ID: 1006148384

View in Genome Browser
Species Human (GRCh38)
Location 6:31972481-31972503
Sequence GTGGAGTCGGATCCTCTTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006148370_1006148384 26 Left 1006148370 6:31972432-31972454 CCTGATCCCGGAGACCTTTGGAG 0: 1
1: 0
2: 1
3: 4
4: 84
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148375_1006148384 12 Left 1006148375 6:31972446-31972468 CCTTTGGAGTTAAGAGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148371_1006148384 20 Left 1006148371 6:31972438-31972460 CCCGGAGACCTTTGGAGTTAAGA 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006148372_1006148384 19 Left 1006148372 6:31972439-31972461 CCGGAGACCTTTGGAGTTAAGAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006148384 Original CRISPR GTGGAGTCGGATCCTCTTCG GGG Exonic
900481713 1:2902630-2902652 GTGGAGTGGGGTCCTCTCCTGGG + Intergenic
904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG + Intronic
904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG + Intergenic
906749663 1:48247668-48247690 GTTGAGTTGGATTCTCTTCAGGG - Exonic
1064274910 10:13896862-13896884 GTAGAATCGGCTGCTCTTCGGGG - Intronic
1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG + Intronic
1075786559 10:125053879-125053901 GTGGAATCTGATCCTCTGCCGGG - Intronic
1119357488 14:74019209-74019231 GCGGCGCCGGATCCTCTACGTGG - Intronic
1121510753 14:94511572-94511594 GTGGTGTCGGTTCCTGTTCTGGG - Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1129483241 15:75843929-75843951 GGGGAGCCGGAGCCTCTCCGGGG - Intronic
1131091091 15:89625391-89625413 GTGGCGCCGGCTCCTCTTCCGGG + Exonic
1132356925 15:101178598-101178620 GCGGAGTCCATTCCTCTTCGAGG + Exonic
1133300574 16:4779870-4779892 GGGGAGTCCTATCCTTTTCGAGG + Intronic
1146811977 17:35911164-35911186 GTGGAGACTGATCCTTTTCCCGG - Intergenic
1149482028 17:57011348-57011370 GTGGACTCTGATTCTCTTCTGGG + Intergenic
1156391029 18:36650877-36650899 GTGGAGTCAGAGACTCTTCCAGG - Intronic
1162020358 19:7865420-7865442 GTGGTGTCAGGGCCTCTTCGAGG + Intergenic
925184628 2:1838593-1838615 GTGCAGTCGGTCCCTCTGCGGGG - Intronic
927697911 2:25250657-25250679 GTGGTGTGGGCTCCTCTGCGAGG - Intronic
935612257 2:105037895-105037917 GTGGAGTCGGATACGCCCCGCGG + Intergenic
948674355 2:239588337-239588359 GTGGAGTTGGAGCCACTCCGTGG - Intergenic
1169486606 20:6039894-6039916 GTGGGGTTGGTTCCTCTTGGAGG - Exonic
978482405 4:109208828-109208850 GTGGAGAATGATCCTCTTCAGGG - Intronic
1000616457 5:163433125-163433147 GTAGGGTCAGAGCCTCTTCGTGG - Intergenic
1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG + Exonic
1037862205 8:22413495-22413517 GGGGAGTCGAATCATCTTGGGGG - Intronic
1056599705 9:88036997-88037019 GTGGTGTTGGATCCTGTTGGGGG + Intergenic
1196893491 X:120311372-120311394 GCGGAGTAGGATGCTCTGCGGGG - Exonic