ID: 1006144212

View in Genome Browser
Species Human (GRCh38)
Location 6:31948583-31948605
Sequence CTACCTTGAGGGCGACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006144212 Original CRISPR CTACCTTGAGGGCGACAGGG AGG Intronic
901155395 1:7134047-7134069 CTACCTGGGGGGAGTCAGGGAGG - Intronic
906480492 1:46196363-46196385 CTACCTTGAGGGGTTCAGTGTGG - Intronic
915319181 1:155046945-155046967 TGACCTTGAGGAGGACAGGGAGG - Intronic
915941404 1:160120771-160120793 CTGCCTTGGGGGAGATAGGGGGG - Intronic
919490780 1:198202747-198202769 CTACCATGAGAGCAACATGGGGG + Intronic
922915416 1:229253204-229253226 CTGCCTGGAGGGCGAGAGGGCGG - Intergenic
1066265630 10:33773662-33773684 TTACCTTAAGGGAGGCAGGGAGG - Intergenic
1069421512 10:68250830-68250852 CTAGCCTGAGGGAGACATGGAGG - Intergenic
1070748146 10:78947571-78947593 CAACCTTGAGGGTGTCAGGCTGG + Intergenic
1076720179 10:132389030-132389052 CTTCCTTGAGGGAGCCAGGAGGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1083694608 11:64434251-64434273 CTGCCTTGAGTGCCCCAGGGTGG - Intergenic
1084086651 11:66858047-66858069 CCACCTTGACGGCAACAGGCTGG + Exonic
1084394639 11:68901125-68901147 CTACCTAGAGGTCCACATGGCGG + Intronic
1088762511 11:112945768-112945790 CTACCTTTAAGGAGGCAGGGAGG - Intergenic
1095975925 12:47941212-47941234 CTAGATTGGGGGTGACAGGGGGG + Intronic
1097189514 12:57212771-57212793 CTGCCTTCAGGGAGACAGGCAGG + Exonic
1100613832 12:96215363-96215385 CCACCTTGTGGCCGACAGGAAGG + Intronic
1107727958 13:43318962-43318984 CAACCTGGAGGGAGAGAGGGAGG + Intronic
1112483227 13:99796233-99796255 CAACTTTGAGGGCCACAGGTGGG + Intronic
1118321805 14:64757766-64757788 CTCCCTGGAGGGGGACAAGGAGG + Intronic
1119323028 14:73742708-73742730 CTTCGGTGAGGGTGACAGGGAGG - Intronic
1121542075 14:94735690-94735712 CTACCTTGAAGGCGTCATGCTGG + Intergenic
1121756402 14:96406331-96406353 TTTCCTTGAGGGGGAGAGGGTGG - Intronic
1123427479 15:20184073-20184095 CTTCCTTGTGGGCTTCAGGGAGG - Intergenic
1123536715 15:21190623-21190645 CTTCCTTGTGGGCTTCAGGGAGG - Intergenic
1134524309 16:14932552-14932574 GTACCTGGAGGGCAAGAGGGAGG - Intronic
1134548594 16:15128386-15128408 GTACCTGGAGGGCAAGAGGGAGG + Intronic
1134711898 16:16331039-16331061 GTACCTGGAGGGCAAGAGGGAGG - Intergenic
1134719754 16:16374332-16374354 GTACCTGGAGGGCAAGAGGGAGG - Intergenic
1134947672 16:18337553-18337575 GTACCTGGAGGGCAAGAGGGAGG + Intergenic
1134954930 16:18377655-18377677 GTACCTGGAGGGCAAGAGGGAGG + Intergenic
1136849551 16:33602549-33602571 CTCCCTTGGGGTCCACAGGGTGG + Intergenic
1141957578 16:87383214-87383236 CCACGTTGAGGGGGCCAGGGAGG - Intronic
1203111260 16_KI270728v1_random:1451202-1451224 CTCCCTTGGGGTCCACAGGGTGG + Intergenic
1143583094 17:7837681-7837703 CTACCTTGAAGGCCGCTGGGAGG + Intergenic
1147042070 17:37726961-37726983 CTACCTTGAGGAGGAGAGGAGGG - Intronic
1147449923 17:40497801-40497823 CAACCCTGAGGGCAACAGGGAGG + Intronic
1148327255 17:46790448-46790470 CAACCTTGAGGGAGGGAGGGAGG - Intronic
1165031203 19:32999321-32999343 CTCCCTTGGGGTCCACAGGGTGG - Intronic
1165286757 19:34849133-34849155 GTACTTTGAGGGAGATAGGGTGG + Intergenic
1165332813 19:35150791-35150813 CTACCTTGAGGGCAATGGGCGGG + Intronic
1166060278 19:40321494-40321516 CTTAGTTGAGGGGGACAGGGAGG + Exonic
925725393 2:6866027-6866049 CTACCTTGGGGCCGACGGCGCGG - Intronic
928238807 2:29568959-29568981 TTACCTTGGGTGGGACAGGGCGG + Intronic
928367213 2:30712027-30712049 CCACCTTGAGGGAGAGAGTGTGG - Intergenic
932793171 2:74673438-74673460 CCCCCTGCAGGGCGACAGGGAGG - Exonic
946238406 2:218339764-218339786 GTACCTAGAGGGCGAGTGGGTGG - Exonic
