ID: 1006147661

View in Genome Browser
Species Human (GRCh38)
Location 6:31969068-31969090
Sequence GCTCCCAAACACCCTCAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006147660_1006147661 -3 Left 1006147660 6:31969048-31969070 CCTGGGGACGCTGGGGATCAGCT 0: 1
1: 0
2: 4
3: 18
4: 149
Right 1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 132
1006147653_1006147661 13 Left 1006147653 6:31969032-31969054 CCTGGTCTGCCAGAGCCCTGGGG 0: 1
1: 0
2: 1
3: 41
4: 408
Right 1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 132
1006147657_1006147661 4 Left 1006147657 6:31969041-31969063 CCAGAGCCCTGGGGACGCTGGGG 0: 1
1: 0
2: 3
3: 75
4: 471
Right 1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 132
1006147659_1006147661 -2 Left 1006147659 6:31969047-31969069 CCCTGGGGACGCTGGGGATCAGC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 132
1006147650_1006147661 26 Left 1006147650 6:31969019-31969041 CCTTGCTCTCTGGCCTGGTCTGC 0: 1
1: 0
2: 2
3: 41
4: 439
Right 1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006147661 Original CRISPR GCTCCCAAACACCCTCAAGC AGG Exonic
900787384 1:4657220-4657242 CCTCTCAAGCATCCTCAAGCCGG + Intronic
901151780 1:7108123-7108145 GCTCGCTAACTCCCTCATGCAGG - Intronic
903193180 1:21668132-21668154 TCCCCCAAACACCCTCAGGAAGG + Intronic
903320551 1:22540634-22540656 CCTCCCAGGCATCCTCAAGCAGG - Intergenic
905693679 1:39960218-39960240 GCCCCCCCACACCCTGAAGCAGG - Intronic
909577106 1:77187145-77187167 GTTCCCCATCATCCTCAAGCAGG + Intronic
910327293 1:86025273-86025295 TATCCCAAACACCCTCAACAAGG - Intronic
911932120 1:103917953-103917975 GCTGCCAAGCACTCTCAAGAAGG + Intergenic
913176616 1:116278546-116278568 GCTACCAAACACTGTCAAGTTGG + Intergenic
915081899 1:153358364-153358386 GCACCCAGACACCCTGAACCAGG + Exonic
915148422 1:153809524-153809546 GCCCCCAAACACCCACAGGTAGG + Exonic
915291272 1:154885365-154885387 GATCCCCAACATCCTCAAACAGG + Intergenic
915695808 1:157740094-157740116 GCTCCCCATCACCCTCCAGCAGG - Intergenic
1063202008 10:3793078-3793100 ACACCCAAACACCCTCCACCGGG - Intergenic
1064751837 10:18538209-18538231 GCTCACAGGCATCCTCAAGCTGG - Exonic
1068680204 10:59811058-59811080 GCTCCCCAACAACCTCCAGAAGG + Intronic
1072543613 10:96417196-96417218 GGTCACAAAGACCCTAAAGCTGG - Intronic
1074159899 10:110828952-110828974 GCTACCACAGACCCTGAAGCAGG - Intronic
1074263747 10:111880546-111880568 ACTCCCAAGCATCCTCAAGCTGG + Intergenic
1076737722 10:132466183-132466205 GCTCCTGAACACCCTCCAGCTGG - Intergenic
1077316344 11:1921004-1921026 GTGCCCCAACACCCTCAGGCAGG - Intronic
1081131547 11:39387088-39387110 GCCCCAAAAAACCCTAAAGCAGG - Intergenic
1089660428 11:119981922-119981944 GCTTCCAAGAACCCTCAAGAAGG - Intergenic
1091029744 11:132175027-132175049 GCTGCTAAACTCCCTCCAGCAGG - Intronic
