948577 CCAGCCACACTCACCTGTCAGGG - Intergenic
1017595272 6:156021678-156021700 ACTGCCACATACCCATGGCAAGG + Intergenic
1019641915 7:2107849-2107871 GCTGCCACCCAGACCTGCAAGGG + Intronic
1019684834 7:2375651-2375673 CCTGCCACTAACACCAGCCAAGG - Intronic
1020394242 7:7695897-7695919 ACTGTTTCACACTCCTGCCATGG - Intronic
1022006718 7:26272282-26272304 AATGCCACACACACCCTACAAGG + Intergenic
1022957123 7:35391129-35391151 AATTCCACACACATTTGCCAAGG + Intergenic
1024244395 7:47458259-47458281 ACTCCCACACACACACGCCATGG + Intronic
1025256133 7:57385018-57385040 ACTCCCACACTCAGATGCCAGGG + Intergenic
1027160509 7:75799023-75799045 GCTGCCACACTTACCTGGCAAGG + Intergenic
1029269049 7:99365649-99365671 ACTGCCACACACACAGGCTCTGG - Intronic
1033895421 7:146063664-146063686 ACTGCTAGAGACACCAGCCAAGG - Intergenic
1034919034 7:155064180-155064202 GCTGCCAAACACATCTGACACGG + Intergenic
1036753253 8:11456378-11456400 ACTCACACACACACCAGGCAGGG - Intronic
1041008323 8:53517040-53517062 AATGACTCCCACACCTGCCATGG - Intergenic
1041415517 8:57603598-57603620 ACTGACACACAGACCTGATAAGG + Intergenic
1043943219 8:86220260-86220282 TCTGCCACACACTGCTGACAGGG - Intronic
1044712108 8:95067953-95067975 ACTCCCACCCACACCACCCAAGG - Intronic
1048621079 8:136133504-136133526 AATGACAAACACACCAGCCAAGG - Intergenic
1049379860 8:142306609-142306631 AGTGCCCCTCGCACCTGCCAGGG + Intronic
1049920779 9:362152-362174 ACTGATACCCACATCTGCCAAGG - Intronic
1051058423 9:13016285-13016307 AAGGCCACACACAACTGCAAGGG + Intergenic
1051901674 9:22049550-22049572 ACTGGCCCACACACCAGCCAGGG + Intergenic
1052729339 9:32266731-32266753 ACAACCACACAAACCTGGCAAGG + Intergenic
1052729554 9:32269166-32269188 ACAACCACACAAACCTGGCAAGG + Intergenic
1053299480 9:36938835-36938857 AGTGCCACATACAGCTGCGAGGG + Intronic
1056779042 9:89535723-89535745 ATGGACACCCACACCTGCCAGGG + Intergenic
1057027619 9:91746937-91746959 ACAGCAACACACGCCAGCCAAGG + Intronic
1058614851 9:106815168-106815190 ACACCCACACACACCTGTCATGG + Intergenic
1058934293 9:109753602-109753624 TCTTCCACACACACTTGCAAAGG - Intronic
1059425060 9:114215863-114215885 ACTGTCCCACTCACCTGGCAGGG - Intronic
1060304743 9:122401189-122401211 CCTGCCACAGAAACCTGCAAGGG - Intergenic
1060758686 9:126230622-126230644 CCAGCCACACAGGCCTGCCAAGG + Intergenic
1060915581 9:127387664-127387686 ACTGCAACATCCACCTCCCAGGG - Intronic
1062381677 9:136289945-136289967 ACTTTCACACCCACCTGCCTGGG + Exonic
1185539822 X:894083-894105 ACTGTCACACAGAGCTGCAAGGG + Intergenic
1189497313 X:41520916-41520938 ACTGTAACCCACACCTGGCATGG - Intronic
1190264365 X:48818480-48818502 AGTCACACACACACATGCCAAGG - Intronic
1190871285 X:54426727-54426749 ACAGCCATACACAGCAGCCAAGG - Intergenic
1191865651 X:65701674-65701696 ACTGCACAACACTCCTGCCATGG + Intronic
1193996854 X:88375710-88375732 AGTGGCAGTCACACCTGCCAGGG + Intergenic
1197758280 X:130011190-130011212 ACTCCCACCCACAGCTCCCAAGG + Intronic
1199703010 X:150399165-150399187 CCTGCCACAGCCACCTCCCAGGG - Intronic
1199984717 X:152942083-152942105 ACTGCCCCACAGACCAGCCCCGG - Intronic
1200070301 X:153525913-153525935 ACTGCCCCAGACGCCTGCCCTGG + Intronic
1200983747 Y:9285562-9285584 TCTGGCACACCCAACTGCCATGG + Intergenic
1202126624 Y:21574140-21574162 TCTGGCACACCCAACTGCCATGG - Intergenic