ID: 1006143166

View in Genome Browser
Species Human (GRCh38)
Location 6:31943202-31943224
Sequence CTGTGGGTGTGAGGATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 353}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006143166_1006143171 8 Left 1006143166 6:31943202-31943224 CCATCTGATCCTCACACCCACAG 0: 1
1: 1
2: 5
3: 34
4: 353
Right 1006143171 6:31943233-31943255 AAGCTCACAGACACCATCTGCGG 0: 1
1: 0
2: 3
3: 17
4: 197
1006143166_1006143176 15 Left 1006143166 6:31943202-31943224 CCATCTGATCCTCACACCCACAG 0: 1
1: 1
2: 5
3: 34
4: 353
Right 1006143176 6:31943240-31943262 CAGACACCATCTGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 167
1006143166_1006143173 10 Left 1006143166 6:31943202-31943224 CCATCTGATCCTCACACCCACAG 0: 1
1: 1
2: 5
3: 34
4: 353
Right 1006143173 6:31943235-31943257 GCTCACAGACACCATCTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1006143166_1006143174 13 Left 1006143166 6:31943202-31943224 CCATCTGATCCTCACACCCACAG 0: 1
1: 1
2: 5
3: 34
4: 353
Right 1006143174 6:31943238-31943260 CACAGACACCATCTGCGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1006143166_1006143175 14 Left 1006143166 6:31943202-31943224 CCATCTGATCCTCACACCCACAG 0: 1
1: 1
2: 5
3: 34
4: 353
Right 1006143175 6:31943239-31943261 ACAGACACCATCTGCGGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 103
1006143166_1006143172 9 Left 1006143166 6:31943202-31943224 CCATCTGATCCTCACACCCACAG 0: 1
1: 1
2: 5
3: 34
4: 353
Right 1006143172 6:31943234-31943256 AGCTCACAGACACCATCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006143166 Original CRISPR CTGTGGGTGTGAGGATCAGA TGG (reversed) Intronic
900189528 1:1347448-1347470 CGGTGGGTGTCAGGAGCAGAAGG + Intronic
901073226 1:6534435-6534457 CTGTGTGTGACAGGGTCAGAAGG + Intronic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902208442 1:14887033-14887055 GTGTGGTTGTGAGGATTAAATGG + Intronic
902631896 1:17709738-17709760 CTCTGGGTGTGAGGTTCAAGAGG + Intergenic
902785764 1:18731684-18731706 CTGGGGGTCTGTGGATCAAAGGG - Intronic
902917417 1:19646953-19646975 CTGTGGGAGCGAGGGGCAGAAGG + Intronic
903168539 1:21537994-21538016 GCGTTGGTGTGAGGACCAGATGG + Intronic
903267970 1:22169801-22169823 GTGGGGGTGTGATGAGCAGAGGG + Intergenic
903319980 1:22537178-22537200 CATTGGCTGTGAGGTTCAGAAGG + Intergenic
903578573 1:24354222-24354244 GGGTTGTTGTGAGGATCAGAGGG + Intronic
904913150 1:33950324-33950346 CATTGGGTGTGAGGAGGAGACGG - Intronic
905366536 1:37454708-37454730 CTGGGTGTGGGAAGATCAGAGGG - Intergenic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906509272 1:46401561-46401583 CTGTGGGTGTGGGGATGGCATGG + Intronic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
909517922 1:76533317-76533339 TTGTGGGAATGAGGAGCAGATGG - Intronic
911201714 1:95051122-95051144 CTATGAGTCTGAGGTTCAGAAGG - Intronic
911204719 1:95080616-95080638 CTGTGGGAGTGAGAAACAAAAGG + Intergenic
912684620 1:111752627-111752649 CCCTGGGTGTGAGGATCGGTGGG - Intronic
914195649 1:145446749-145446771 GTGTGGCTGTGAGGACCAGGTGG - Intergenic
915216430 1:154343567-154343589 ATGTGGGTGTGAGGAGAGGAGGG + Exonic
915250221 1:154582778-154582800 CTGTGGTTCTCAGCATCAGAAGG - Exonic
916206253 1:162318935-162318957 CTCTGGGTGTGATAATGAGAGGG - Intronic
918111072 1:181455964-181455986 CTGTGGGACTGAGGTTCGGATGG + Intronic
918247291 1:182671216-182671238 CTGTGGTTGAGAGCATCAAATGG - Intronic
919765432 1:201124360-201124382 CGATGGGTGTGTGGTTCAGAGGG - Intronic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