1091994658 12:4983744-4983766 TCTCCCAAGCACCCTCTATCAGG - Intergenic
1092018002 12:5175515-5175537 GCAACTAAACACCCTCAATCTGG - Intergenic
1093143043 12:15532557-15532579 ACTTTCAAACACCCTCAAGGGGG + Intronic
1093960598 12:25269018-25269040 CCTCTCAAACCACCTCAAGCTGG + Intergenic
1095488371 12:42707667-42707689 TCTCCCAAACAACTTCCAGCAGG + Intergenic
1104906270 12:132215075-132215097 CCTCCCAAACGCCCTTAAACGGG - Intronic
1110012918 13:70361952-70361974 GGTTCCACACACCCTCAAGGAGG - Intergenic
1110987676 13:81992075-81992097 GCCCCCAAACACCTTCTACCAGG + Intergenic
1114225490 14:20734244-20734266 TCACCCAATCACCCTCCAGCTGG - Intronic
1114568565 14:23649801-23649823 GCTCCCAGACACTTCCAAGCCGG - Intergenic
1115798838 14:36969598-36969620 GCTCCCAAACAGGCTGAGGCGGG - Intronic
1119048540 14:71343150-71343172 GCTTTCAAACACTCTTAAGCAGG - Intronic
1120553373 14:85899417-85899439 GTTCTCAAACACCCTCAGGGGGG + Intergenic
1122127298 14:99586251-99586273 TCTCCCAAGCACCAGCAAGCAGG + Intronic
1122231493 14:100308230-100308252 CCTCCCAAACCTCCTCAACCAGG - Intergenic
1202902981 14_GL000194v1_random:53859-53881 ACCCCCCAACACCCCCAAGCTGG - Intergenic
1127583826 15:60362826-60362848 GCTCCCACATACCCTCTAGGAGG - Intronic
1129176283 15:73841911-73841933 GCTCCTAGTCACCCTCACGCTGG + Intergenic
1134304641 16:13021184-13021206 GCCACCAAACACCCTGAAGGAGG - Intronic
1136103471 16:28012058-28012080 ACTCCCTGACACCCCCAAGCAGG + Intronic
1138431740 16:56973254-56973276 CCTCCCAATCTCCCTGAAGCTGG + Intronic
1141994370 16:87627327-87627349 GCGCCAAGACCCCCTCAAGCTGG - Intronic
1142136473 16:88453914-88453936 GCCCCCAAACACCCTCCTCCCGG - Intronic
1144178515 17:12731148-12731170 GCTCCCAGCCAGCCTCATGCTGG + Intronic
1144587314 17:16495043-16495065 CCAACCACACACCCTCAAGCAGG - Intergenic
1144662169 17:17078177-17078199 ACTCCCAAACAGACACAAGCAGG - Intronic
1144779663 17:17801433-17801455 GGCCCCAACCACCCTCAGGCAGG - Intronic
1147430339 17:40366923-40366945 GTTCCCCAACACACACAAGCAGG - Intergenic
1150956531 17:69866363-69866385 GCCCCCAAAATCACTCAAGCTGG + Intergenic
1152461321 17:80443911-80443933 GCTGCCAATCACCCCCAAGTAGG - Intergenic
1161638591 19:5405333-5405355 GCCCCCAAACACCTGGAAGCAGG + Intergenic
1161957381 19:7504122-7504144 GGGCCCCAACACCCTCAAGTGGG + Exonic
1162458383 19:10799490-10799512 CACCCCAAACACCCTCCAGCAGG - Intronic
1162751993 19:12834613-12834635 GCTCCCGCCCACCCACAAGCTGG - Intronic
1165116775 19:33533439-33533461 GCTCCCAGAGACCCTGAGGCTGG + Intergenic
1165285430 19:34838125-34838147 GCTTCCAGACACTCTCAAGAAGG - Intergenic
1165923788 19:39314757-39314779 GAACCTAAACACCCTCACGCTGG - Exonic
1166381245 19:42356393-42356415 GCCCCCAAACATCCACAAGGTGG - Exonic
1167298373 19:48664678-48664700 GCTCACAAACACCCCCACTCCGG + Exonic