947572171 2:231244791-231244813 CCACCATGAGGGCGGCATGGAGG + Intronic
947714667 2:232333561-232333583 CCACCTTGAGGGCATCTGGGAGG + Intronic
947846085 2:233244766-233244788 CTACCTTAAGGGAAAAAGGGGGG - Intronic
1170412195 20:16103929-16103951 CTACCTTGAAGGCCACAGCCAGG + Intergenic
1172697605 20:36833298-36833320 CTACCTTGAGGGTAGCTGGGAGG - Intronic
1173322901 20:42005298-42005320 CTTCCTTGAGGGAGGCAGGCTGG + Intergenic
1175013463 20:55763925-55763947 CTATCATGAGAGCAACAGGGAGG + Intergenic
1175135608 20:56821329-56821351 TTACCCAGAGGGCGACAGGGAGG + Intergenic
1179028677 21:37701289-37701311 GAACCTTGAAGGAGACAGGGAGG + Intronic
1180183247 21:46127251-46127273 CGACCTGGAGGACCACAGGGAGG + Intronic
1183649916 22:39147980-39148002 CTACTGTGAGGGTGAGAGGGTGG - Intronic
950013035 3:9736846-9736868 CTTCCTTGAGGGGGAGAGAGAGG + Intronic
950548240 3:13651755-13651777 CTCCCCTGAGGGAGACAGGCGGG + Intergenic
950692576 3:14671928-14671950 CGAGCATGGGGGCGACAGGGAGG - Exonic
950718162 3:14864242-14864264 CTACCTTGTGGGTGACACTGGGG - Exonic
953126094 3:40093039-40093061 CTTCCTTGAGGTTAACAGGGAGG - Intronic
953928329 3:46993595-46993617 CTAGCTTTAGGGAGACAGGTTGG + Intronic
955060182 3:55486976-55486998 CTACCTTCATGGCGAGGGGGAGG + Exonic
958896671 3:99837223-99837245 ATTCCTTTAGGGCAACAGGGAGG - Intronic
962648391 3:137463243-137463265 ACACCTTGAGGGGAACAGGGAGG + Intergenic
963947890 3:151166487-151166509 CTACCTAGAGAGAGAAAGGGGGG + Intronic
975120143 4:70719295-70719317 CTACCTGGAGAGAGGCAGGGTGG + Intronic
975811140 4:78171253-78171275 CCACCCTGAGAGGGACAGGGAGG - Intronic
985493602 5:192895-192917 CTCCCTCGAGGGAGACTGGGAGG - Intronic
998445024 5:142191813-142191835 TCACCTTGAGGGTGGCAGGGTGG + Intergenic
1002109032 5:176895631-176895653 CTACATTGAGGGAGACATGCAGG + Intronic
1005964451 6:30717153-30717175 GTACCTTGGGTGCGACTGGGCGG - Intronic
1006052652 6:31356218-31356240 CTACCTGGAGGGCGAGTGCGTGG - Exonic
1006144212 6:31948583-31948605 CTACCTTGAGGGCGACAGGGAGG + Intronic
1013635388 6:112024508-112024530 CTGCTTTGAGTGCAACAGGGAGG - Intergenic
1014203336 6:118627941-118627963 CTAACTTGAGTGGGACAGGATGG - Intronic
1017739716 6:157396067-157396089 ATATCTAGAGGGAGACAGGGAGG - Intronic
1020729970 7:11868405-11868427 CTACCATGAGGACAACATGGGGG - Intergenic
1024093868 7:45969052-45969074 CTTCCTCGAGGCCGGCAGGGCGG + Intergenic
1025030849 7:55555491-55555513 CTACCATGAGGGACACAGTGGGG + Intronic
1033163610 7:139018864-139018886 CTACCCTGTGTTCGACAGGGTGG - Intergenic
1033471841 7:141657106-141657128 TTACATTTAAGGCGACAGGGAGG + Exonic
1034340602 7:150352027-150352049 CTAACTGGAGGACTACAGGGAGG + Intergenic
1035373664 7:158394343-158394365 CTGCTTTCAGGGCCACAGGGAGG + Intronic
1036386171 8:8283734-8283756 CTATCTTGAAGGTGACAGTGGGG + Intergenic
1045205496 8:100035528-100035550 CAACCTTGTGGGGGACAGTGTGG + Intronic
1047998330 8:130357678-130357700 CTACCTCGAGGGTTACAGGAGGG + Intronic
1049530407 8:143151693-143151715 TCCCCTTGAGGGAGACAGGGAGG - Intergenic
1049642074 8:143720301-143720323 CTTCGGTGAGGGTGACAGGGTGG + Intronic
1054835607 9:69672393-69672415 CTAGCTGGAGGGCGGGAGGGAGG - Intergenic
1060974051 9:127754583-127754605 CCACCTAGAGGGCGGGAGGGTGG + Intronic
1061638953 9:131936354-131936376 CCACCTCGAGGGCCACAGTGAGG + Intronic
1061957217 9:133969962-133969984 CTGCCTTGAAGGCTGCAGGGAGG - Intronic
1186509140 X:10117435-10117457 CGAGCTTGGGGGCGACAGCGAGG - Exonic
1189763361 X:44344505-44344527 CAACCTTTAGGGCTTCAGGGAGG - Intergenic
1189877652 X:45453563-45453585 TTACCTGGATGGCTACAGGGAGG + Intergenic
1190109147 X:47578739-47578761 CTACCTTGTCAGCGAGAGGGAGG - Intronic