921570018 1:216766436-216766458 CTGGGGCTGTGAGAATGAGAGGG - Intronic
922182117 1:223243504-223243526 CTGAGGGTGGGTGGCTCAGAGGG + Intronic
924642393 1:245846640-245846662 CTCTGGCTGTGAGGATTAGAAGG + Intronic
1062902176 10:1154753-1154775 CTGTGGCTGTGAGGATGGGAGGG - Intergenic
1062945091 10:1454616-1454638 CTGTGGGTGTGAGGACTCTAGGG - Intronic
1062952140 10:1512483-1512505 CTGTTGCTTTGAGGATTAGATGG - Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065121400 10:22533900-22533922 CTGTGGTTGTGGGCATCAGAAGG + Intergenic
1068687785 10:59887347-59887369 ATGTGGGTGAGTGTATCAGAGGG - Intronic
1069117086 10:64520898-64520920 GTGTGTGTGTGTGGAACAGAGGG + Intergenic
1070300107 10:75197322-75197344 CTGCTGTTGTGAGGAGCAGAGGG - Intergenic
1070805860 10:79270312-79270334 CACTGGCTCTGAGGATCAGAAGG - Intronic
1071699390 10:87914050-87914072 CTGTGCCTGAGAAGATCAGATGG - Intronic
1072622396 10:97088774-97088796 CTGTGGGTGACAGGATCGCAGGG + Intronic
1072726935 10:97820060-97820082 CTGGGGGTGGGAGGCTGAGATGG + Intergenic
1073062146 10:100739392-100739414 GTGTGGATGTGAGGAGCAGGCGG - Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073207969 10:101778688-101778710 CTCTGGGGGAGAGGAGCAGATGG + Intronic
1073328182 10:102654620-102654642 ATTTGGGTGGGAGTATCAGAGGG - Intronic
1073943142 10:108720298-108720320 CTGTGGGTCTGAGGATGTGGAGG - Intergenic
1074913654 10:117935636-117935658 CTGTGTGTGTAAGGGACAGAGGG - Intergenic
1074948454 10:118304090-118304112 CTGTTGGAGTTAGCATCAGATGG - Exonic
1075267056 10:121009874-121009896 CTGTAGGTATCAGGACCAGATGG + Intergenic
1076493702 10:130882487-130882509 CTGTGGTTGTGAGGATGAGCTGG - Intergenic
1076820570 10:132936785-132936807 CTCAGGGTGTGGGGATCCGAAGG - Intronic
1078262939 11:9728133-9728155 CTATGTGAGTGAGGATCTGAAGG + Exonic
1079451508 11:20603001-20603023 CTGTGTGTGGGAGGATTAGAGGG + Intronic
1079884973 11:25976044-25976066 CTGTGGGGCTGAGGATTAGTGGG + Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080395440 11:31885855-31885877 CTGTGGGCTTGAGAATCAGTAGG - Intronic
1080685447 11:34511544-34511566 CTGTGGGAGTGAGGCAGAGATGG + Exonic
1081872178 11:46388220-46388242 CTGTGTGTGAGAGGAAGAGAGGG + Intergenic
1083743079 11:64721408-64721430 CTGTGGATCTGAGGATAGGATGG + Intronic
1084770411 11:71339469-71339491 GCGTGGGTGTGAGGAACAGGAGG - Intergenic
1085254139 11:75162903-75162925 GTGTGGCTGTGAGGATCAAAGGG + Intronic
1086511778 11:87566064-87566086 CTGAGGGGGTGTGGATCAGGAGG - Intergenic
1088553521 11:111038429-111038451 CTGTGGCAGTGATGATAAGAAGG - Intergenic
1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG + Intergenic
1091757631 12:3065206-3065228 CTGTGCATGTGAGGTTCAGCAGG + Intergenic
1091758756 12:3073422-3073444 GTGTTGTTGTGAGGATCAGTGGG + Intergenic
1092092738 12:5817061-5817083 TTGTGTGTGTGAGAATCTGAGGG - Intronic
1093549350 12:20389226-20389248 CTGTGTGTGTGAGGAGGAAAGGG + Intronic
1094226226 12:28049098-28049120 CAGTGGGAGTTTGGATCAGATGG + Intergenic
1096244364 12:49975922-49975944 CAGTGGGTGAGAGGATGGGAGGG - Exonic
1096657711 12:53102077-53102099 CTGCTGGTGTGTGGATCGGATGG + Exonic
1096780852 12:53991349-53991371 CTGAGAGGGAGAGGATCAGAGGG + Intronic
1098981991 12:76966278-76966300 CTGTTGCTGTGAGAATCAAAGGG + Intergenic
1099212928 12:79815294-79815316 CTTTGGGTGGGCGGATCACAAGG + Intronic
1100346656 12:93738275-93738297 CTGTGGGGATGAGGACCTGAAGG + Intronic
1101541262 12:105667579-105667601 CTGTGGGTGAGAGGCTCTGTGGG - Intergenic
1102385267 12:112503812-112503834 CTGTGGGTGCCAGGCTGAGAGGG - Intronic
