ID: 1006148372

View in Genome Browser
Species Human (GRCh38)
Location 6:31972439-31972461
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006148372_1006148385 28 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148385 6:31972490-31972512 GATCCTCTTCGGGGTGAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 82
1006148372_1006148377 -8 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148377 6:31972454-31972476 GTTAAGAGGCGGCGGAAGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1006148372_1006148380 6 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148380 6:31972468-31972490 GAAGCGAGGGCCTGTGGAGTCGG 0: 1
1: 0
2: 1
3: 15
4: 200
1006148372_1006148378 -7 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148378 6:31972455-31972477 TTAAGAGGCGGCGGAAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1006148372_1006148382 17 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148382 6:31972479-31972501 CTGTGGAGTCGGATCCTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 102
1006148372_1006148383 18 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148383 6:31972480-31972502 TGTGGAGTCGGATCCTCTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1006148372_1006148384 19 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148372_1006148379 0 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148379 6:31972462-31972484 GCGGCGGAAGCGAGGGCCTGTGG 0: 1
1: 0
2: 3
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006148372 Original CRISPR CTCTTAACTCCAAAGGTCTC CGG (reversed) Exonic