ID: 1006132060

View in Genome Browser
Species Human (GRCh38)
Location 6:31875675-31875697
Sequence CAATGGTTCTTAACGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006132054_1006132060 17 Left 1006132054 6:31875635-31875657 CCTCCCATTTCTGGGGGGACTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1006132060 6:31875675-31875697 CAATGGTTCTTAACGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 73
1006132056_1006132060 13 Left 1006132056 6:31875639-31875661 CCATTTCTGGGGGGACTCAAGAA 0: 1
1: 0
2: 4
3: 12
4: 126
Right 1006132060 6:31875675-31875697 CAATGGTTCTTAACGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 73
1006132055_1006132060 14 Left 1006132055 6:31875638-31875660 CCCATTTCTGGGGGGACTCAAGA 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1006132060 6:31875675-31875697 CAATGGTTCTTAACGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 73
1006132051_1006132060 23 Left 1006132051 6:31875629-31875651 CCACTGCCTCCCATTTCTGGGGG 0: 1
1: 0
2: 2
3: 38
4: 393
Right 1006132060 6:31875675-31875697 CAATGGTTCTTAACGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006132060 Original CRISPR CAATGGTTCTTAACGTGGCC TGG Intronic
902569776 1:17339754-17339776 CACTGGTGCTCCACGTGGCCAGG + Exonic
904232372 1:29086565-29086587 AAAAGGATCTTAAGGTGGCCGGG - Intronic
920625714 1:207596316-207596338 TAATACTTCTTAAAGTGGCCGGG + Intronic
922763679 1:228147037-228147059 CCATGGTTATGAATGTGGCCAGG + Intronic
1064026518 10:11853078-11853100 CAATGGTTCCTAGTGAGGCCCGG - Intronic
1069713349 10:70504943-70504965 CAGTGGATCTTAACGTGACGAGG - Intronic
1070397744 10:76026334-76026356 CACAGGTTCTAAATGTGGCCTGG + Intronic
1071449644 10:85781940-85781962 CAATGGTTATTTAGGAGGCCAGG + Intronic
1077762748 11:5121359-5121381 CTGTGGCTCCTAACGTGGCCAGG + Intergenic
1078748043 11:14134010-14134032 AAGTGGTTCTGAACATGGCCTGG - Intronic
1080265151 11:30392660-30392682 CACTGGTTCTTAAAGGGGACGGG + Intronic
1083436398 11:62646442-62646464 CAAAGGTTCCTCACGAGGCCGGG + Intronic
1091216565 11:133905921-133905943 AAACGGTTCTTAGCGGGGCCTGG - Intergenic
1093481039 12:19604057-19604079 CAATTGTTCTTAACCAGGCGTGG + Intronic
1097550625 12:61063363-61063385 CAATTGTTCTTAACAAAGCCTGG - Intergenic
1098159688 12:67638101-67638123 CAATTGTTCTTAAATTGTCCTGG - Intergenic
1099735765 12:86564906-86564928 CAATGGTTCTTGAGGTGTCAGGG + Intronic
1105710701 13:23006199-23006221 CAATGGGTCTTAACCTGCCTGGG + Intergenic
1111704428 13:91730889-91730911 CAATGTTTCTAAATGTGGCCTGG - Intronic
1118137737 14:63046606-63046628 CAGTGGTTCTCAAAGTGGCCTGG + Intronic
1118814627 14:69301301-69301323 CAATGGTTCTTAACCTTTTCTGG - Intronic
1120846274 14:89128496-89128518 CAATTGTTCATAAGCTGGCCTGG - Intronic
1121316020 14:92961404-92961426 CCATGGTCCTCAAGGTGGCCGGG + Intronic
1121423793 14:93833894-93833916 GAATGGTTCTGAAAGTGTCCCGG - Intergenic
1126875006 15:53032107-53032129 CAATGGTTCTCAACTTGAGCAGG - Intergenic
1128040505 15:64568423-64568445 CAGTGGTTCTCAACTTGGGCTGG + Intronic
1134514124 16:14873221-14873243 CTATGGACCTTAACATGGCCTGG - Intronic
1134701766 16:16271721-16271743 CTATGGACCTTAACATGGCCTGG - Intronic
1134970064 16:18522929-18522951 CTATGGACCTTAACATGGCCTGG + Intronic
1135269672 16:21058162-21058184 CACTGGGTCTTACAGTGGCCTGG - Exonic
1138062123 16:53902816-53902838 CAAAAGTTATCAACGTGGCCGGG + Intronic