1102401185 12:112630968-112630990 GGGCAGGTGTGAGGATCAGATGG + Intronic
1102759806 12:115375365-115375387 CTGTGGGTGACATGATAAGAAGG + Intergenic
1103736782 12:123065683-123065705 CTGTGGGTGTGAGGATGAGGAGG + Intronic
1103742104 12:123097837-123097859 CAGTGGGTATGAGGAACAGCTGG + Intronic
1103763167 12:123265690-123265712 CTGAGTGTGTGAGGATAGGAGGG - Intronic
1103799222 12:123526489-123526511 GGGTGGGTGTGAGGATTAAATGG + Intronic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1112427382 13:99315419-99315441 CAGTGAATGTGAGGCTCAGAGGG - Intronic
1113871935 13:113564982-113565004 CTGAGGGTGTGAGGATCTGATGG - Intergenic
1114063438 14:19039313-19039335 CTGAGATTGTGAGGATGAGAGGG - Intergenic
1114098818 14:19360683-19360705 CTGAGATTGTGAGGATGAGAGGG + Intergenic
1114251612 14:20966595-20966617 GTGGGGGTGTGTGGATGAGATGG - Intergenic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1119600076 14:75969885-75969907 CAGTGGATATGACGATCAGATGG - Intronic
1119855853 14:77900226-77900248 CTGTGGAAGTGGGCATCAGAAGG + Intronic
1120302270 14:82723171-82723193 CTGGGGGTGTGTGCATCAGTGGG + Intergenic
1121654965 14:95588424-95588446 GAGGGGGTGTGAGGATGAGAGGG + Intergenic
1122744765 14:103891198-103891220 CAGTGGGTGTGGGAACCAGAGGG - Intergenic
1122792510 14:104190245-104190267 CTGTGGGTTTGGGGATCTGGGGG + Intergenic
1123493113 15:20798865-20798887 CTGAGATTGTGAGGATGAGACGG + Intergenic
1123549619 15:21367967-21367989 CTGAGATTGTGAGGATGAGACGG + Intergenic
1123666482 15:22612591-22612613 CTGTGGTTGTGAGGATTAAATGG - Intergenic
1124235584 15:27986898-27986920 TTTTGTGTGTGAGGATCAGATGG - Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1126288242 15:47041409-47041431 CTGAGGATGTGAGGATAAGTGGG - Intergenic
1127013413 15:54655537-54655559 TTGGGGGTCTGGGGATCAGACGG - Intergenic
1127039919 15:54963276-54963298 CTGCGGGAGTGAGGTGCAGATGG - Intergenic
1129154829 15:73711215-73711237 CTGTGTGTGAGAGGCTGAGAGGG + Intronic
1129166452 15:73780927-73780949 CTCTGGGTGGGAGCATCAGAGGG + Intergenic
1129228732 15:74184749-74184771 CTGTGAGTGTGAGGGACATAGGG - Intronic
1129668221 15:77591653-77591675 GGGTTGTTGTGAGGATCAGATGG + Intergenic
1129749360 15:78049795-78049817 CTGTGGGAGGGAGGATGTGAGGG - Intronic
1130107744 15:80941779-80941801 CGGTGGGTGGGAGGAGAAGAGGG + Intronic
1130461420 15:84160199-84160221 CTCTGAGGGGGAGGATCAGAGGG - Intergenic
1131462785 15:92630469-92630491 CTGAGAGTGTGAGGATCTGATGG + Intronic
1132320433 15:100920852-100920874 CTGGGGGTGTGAGGAGAAGGAGG - Intronic
1202957950 15_KI270727v1_random:95185-95207 CTGAGATTGTGAGGATGAGACGG + Intergenic
1132713259 16:1278566-1278588 CGGTGGCTGTGAGTATCAGATGG - Intergenic
1133580287 16:7138172-7138194 CTTTGGGTGTGAGGATCAGATGG + Intronic
1134065542 16:11225811-11225833 ATGAGGATGTGAGGCTCAGAGGG - Intergenic
1135595028 16:23735264-23735286 GTGTGTGTGTGTGGTTCAGAAGG + Intergenic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138471430 16:57241140-57241162 CAGTGGGTTTGGGGATCCGATGG + Intergenic
1138552757 16:57756442-57756464 CTGTGGGTGTGGATATCAGCAGG + Exonic
1139532354 16:67548597-67548619 GGGTGGGTGTGAGGATCGGAAGG + Intergenic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139673644 16:68508696-68508718 CAGTGGGTGGGAGGACAAGATGG - Intergenic
1140587352 16:76309218-76309240 CTGCAGCTGTGAGGATGAGATGG + Intronic
1140733073 16:77873902-77873924 CTGTGGGTGGGAGGTGAAGATGG + Intronic
1141158068 16:81610635-81610657 GTGTGGGGGTGAGGATGAGAGGG - Intronic
