ID: 1006140750

View in Genome Browser
Species Human (GRCh38)
Location 6:31928132-31928154
Sequence CGCCTTAGACAGAGACCGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006140750_1006140757 15 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140757 6:31928170-31928192 GCTCCCTGTGGGCTTTGCTCAGG 0: 1
1: 0
2: 0
3: 38
4: 276
1006140750_1006140763 30 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140763 6:31928185-31928207 TGCTCAGGGTGCTACACCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 109
1006140750_1006140754 -7 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140754 6:31928148-31928170 TAAGGCGGTCTGCAAACGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1006140750_1006140756 4 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140756 6:31928159-31928181 GCAAACGTGAGGCTCCCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 78
1006140750_1006140762 29 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140762 6:31928184-31928206 TTGCTCAGGGTGCTACACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 91
1006140750_1006140755 3 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140755 6:31928158-31928180 TGCAAACGTGAGGCTCCCTGTGG 0: 1
1: 0
2: 2
3: 6
4: 122
1006140750_1006140761 28 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140761 6:31928183-31928205 TTTGCTCAGGGTGCTACACCAGG 0: 1
1: 0
2: 0
3: 6
4: 113
1006140750_1006140758 16 Left 1006140750 6:31928132-31928154 CCACCCGGTCTCTGTCTAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1006140758 6:31928171-31928193 CTCCCTGTGGGCTTTGCTCAGGG 0: 1
1: 0
2: 2
3: 29
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006140750 Original CRISPR CGCCTTAGACAGAGACCGGG TGG (reversed) Exonic
904472581 1:30745344-30745366 GGCCTTAGGCAGAGCCCGGGTGG - Intronic
905289266 1:36910483-36910505 CGCCTTAGCCAGACCCCTGGGGG + Intronic
916713214 1:167430385-167430407 TGCCTTAGACAGAGAGAGTGGGG - Intergenic
923146115 1:231199408-231199430 TCCCTTAGACAGAAACAGGGAGG - Intronic
923324133 1:232865801-232865823 AGCCTTAGATAGAGTCTGGGGGG - Intergenic
1069752966 10:70756528-70756550 AGGCATACACAGAGACCGGGTGG + Intronic
1078541570 11:12217550-12217572 CGCCTTAGTCTGAAACTGGGGGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1088481000 11:110296459-110296481 CGCCTTACCCGGAGAGCGGGCGG + Exonic
1089496459 11:118910629-118910651 CCCCTTCGGCAGAGCCCGGGCGG + Exonic
1103374735 12:120446779-120446801 CGCCGTGGACACAGACGGGGTGG + Exonic
1106386229 13:29288676-29288698 AGCCTTAGACAAAGACAAGGTGG - Intronic
1110822275 13:79930510-79930532 CCCGTTAGACAGAGACAGGGAGG + Intergenic
1111754509 13:92376117-92376139 CTCCATAGACAGAGCCCGGCTGG - Intronic
1118570097 14:67186298-67186320 CGTGTTAGACAGTGACTGGGTGG + Intergenic
1122294488 14:100697703-100697725 CGCCTTAGACAGGGGCTGCGGGG + Intergenic
1127621618 15:60739704-60739726 CTCCTAAGTCAGAGACTGGGAGG - Intronic
1127966151 15:63924318-63924340 GGCCTGAGACAGAGGCCTGGTGG - Intronic
1128739414 15:70073335-70073357 CGCCTGGGGCAGAGACCTGGAGG - Intronic
1130555967 15:84922714-84922736 CGCCTGAGACAGAGGCAGAGGGG - Intronic
1130926453 15:88389145-88389167 GGGCTTACACACAGACCGGGTGG + Intergenic
1136429013 16:30186329-30186351 AGACTGAGACAGAGACCGGCGGG + Intronic
1137724902 16:50650569-50650591 GGCCTAAGACAGAGACTTGGGGG + Intergenic
1141417332 16:83886128-83886150 TACCTGAGACAGAGAACGGGAGG + Intergenic
1146747698 17:35346543-35346565 CCCCTTAGACAGAGAAGGGAAGG - Intergenic
1148621232 17:49035992-49036014 TGCCTTAAACAGTGACCGGCTGG - Intronic
1161048755 19:2151126-2151148 CAACTAAGACAGAGCCCGGGCGG + Intronic
1165103014 19:33450080-33450102 CACCTAACACAGAGACCAGGTGG - Intronic
1165730773 19:38143289-38143311 CCCCTGAGACAGGGACCTGGGGG - Intronic
1167136749 19:47620943-47620965 GGCCGTAGACAGAGATCGAGTGG - Intronic
1167521939 19:49960419-49960441 GGGCTGGGACAGAGACCGGGTGG + Exonic
927215322 2:20665384-20665406 CGCGTCAGGGAGAGACCGGGGGG + Intergenic
930018532 2:46986908-46986930 AGGCTTAGCCAGAGACAGGGAGG - Intronic
935433663 2:103004755-103004777 TGCCTAAGACAGAGAGCAGGGGG + Intergenic
938231110 2:129660138-129660160 CCCTTAAGACAGAGACCTGGTGG - Intergenic
950216608 3:11164223-11164245 TGCCTTAGAGAGCGACAGGGAGG + Intronic
951252661 3:20412157-20412179 GGCCTTTGACAGACATCGGGTGG + Intergenic
951906939 3:27715307-27715329 CGCCTCAGACCGAGTCCGGGCGG + Intergenic
953043133 3:39272646-39272668 AGCCATAAACAGAGACCAGGAGG - Intronic
975698219 4:77035710-77035732 GGCCTTAGACAAAGAGCAGGTGG - Exonic
976869280 4:89771281-89771303 ACCCTTAGACAGAGACAGAGAGG + Intronic
996602715 5:125284737-125284759 AGAGTTAGACAGAGACAGGGTGG - Intergenic
999233379 5:150076104-150076126 CACCATAGCCAGAGACCTGGAGG + Intronic
1001484154 5:172107691-172107713 CGCTTTAGACAGAGAGGGGCCGG - Intronic
1006140750 6:31928132-31928154 CGCCTTAGACAGAGACCGGGTGG - Exonic
1022613247 7:31899017-31899039 CGCTTCAGACAGAGGCAGGGAGG - Intronic
1023318715 7:38970356-38970378 CCCCTTGAACACAGACCGGGAGG + Intergenic
1029554186 7:101256633-101256655 CACCTTAGAGAGAAACCAGGTGG + Intergenic
1034866871 7:154649544-154649566 TGCCATACACAGTGACCGGGCGG - Intronic
1038266495 8:26042888-26042910 TGCCTGGGACAGAGACAGGGCGG + Intronic
1039442306 8:37603470-37603492 GGCCTAAGACAGAGAAGGGGAGG + Intergenic
1049700134 8:144007128-144007150 AGCCAGGGACAGAGACCGGGAGG - Intronic
1053582395 9:39419071-39419093 GGCCTCAGACAGAGACAGAGGGG - Intergenic
1054103973 9:60977810-60977832 GGCCTCAGACAGAGACAGAGGGG - Intergenic
1054582375 9:66929036-66929058 GGCCTCAGACAGAGACAGAGGGG + Intronic
1059014014 9:110494249-110494271 GGCCAGAGACAGAGACGGGGAGG + Intronic
1186195916 X:7110242-7110264 CGCCTTAGACAGAAACTTAGAGG - Intronic
1187713387 X:22076794-22076816 GGCTTGAGACAGAGACTGGGAGG + Intronic
1198005523 X:132489489-132489511 CGCCTTTGGCAAAGGCCGGGCGG - Intronic