927937458 2:27083755-27083777 GTTCACAGACACCCTCAAGACGG - Exonic
929393600 2:41497883-41497905 CCTCCCTAACACCATCAAGATGG + Intergenic
930247085 2:48995222-48995244 ACTCCCAAACTCCCTGAAACCGG - Intronic
935112503 2:100105441-100105463 GGTCCCACCCACCCTCTAGCTGG + Intronic
935473898 2:103494336-103494358 CCTCCCACAGCCCCTCAAGCTGG - Intergenic
935739083 2:106130805-106130827 GGTCCCCAACACCCTGAAGCAGG + Intronic
937801212 2:126082385-126082407 GCTTCCAAACACCTCCAAACAGG + Intergenic
945804905 2:214478673-214478695 GATCCAAAACAACCTCAAACTGG + Intronic
946231756 2:218295725-218295747 CCTCCCAAACTCCCTCTAGGTGG - Intronic
946387727 2:219395357-219395379 GCTCCCTAACAACCTCTACCTGG + Intronic
947733772 2:232444604-232444626 CCTCCCAAATGCCCTCAAGGTGG - Intergenic
948503992 2:238415568-238415590 GCCCACACACACCCTCCAGCCGG - Intergenic
948862344 2:240758725-240758747 CCTCCCAAACTCCCTCCAGGGGG + Intronic
1171121987 20:22576409-22576431 CCTCCCAAACACCATGAACCTGG - Intergenic
1171249980 20:23639482-23639504 CCTCCCACACACCCTAATGCTGG - Intergenic
1172462295 20:35128670-35128692 GCCCCCAAAGACCTTCTAGCAGG + Intronic
1172933431 20:38601812-38601834 GTTCCCAGACACCCTCATGCAGG - Intergenic
1173397385 20:42692078-42692100 CCTACCCAACACCTTCAAGCAGG - Intronic
1175687142 20:61039845-61039867 GTTCCCATACACCCTAAACCAGG + Intergenic
1176622344 21:9068626-9068648 ACCCCCCAACACCCCCAAGCTGG - Intergenic
1177809042 21:25905139-25905161 GCTCCCAAACATAGTCGAGCAGG + Intronic
1178719712 21:34997847-34997869 TCTCCCCAACACCCCCAATCTGG + Intronic
1182290758 22:29277634-29277656 ACCCCAAAATACCCTCAAGCAGG - Intronic
1185250750 22:49800352-49800374 GCTGCTGAACACCCTCAGGCAGG + Intronic
950973345 3:17212610-17212632 GCCCCCAAAGACCCTCCAGGGGG + Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953223565 3:40997121-40997143 ACTGACAAACACCCACAAGCAGG + Intergenic
955796122 3:62639051-62639073 GCTCACAAACACACACAAACTGG + Intronic
964169865 3:153757088-153757110 GCTCCACAACACCCTCAGACAGG + Intergenic
967101600 3:186220642-186220664 GGTCCCAGCCAACCTCAAGCTGG - Intronic
969358109 4:6643138-6643160 GCTGACAAACACCCTTCAGCTGG + Intergenic
973197539 4:47463158-47463180 CCTACCAACCACCCTCAAGGGGG + Intronic
975045359 4:69796567-69796589 GATCCCAAACACCTTCCACCAGG - Intergenic
979780766 4:124648941-124648963 GCTGTAAAACAGCCTCAAGCAGG - Intergenic
979905205 4:126280820-126280842 TCACCCAAAGACCATCAAGCAGG + Intergenic
980838699 4:138230251-138230273 CCTTCCAAACACCCTCAAGCAGG - Intronic
985682951 5:1265990-1266012 GATCCCAAACAACCCCACGCAGG + Intronic
986201897 5:5586774-5586796 GCTTCCAAATACCATCACGCTGG + Intergenic
986350813 5:6878051-6878073 GTTCCCAGCCACCCTCAGGCAGG + Intergenic
987601075 5:20071307-20071329 ACTCTCAAACACCCTAAAGAAGG - Intronic