1141643102 16:85352903-85352925 CTGTGTGTGTCAGAAACAGAGGG - Intergenic
1141969898 16:87474137-87474159 CTGTAGGTGTGAAGTTCAGTTGG - Intronic
1142114938 16:88351652-88351674 CTGTGGATCTGAGGTCCAGACGG + Intergenic
1143284760 17:5780912-5780934 CTGTGGGTTTGAGAGTCTGAAGG + Intronic
1143471035 17:7175892-7175914 CTGTGAGTGTGAGAATGAGATGG - Intronic
1143471049 17:7176073-7176095 GTGTGAGTGTGAGAATGAGAAGG - Intronic
1143471056 17:7176170-7176192 GTGTGAGTGTGAGAATGAGATGG - Intronic
1143471059 17:7176198-7176220 TTGTGAGTGTGAGAATGAGATGG - Intronic
1143471065 17:7176280-7176302 CTGTGAGTGTGAGAATGAGATGG - Intronic
1143471084 17:7176538-7176560 GTGTGTGTGTGAGAATGAGATGG - Intronic
1143471086 17:7176593-7176615 CTGTGAGTGTGAGAATGAGATGG - Intronic
1143471087 17:7176627-7176649 GTGTGGATGTGAGAATGAGAGGG - Intronic
1144621380 17:16820728-16820750 CTGTGGCCGTGAGGATCTGCAGG + Intergenic
1145876944 17:28326178-28326200 ATATAGGTGAGAGGATCAGAAGG - Intronic
1146019181 17:29261377-29261399 ATGTGTGTGTGAGGAAAAGATGG - Exonic
1146180886 17:30697622-30697644 CTGTGGGGTTGAGGATCCCAGGG - Intergenic
1147325620 17:39668142-39668164 TTGTGGGGGTGAGGAACTGAGGG + Exonic
1147327901 17:39678632-39678654 CTGTTGGGGTGAGGATAGGAAGG - Intronic
1147464075 17:40597311-40597333 CAGTGGTTGTGAGGAGCTGAGGG - Intergenic
1147573356 17:41585042-41585064 CTGTGGCTGTGAGAATCTGCAGG + Exonic
1147927879 17:43956419-43956441 GTGTGGGTGTGTGGATCGGGGGG - Intronic
1148150426 17:45393762-45393784 CTGTGGGAGGGAAGATGAGAGGG + Intergenic
1151164173 17:72189971-72189993 CTGTGGATGTGAGAGTCAGAGGG - Intergenic
1151186849 17:72371126-72371148 TTGTGGGTGGGAGGAGCGGATGG - Intergenic
1152112875 17:78366731-78366753 CAGAGGGTGAGAGGCTCAGAAGG - Intergenic
1152519324 17:80846091-80846113 CCGTGAGTGTGTGGATCAGCAGG - Intronic
1152531665 17:80922687-80922709 ATGGGGGTGTGAAGGTCAGACGG - Intronic
1155410331 18:25537178-25537200 CTGTGTGTGTGTGGCACAGAGGG + Intergenic
1155631337 18:27897058-27897080 CTATGGGGGTGAGGAGCAGGGGG + Intergenic
1156760890 18:40588863-40588885 ATGTGAGTGTGGGGATGAGATGG - Intergenic
1157604317 18:48916201-48916223 GAGTGGCTGTGAGGATCATATGG + Intergenic
1157691090 18:49682484-49682506 CGGTGGGAGTGAGGAACTGATGG + Intergenic
1158010514 18:52722391-52722413 CTGGGAGTCTGAGGATGAGAAGG - Intronic
1158894751 18:61902309-61902331 CTGTGAGAGTGAGGATAAGGAGG - Intergenic
1160047126 18:75397092-75397114 CTGGGGGTGAGAGGAAGAGACGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1161788073 19:6340572-6340594 CTGTGTGTGGGTGGAGCAGATGG + Intergenic
1162423784 19:10581691-10581713 CTGTGGGTGTAAGGAACTGGAGG - Intronic
1162977695 19:14217910-14217932 CTGTGGGGTTGAGGATCCCAGGG + Intergenic
1163375051 19:16924996-16925018 CTGTGGCTGTTAGGATGAGATGG - Intronic
1163528290 19:17834722-17834744 CTGAGGGTGAGAGGAGCAGTCGG + Intronic
1163545985 19:17941842-17941864 CTGAAGGTGTGAGAGTCAGATGG + Intronic
1163608465 19:18288585-18288607 CAGAGGGTTTGGGGATCAGAAGG + Intergenic
1163773983 19:19207204-19207226 TTGTGGGTGTGAGCAGCAGTGGG + Intergenic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164948110 19:32313080-32313102 TTGTGAGTTTGAGGATAAGACGG + Intergenic
1165950440 19:39471312-39471334 CTGTGGGGGTGAGAATGGGAAGG - Intronic
1166401087 19:42480770-42480792 GTCTGGGTGTGAGGATCTGATGG - Intergenic
1166571997 19:43802831-43802853 CTGAGGGTGTGTGGATGAGTGGG - Intronic
1166889471 19:45981718-45981740 ATGTGGGTGTGAGGAAGAAAGGG - Intergenic
1167537873 19:50066408-50066430 CTGTGGGTGCCAGAATCACAGGG + Intergenic