1141420487 16:83912181-83912203 CGATGGTTCTAAGGGTGGCCTGG - Intronic
1141522578 16:84590878-84590900 AAATGGCTCTTAATTTGGCCCGG + Intronic
1144051464 17:11500558-11500580 CTATGGTTTAAAACGTGGCCTGG - Intronic
1145103753 17:20097992-20098014 CAATGGTTCTCAATGGGGACAGG - Intronic
1146332011 17:31935484-31935506 CAAAGGTTCTTAACTTGAACAGG + Intergenic
1150834282 17:68550699-68550721 CAGTGGTTCTCAAGGTTGCCTGG + Intronic
1152231617 17:79116848-79116870 CAGTGGTTGTCAAAGTGGCCTGG + Intronic
1153289141 18:3483206-3483228 AAATGGTTCTTAAACTGGCCGGG - Intergenic
1159973323 18:74679859-74679881 CAGTGGTTCTTCATGTGGCATGG + Intronic
1166140317 19:40801900-40801922 CAGTGGTTCTTGACTTTGCCAGG + Intronic
932197367 2:69796218-69796240 CAATTCTTCTTAAAGTGCCCTGG + Intronic
936413101 2:112277884-112277906 CAATGGTTCTAAACCTTCCCTGG + Intronic
942313515 2:174678498-174678520 CACTGCTTCTTCTCGTGGCCAGG - Intronic
944381837 2:199119466-199119488 TAGTGGTTCTTAACCTGGACTGG - Intergenic
1172556001 20:35842048-35842070 TAATGGTTCATAAACTGGCCGGG + Intronic
1176965375 21:15206653-15206675 CAATGCTTCCTAATGTAGCCAGG + Intergenic
1181298659 22:21863161-21863183 CAGTGGTTCTTAATGTTTCCAGG + Intronic
955727322 3:61947393-61947415 CAATGGTTCTGACCGGTGCCAGG + Intronic
958731901 3:97968787-97968809 CAGTGGTTCTTAACCTTGTCAGG - Intronic
959625363 3:108443755-108443777 CAATGGTTCTTAATCTGGACTGG + Intronic
963269956 3:143276738-143276760 CCATGGTTCTTAACCTTCCCTGG + Intronic
963850762 3:150208423-150208445 CAGTGGTTCTTAACTTGGGGTGG + Intergenic
967339363 3:188379062-188379084 AAATGGTCCTTATCTTGGCCTGG - Intronic
967844701 3:194034465-194034487 CAGTGGTTCTTAAAGTGTCTTGG - Intergenic
972280242 4:37595283-37595305 AAATGTTTCTTAAAGTGGCTGGG - Intronic
973833727 4:54788805-54788827 CACTGGTTCTTAACTTGGGAGGG - Intergenic
986320928 5:6632609-6632631 CAGTAATTCTTAAAGTGGCCGGG + Exonic
988518907 5:31928765-31928787 CAAGGGTTCTTTTCTTGGCCCGG - Intronic
989375595 5:40756710-40756732 CAGTGGTTCTCAACGGGGCAGGG - Intergenic
992573360 5:78083110-78083132 AATAGGTTCTCAACGTGGCCGGG - Intronic
1001724320 5:173884309-173884331 GAATGCTTATTAACGTTGCCAGG + Intergenic
1003378954 6:5605010-5605032 CAATGGTTCTTAACTTTGTCAGG - Intronic
1006132060 6:31875675-31875697 CAATGGTTCTTAACGTGGCCTGG + Intronic
1015676101 6:135751065-135751087 GAATGGTTCTTTCTGTGGCCTGG - Intergenic
1022546803 7:31197459-31197481 CAAGGGTTCTTAACCTGGGATGG + Intergenic
1022948874 7:35316550-35316572 AAATTCTTCTTAACTTGGCCAGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028865438 7:95706106-95706128 CAAGGGTTCTTAACCAGGCTGGG + Intergenic
1035292068 7:157845591-157845613 CAATGCTCCTTAACATTGCCTGG - Intronic
1036210677 8:6838134-6838156 AAATAGTTCAAAACGTGGCCGGG + Intergenic
1037628191 8:20627141-20627163 CAATGTTACTTAACATGGACAGG + Intergenic
1039892336 8:41694036-41694058 CAATGGGGCTGAATGTGGCCTGG + Exonic
1043409371 8:79976376-79976398 AAAAGGTTCTTAACAAGGCCGGG - Intronic
1048587894 8:135791861-135791883 CAAGGGTTGTGAACATGGCCTGG + Intergenic
1048820139 8:138372877-138372899 CATTGCTTCATAACGTGGACTGG - Intronic
1058807552 9:108606967-108606989 CACTGGTTCTTAACTGGGGCAGG - Intergenic
1191597934 X:62968011-62968033 CAAGGGTTCTTAAGCTGGCAAGG + Intergenic
1202021169 Y:20466510-20466532 CAATTCTTCTTAAAGTGCCCTGG + Intergenic