994285371 5:97958377-97958399 GATGCCAACCACCCTTAAGCTGG + Intergenic
1000988139 5:167883197-167883219 GCTCCCAAAGACCCTCACCCTGG + Intronic
1003035426 6:2637209-2637231 GCTCCCAATCTCCCTCTAGGTGG - Intergenic
1005009331 6:21321321-21321343 CCTCCCAGACACCCAGAAGCGGG - Intergenic
1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG + Exonic
1007123060 6:39399701-39399723 GCTTCCACACACCCTCAGGCAGG - Intronic
1013895281 6:115080781-115080803 GGGCCCAAACACCCTGAATCTGG - Intergenic
1013895392 6:115081864-115081886 GGGCCCAAACACCCTGAATCTGG + Intergenic
1014167744 6:118245197-118245219 TCTTCCAAACACCCTCCACCTGG + Intronic
1014564004 6:122926372-122926394 CATCCCAAACCCCCTCCAGCTGG + Intergenic
1022357821 7:29632372-29632394 GCTCTTAAAAACCCTGAAGCCGG + Intergenic
1023969306 7:44979303-44979325 GCTCCCCTCCACCCACAAGCAGG + Intergenic
1026882573 7:73916860-73916882 GCTGCCAAACACGCAGAAGCTGG - Intergenic
1032480275 7:132240502-132240524 GCTGCCAAACACCCATTAGCTGG - Intronic
1033442952 7:141396450-141396472 GCTCTCAAAGACCTTCAAGGCGG - Intronic
1034020793 7:147640387-147640409 TCTCCCAATCACCCTGAAGTAGG - Intronic
1035053869 7:156020740-156020762 CCTCCCAAACCCCCTCCACCAGG + Intergenic
1036760816 8:11507480-11507502 GCTCCCAAAAGCCCTCAGGGTGG - Intronic
1039417663 8:37409483-37409505 CCTCCCAAACACCCTCATAGAGG - Intergenic
1041733180 8:61083457-61083479 GCTCCCAAACCCCCTCAGTTGGG - Intronic
1044834798 8:96285630-96285652 GCTCCCAAAGGCTCTCAAGAAGG - Intronic
1047958546 8:129994293-129994315 TCTCCCACACATCCTCAAGAGGG + Intronic
1049264573 8:141660548-141660570 GCTCCCACCCTCCCTCGAGCTGG - Intergenic
1049442810 8:142616985-142617007 CCTCCCCAACCCCCTCCAGCAGG + Intergenic
1049475543 8:142795468-142795490 GCTCCCAAGCACCCAGGAGCAGG - Intergenic
1053004712 9:34596863-34596885 TCTCCCAAGCACCCTCCTGCTGG + Intergenic
1059293209 9:113246157-113246179 CCTCCCACACCCTCTCAAGCTGG + Intronic
1059527984 9:115010512-115010534 CCTCCAACACACCCTCAATCTGG + Intergenic
1062278158 9:135740335-135740357 GCTCCCAAACTCCCCCAAGCAGG + Intronic
1185513219 X:678317-678339 TCTCCCAGACACCCTCCACCTGG - Intergenic
1185513260 X:678514-678536 TCTCCCAGACACCCTCCACCTGG - Intergenic
1185513300 X:678711-678733 TCTCCCAGACACCCTCCACCTGG - Intergenic
1185513341 X:678908-678930 TCTCCCAGACACCCTCCACCTGG - Intergenic
1186426154 X:9465378-9465400 GCTCCGAACCTCCCTCCAGCCGG - Exonic
1197622101 X:128762400-128762422 CTTCACAAACACCCACAAGCGGG + Intergenic
1200078187 X:153562206-153562228 GCTCCCCAACACCAACAAACAGG - Exonic
1200727264 Y:6686616-6686638 GCTCCCCATCACCCTCAGGGAGG - Intergenic
1200728416 Y:6702391-6702413 GCTCCCCATCACCCTCAGGGAGG - Intergenic
1201158864 Y:11154067-11154089 ACCCCCCAACACCCCCAAGCTGG - Intergenic