1167643476 19:50694405-50694427 GTGGGGATGTGGGGATCAGAGGG + Intronic
1168651990 19:58097652-58097674 CTGAGGGTGTGAGGATGTGAGGG - Intronic
925883181 2:8369879-8369901 CTGTGGGTGGGAGGAGGAAATGG - Intergenic
926922173 2:17949881-17949903 CTGTGGGTGGAATGATCAGTAGG + Intronic
928414799 2:31083264-31083286 CTTTAGCTGTGGGGATCAGAGGG + Intronic
928449248 2:31364306-31364328 AAGTGGGAGGGAGGATCAGAGGG - Intronic
929141391 2:38669639-38669661 CTCTGGGTGGGTGGATCACAAGG + Intronic
929567760 2:43000329-43000351 CTGTGAGTGTGCGCATCACATGG - Intergenic
929982212 2:46692140-46692162 CTTTGGGAGTGAGGATCAGAAGG - Intergenic
932264265 2:70353485-70353507 CAGTGGGGGTGAGGATGAGCTGG + Intergenic
937009605 2:118550807-118550829 CTGAGGGTGAGAGGGTGAGAGGG - Intergenic
937258096 2:120568873-120568895 CAGTGGGAGGGAGGCTCAGATGG - Intergenic
937866216 2:126753384-126753406 CTGTGTGTGTGAGGAAGGGAGGG + Intergenic
937939773 2:127275997-127276019 GTGTGAGTGTGAGGAGCAGTTGG + Intronic
938480779 2:131659477-131659499 CTGAGACTGTGAGGATGAGAGGG - Intergenic
938582417 2:132658780-132658802 CTGTGTGGGTGAGGACCAGGGGG + Intronic
940259170 2:151762820-151762842 CAGTTGCTGGGAGGATCAGATGG + Intergenic
940448102 2:153802555-153802577 ATGTGGTTGTAAGGATTAGATGG - Intergenic
940977732 2:159965056-159965078 CTGTGTATGTGTGGATCAGGTGG - Intronic
941618481 2:167750836-167750858 CTTTGAGTGAGAGGAACAGATGG - Intergenic
945862450 2:215139484-215139506 GGGTAGGTGTGAGGATCAAAGGG - Intergenic
946143261 2:217709804-217709826 CTGTGGATGTGAGCACCACAGGG - Intronic
946784217 2:223225437-223225459 CTGTGAGTGAGATGGTCAGATGG + Intergenic
948627734 2:239279556-239279578 CTGTCGGGGTGAGGAGCAGAAGG + Intronic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1171308435 20:24125944-24125966 CTGGGGGTGTGAGGAACAGCAGG - Intergenic
1171447208 20:25213334-25213356 CTGTGGCCTTGAGGACCAGAGGG - Exonic
1172091560 20:32436423-32436445 CTTTAGTTGTGAAGATCAGAAGG + Exonic
1173711348 20:45158342-45158364 CAGAGGGTGTTATGATCAGAGGG + Intergenic
1173946047 20:46951773-46951795 GTGTGGATTTCAGGATCAGATGG + Intronic
1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG + Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175369753 20:58480344-58480366 CTGAGGATGTGAGAAGCAGAAGG + Intronic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1176063314 20:63181639-63181661 CTGTGGGTGCCAGGAACAGTTGG + Intergenic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176383256 21:6124303-6124325 CTGTTGGTGGGAGGGTCAAATGG + Intergenic
1177724966 21:24955521-24955543 CTGAGCTTGTGAGGGTCAGAGGG - Intergenic
1178869096 21:36357491-36357513 CTTTGGGTGGGAGGATCACCTGG - Intronic
1179587883 21:42385226-42385248 CTGGGGGTGTGAGAACCTGAGGG - Intronic
1179740211 21:43413936-43413958 CTGTTGGTGGGAGGGTCAAATGG - Intergenic
1180054259 21:45349057-45349079 CTGTGGGTGTGAGGAACCAATGG + Intergenic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1180162566 21:46004809-46004831 CTGCGGGAGGGAGGAGCAGACGG - Exonic
1180229600 21:46418974-46418996 CAGTGGGCGTGAGCATGAGAGGG - Intronic
1180481932 22:15761947-15761969 CTGAGATTGTGAGGATGAGAGGG - Intergenic
1180717455 22:17881482-17881504 CTGTGGCTGTGCCTATCAGAAGG - Intronic
1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG + Intronic
1181705184 22:24645580-24645602 CTTGGGCTGTGAGGACCAGAAGG + Intergenic
1182468460 22:30532454-30532476 TTCTGGGTGTGAGGCTCAGGGGG + Intronic
1182821530 22:33220952-33220974 CTGTGGGAGTGAGAAAGAGAGGG - Intronic
1183104712 22:35607602-35607624 CAGTGGTTGTGGGGATCAAAGGG - Intronic
