ID: 1006148384

View in Genome Browser
Species Human (GRCh38)
Location 6:31972481-31972503
Sequence GTGGAGTCGGATCCTCTTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006148370_1006148384 26 Left 1006148370 6:31972432-31972454 CCTGATCCCGGAGACCTTTGGAG 0: 1
1: 0
2: 1
3: 4
4: 84
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148371_1006148384 20 Left 1006148371 6:31972438-31972460 CCCGGAGACCTTTGGAGTTAAGA 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148375_1006148384 12 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1006148375 6:31972446-31972468 CCTTTGGAGTTAAGAGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148372_1006148384 19 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006148384 Original CRISPR GTGGAGTCGGATCCTCTTCG GGG Exonic