1183225702 22:36548615-36548637 CTGGGGGTGAGGTGATCAGATGG + Intergenic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1185110122 22:48896150-48896172 GTGTGGGAGTGAGGCTCAGGAGG + Intergenic
949938029 3:9132025-9132047 TTGTGGTTGTGAGGAGCAGTGGG - Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950502668 3:13374307-13374329 GTGTGCGTGTGAGGATAAGCTGG - Intronic
950553841 3:13683594-13683616 GTGTGGGTGTGAGGATGTGAGGG - Intergenic
951253315 3:20419203-20419225 ATGTGGGGGTGAGGATGTGACGG + Intergenic
952492773 3:33887897-33887919 CCGTGGATGTGTGGATAAGAGGG + Intergenic
952777692 3:37061796-37061818 CTGTGGGAGTGAGTAGCTGAGGG - Intronic
953435044 3:42871429-42871451 CTTTGGGTGTGAGGCACAAAAGG + Intronic
954451688 3:50575073-50575095 CTGGGGGTGTGAGACTCAGAGGG + Intronic
954930758 3:54279343-54279365 GTGTGGGAGTGAGGACCAAACGG + Intronic
955182446 3:56684317-56684339 CTGTTGCTGTGAGGATTAAATGG - Intergenic
956685437 3:71823028-71823050 GTGATGGTTTGAGGATCAGAAGG + Intergenic
958958323 3:100485629-100485651 TTGAGGGAGGGAGGATCAGAGGG + Intergenic
959858960 3:111195088-111195110 CTGTAGCTGTAAGGATCAAAGGG + Intronic
960140784 3:114150153-114150175 CTGTGAGTGTCAGGATCAGTGGG - Intronic
960907918 3:122620209-122620231 AGGTGGTTTTGAGGATCAGAAGG + Intronic
961574798 3:127825542-127825564 CTAGGGGAGTGAGGATGAGAGGG - Intergenic
961739626 3:129025001-129025023 CTGAGGGAGGGAGGAGCAGATGG + Intronic
961741213 3:129034158-129034180 CTGCAGGTGTGATGACCAGACGG + Exonic
962506397 3:136050674-136050696 CTGTGGGTGATAGGAGCAAAGGG - Intronic
967044986 3:185728190-185728212 GTGTGAGAGTGTGGATCAGAGGG - Intronic
967136185 3:186514809-186514831 GAATGGGTGTGAGGATGAGAAGG - Intergenic
967947595 3:194816509-194816531 GGGTGGCTGTGAGGATTAGAGGG - Intergenic
968645977 4:1740692-1740714 CAGTGGGTGTGAGCCTCGGAGGG - Intronic
968676223 4:1881892-1881914 GGGTGGGGGTGAGTATCAGATGG + Intronic
969909356 4:10429030-10429052 GTTTGGGTTTGAAGATCAGAAGG - Intergenic
970437344 4:16048410-16048432 ATGTGGATGTGAGGATTTGAAGG - Intronic
970805351 4:20024376-20024398 CTGTGGGTGTGGGGACCCCAAGG - Intergenic
971316723 4:25573837-25573859 GTGTGTGTGTGATGATCATAAGG + Intergenic
971756269 4:30712429-30712451 CTGTGGTTGTGAGACTCACAGGG + Intergenic
973210718 4:47612524-47612546 CAGTCGGTGTGAGGATCATTTGG - Intronic
977294899 4:95199296-95199318 GCGTGGGTGTGAGGAAGAGATGG + Intronic
979797265 4:124861716-124861738 GTGTGTGTGTGTGTATCAGATGG - Intergenic
982761624 4:159291270-159291292 CTGTGTGTGTGAGGATTGGGTGG + Intronic
983442905 4:167810128-167810150 CTGCGGGCATGAGGCTCAGATGG - Intergenic
985599498 5:819309-819331 CTGTGGGTGAGAGAGACAGACGG - Intronic
985638824 5:1053589-1053611 CTGTGTGAGTCAGGATCAGGCGG + Intronic
986553134 5:8981253-8981275 GTGTGGGTGTGCGGGTCAGTAGG - Intergenic
986685500 5:10272459-10272481 CTGTGGGTGGAGGGAGCAGAAGG - Intergenic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
987182591 5:15384151-15384173 CTGTGGGAGTGAGGCCCACAAGG - Intergenic
988716148 5:33830110-33830132 CTGTGGGCATGAGGCTCTGATGG + Intronic
992379666 5:76224791-76224813 CTGTGCTTGTGAAGAACAGATGG - Intronic
992444262 5:76819867-76819889 CTGTGGGTGCCAGGAGCAGCGGG - Intronic
992645948 5:78811030-78811052 CTGTAGGTGTGATGAACTGAAGG + Intronic
992988178 5:82255105-82255127 CTGTGGGGTTGAGAAGCAGAGGG - Exonic
993668436 5:90730098-90730120 CTTTGGGTGGGCGGATCACAAGG - Intronic
995245570 5:109931556-109931578 CTGTGGCTGGGGGCATCAGATGG + Intergenic
995778789 5:115754229-115754251 CTGAGGGTTTGAGGATCATTCGG + Intergenic
997387721 5:133486764-133486786 CGGTGGGTGGGCGGAGCAGAAGG + Intronic
997431579 5:133844570-133844592 CTGAGGGTAGGAGGATCAGTTGG + Intergenic
997898493 5:137741570-137741592 CTATGGGTGTGAGGAAGAGCCGG - Intergenic
1000937277 5:167317806-167317828 GTGTGGGTGTGAGTGTCTGAGGG + Intronic
1001218938 5:169882824-169882846 CCCTGGGTGTCAGGAGCAGACGG - Exonic
1002869362 6:1152192-1152214 TTGTGTGTGTGAGAATCAGAGGG + Intergenic
1003411013 6:5863030-5863052 CTGTCTCTGTGAGGAGCAGAGGG + Intergenic
1004093051 6:12524967-12524989 CACTGGGTGTAAGGCTCAGAAGG - Intergenic
1004782258 6:18922391-18922413 ATGTTGTTGTGAGGATCAAATGG - Intergenic
1005347402 6:24904114-24904136 CTGTGTGTATGAGTTTCAGATGG + Intronic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006463131 6:34175558-34175580 CTGTGGGGGAGATGATCAGTGGG + Intergenic
1006830395 6:36964609-36964631 CTGGGGGTGGGAGGATTTGAGGG + Exonic
1007176931 6:39903400-39903422 CAGTGGATGGGAGGACCAGAAGG - Exonic
1007345143 6:41223479-41223501 CTGTGCATGTGAGGAGCAGGAGG - Intergenic
1010379376 6:75207664-75207686 CTCTGGTTGTGAGGATTTGAAGG - Intergenic
1010709951 6:79162202-79162224 CAGCTGCTGTGAGGATCAGAGGG - Intergenic
1010731595 6:79396987-79397009 CTGTGTGTGTAAGGAGAAGAGGG + Intergenic
1012742338 6:103033949-103033971 CTGAGAGTGAGAGGATTAGATGG + Intergenic
1013184834 6:107748764-107748786 CTGTGGCTGTGAGAAACACAGGG + Intronic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1016212438 6:141554573-141554595 CTGTAGGTGGGAGGATCACGAGG - Intergenic
1017061543 6:150489754-150489776 ATGTGGGTTTCTGGATCAGAGGG + Intergenic
1018668829 6:166163216-166163238 CTGTGGGTGGCAGGAGGAGAAGG - Intronic
1018706944 6:166470245-166470267 CTGTGAGTGTGAGCACCAGGTGG + Intronic
1018850938 6:167589639-167589661 CTGTGGGGGTGAAGATGTGAAGG - Intergenic
1019020367 6:168912904-168912926 GTGAGGGTGTGAGGAGCAGCTGG - Intergenic
1019055061 6:169218023-169218045 CGGTGGGTGGGTGGATGAGATGG + Intronic
1019123745 6:169825492-169825514 CTGTGGGTGTCCGGACCCGATGG - Intergenic
1019278923 7:190702-190724 CTCTGGGGGTGAGGATGGGAGGG + Intergenic
1019512661 7:1425866-1425888 CTGTGGGTGTGAGGTCCAGGGGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1022111634 7:27235819-27235841 CTGTGCGGGTGAGTTTCAGAGGG - Intergenic
1022294634 7:29038631-29038653 CTGTGTGTGTGAGGATACCAGGG - Intronic
1022400311 7:30029816-30029838 GTGTGTGTGGGAGGATCAGTTGG + Intronic
1023904366 7:44512027-44512049 CTGTTGCTTTGAGGCTCAGAGGG - Intergenic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1025083601 7:56004945-56004967 GTGTCGGTGTGAGGGTCAGTGGG + Intergenic
1025120488 7:56297529-56297551 GTCTGTGTGTGAGGATCAGTGGG - Intergenic
1026132029 7:67628838-67628860 CTGTGGGTTTGAAGATGAAAAGG + Intergenic
1027530365 7:79323471-79323493 CAGTGGGTGTGAAGACCAGCTGG + Intronic
1027969087 7:85054519-85054541 CTGGGGGTGAGGGGATCAGTGGG + Intronic
1028239278 7:88399432-88399454 CTGTGGGTTTGAGGGGCTGAGGG + Intergenic
1029324004 7:99790247-99790269 CTGTGGGTGATAGGAGCAGTTGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1035072245 7:156154076-156154098 CTGTGGGTGCCAGGTTCCGAGGG + Intergenic
1035259758 7:157653871-157653893 GGGTGGGTGTGGGGATCAGCGGG - Intronic
1036037228 8:5032376-5032398 CTGTGGGCTGGAGGACCAGAGGG + Intergenic
1036698648 8:10996248-10996270 CTGGGGGTGTGTGGAACAGTGGG + Intronic
1038562212 8:28590262-28590284 CTGTGGGTGACAGGAGCAGGGGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1040521221 8:48177480-48177502 CTCCGCGTGTGAGGAGCAGACGG - Intergenic
1040713409 8:50217846-50217868 CTGTGGATGTGAGGATGAGGAGG + Intronic
1041267621 8:56080440-56080462 CAGTTGATGTGAGGATCAAATGG - Intergenic
1043607731 8:82023259-82023281 ATGTGGAAGAGAGGATCAGATGG + Intergenic
1043672311 8:82902777-82902799 GTGTGGGTGTGAGGATGTAATGG - Intergenic
1044291369 8:90474662-90474684 CTGTGGTTGTCAAGATCACATGG - Intergenic
1045000673 8:97875355-97875377 CTGTTGGTGGAAGGATCTGAGGG + Intronic
1046315282 8:112492962-112492984 CTGTGAATGTTAGTATCAGAAGG + Intronic
1047816915 8:128474334-128474356 CTGTGGGTGGAAGGAGCAGAGGG - Intergenic
1047924049 8:129665464-129665486 AAGTGTGTGTGAGGAACAGAAGG + Intergenic
1048337324 8:133512737-133512759 CTGAGTGTGAGAGGGTCAGATGG - Intronic
1048874426 8:138826140-138826162 CCGTTGGTGGGAGAATCAGATGG - Intronic
1049839809 8:144763680-144763702 CTGTGGGGGTAAGGAGGAGAAGG + Intergenic
1050036909 9:1445780-1445802 GGGTGGGGGTGAGGAACAGAGGG + Intergenic
1050072314 9:1828248-1828270 CTGTGGTTCTGAGGATGAAATGG - Intergenic
1052797448 9:32936487-32936509 CTGTGGGTGTGCGAGTCAGTTGG + Intergenic
1054785346 9:69204737-69204759 GTGTGTGTGTGTGTATCAGAGGG + Intronic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1058351443 9:104029253-104029275 CTGTGAGTGGGAGTATAAGAAGG - Intergenic
1059581182 9:115550240-115550262 CTGTGGTTGTGAGAAAGAGATGG - Intergenic
1059960744 9:119562210-119562232 GTGTGTGTGTGATGATCTGATGG + Intergenic
1060269927 9:122133036-122133058 GAGTGGTTGTGAGGATTAGATGG - Intergenic
1061303643 9:129720573-129720595 CTGTGGGTGGGAGGGTGAGCAGG - Intronic
1061671033 9:132188269-132188291 CTGAGGGGCTGAGGATGAGAAGG + Intronic
1062304858 9:135899776-135899798 CTAGGTGTGTGAGAATCAGATGG - Intronic
1062309117 9:135926482-135926504 CAGAGGGTGTGAGGATCTGCGGG + Intergenic
1062562414 9:137147574-137147596 CTGTGGGTGTCAGCATGGGAGGG - Intronic
1062564597 9:137158598-137158620 CTGGGGGTGGGAGTATGAGATGG - Intronic
1062699017 9:137889601-137889623 GTGTGGCTGTGAGGACCAGGTGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187424962 X:19168992-19169014 ATGTGGGTTTGAGAGTCAGAGGG - Intergenic
1189020098 X:37326726-37326748 GTGAGGGGGTGAGGATGAGATGG + Intergenic
1189337661 X:40180109-40180131 CAGTGGGTGGAATGATCAGATGG - Intergenic
1190372606 X:49757371-49757393 CTGTGATTGTGTGGATCTGATGG + Intergenic
1190605563 X:52139081-52139103 CTGTGGCTGTGAGGGTCATCTGG - Intergenic
1192259297 X:69494754-69494776 ATGTGGGTGGGGGGATTAGAGGG - Intergenic
1192341065 X:70263728-70263750 ATGGGGGTGGGAGGATCAGGAGG - Intergenic
1192448054 X:71224943-71224965 ATGTGGGTAAGAGGAGCAGAGGG + Exonic
1193360833 X:80576679-80576701 CTGGGGGTGAGTGGATCACAAGG + Intergenic
1193509972 X:82387737-82387759 TTCTGGGTGTGAGTAGCAGAGGG + Intergenic
1196030746 X:111093309-111093331 TGGTTGTTGTGAGGATCAGATGG + Intronic
1198112688 X:133515460-133515482 CTGTGGGTGTGAGTATTAGAAGG - Intergenic
1198367033 X:135951465-135951487 CTGTGGGAGAGAGCAGCAGAGGG + Intergenic
1198928109 X:141822291-141822313 CTGTGGATGGGAGGAAGAGAAGG + Intergenic
1199684261 X:150252234-150252256 GTGTGTGTGTGAGGCCCAGAGGG + Intergenic
1199983948 X:152937061-152937083 CTGTGGGTGTGTGGAGCATTTGG + Intronic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1201470960 Y:14334529-14334551 CTGTAGGTGTGGGGAAAAGAAGG - Intergenic
1201476175 Y:14383860-14383882 TTGCGGGTGTGAGGAGGAGATGG - Intergenic
1202377839 Y:24254935-24254957 CTCTGAGGGGGAGGATCAGAGGG + Intergenic
1202492943 Y:25415186-25415208 CTCTGAGGGGGAGGATCAGAGGG - Intergenic