ID: 1006150193

View in Genome Browser
Species Human (GRCh38)
Location 6:31982953-31982975
Sequence CATCCTGAGAGGGCTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006150193_1006150206 30 Left 1006150193 6:31982953-31982975 CCCCTCCGAGCCCTCTCAGGATG 0: 2
1: 0
2: 0
3: 7
4: 156
Right 1006150206 6:31983006-31983028 AAAGAAAGTGCCACACAGAAGGG 0: 2
1: 0
2: 2
3: 49
4: 531
1006150193_1006150205 29 Left 1006150193 6:31982953-31982975 CCCCTCCGAGCCCTCTCAGGATG 0: 2
1: 0
2: 0
3: 7
4: 156
Right 1006150205 6:31983005-31983027 GAAAGAAAGTGCCACACAGAAGG 0: 2
1: 0
2: 2
3: 53
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006150193 Original CRISPR CATCCTGAGAGGGCTCGGAG GGG (reversed) Intronic
901037590 1:6345637-6345659 CATCCAGTGAGGGCCCAGAGAGG + Intronic
902196310 1:14801188-14801210 CACCCTGAGACGGCTCCGACTGG - Intronic
902736177 1:18402693-18402715 TCTCTTGAGAGGGCTCGGTGGGG + Intergenic
903180606 1:21603165-21603187 CATCCTGAGGGGGCTAGGGTGGG + Intronic
904235733 1:29115845-29115867 CAGCCTGAGAGGGCTCTGGATGG + Intronic
906493941 1:46289955-46289977 CATCCTCAGTGGGCTGGTAGGGG + Intronic
908817763 1:68051569-68051591 CGTCCTGCGAGGGTTCGGCGAGG - Exonic
912207477 1:107524343-107524365 CACCCTGAGCAGGCTCTGAGAGG - Intergenic
912907994 1:113727850-113727872 CCTCCTGAGTAGGCTTGGAGTGG - Intronic
913961784 1:143344483-143344505 CCTCCTGTGAGGGCTCCCAGTGG - Intergenic
914056139 1:144170055-144170077 CCTCCTGTGAGGGCTCCCAGTGG - Intergenic
914123007 1:144796307-144796329 CCTCCTGTGAGGGCTCCCAGTGG + Intergenic
916128779 1:161593416-161593438 TATCCTGAGAGAGCTGGGAGGGG - Intronic
916138691 1:161675247-161675269 TATCCTGGGAGAGCTGGGAGGGG - Exonic
922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG + Intergenic
922177577 1:223208644-223208666 AACCCTGGGTGGGCTCGGAGTGG - Intergenic
922573866 1:226649220-226649242 CATCCTGAGAGGGCGGAGCGCGG - Intronic
1062813660 10:483697-483719 GCTCCTGAGAGGGCCCAGAGAGG + Intronic
1065674932 10:28164252-28164274 CCTCCTGAGAGGGGAGGGAGAGG + Intronic
1069777122 10:70933720-70933742 CTTCCTGAGAGGGAGCAGAGTGG - Intergenic
1070792148 10:79195889-79195911 CATCCTTAAAAGGCTCAGAGAGG - Intronic
1074710465 10:116172976-116172998 CATCCTGAATGGGCTTCGAGCGG + Intronic
1076570954 10:131432532-131432554 CATCCTGAGAGTGCACAGAGGGG + Intergenic
1077391181 11:2301298-2301320 ACTCCTGGGAGGGCCCGGAGTGG + Intronic
1083628224 11:64082726-64082748 CCTCCTGAGAGGACTCAGAGGGG + Intronic
1084421274 11:69061817-69061839 AATCCTGAGAGGGCTGGGGTGGG + Intronic
1085300630 11:75456264-75456286 CATCCTGGGAGCGGTGGGAGTGG + Intronic
1086001779 11:81992532-81992554 TACCCTGAGAGGGCTGGGCGTGG + Intergenic
1091704384 12:2683943-2683965 CATGCTGGGAGGGGTCGGTGAGG - Intronic
1093364587 12:18277364-18277386 GTTACTGAGAGGGCTCTGAGTGG - Intronic
1096221112 12:49828525-49828547 CATCTGGAGGGGGCTGGGAGGGG - Intronic
1100562912 12:95767180-95767202 AATCCTGAGAGTGGTTGGAGAGG - Intronic
1101880436 12:108622467-108622489 CAGCCTGTGAGGGCTGGGATGGG - Intronic
1102966451 12:117131406-117131428 CATCCTCAGTGGGCTGAGAGGGG + Intergenic
1103237533 12:119385814-119385836 CACCCTGAAGGGGCACGGAGGGG - Intronic
1107385321 13:39902102-39902124 AGTCCAGAGAGGGCTCGGAGAGG + Intergenic
1110489559 13:76087228-76087250 CAGGCTGAGAGGCCTAGGAGGGG - Intergenic
1111215796 13:85139767-85139789 CATGCTGACAGGGCTTGGGGAGG - Intergenic
1113659613 13:112096592-112096614 CATCCTGTGAGGGCTCACAAAGG + Intergenic
1114416013 14:22544951-22544973 CTTCCTCAGTGGGCTCTGAGAGG + Intergenic
1114461703 14:22890300-22890322 CATCCTGAGGGGGGTGGCAGTGG + Intergenic
1117858830 14:60067668-60067690 CATTCTGAGAGGGAAGGGAGAGG - Intergenic
1118511499 14:66479665-66479687 CCTCCTGAGGGGGCTTAGAGGGG - Intergenic
1121109395 14:91302441-91302463 GATCCAGGGAGGGCTAGGAGAGG - Intronic
1121834605 14:97080507-97080529 AAACCAGAGAGGGCTCAGAGAGG - Intergenic
1122738289 14:103856206-103856228 CTTCCTGCGAGGACTCAGAGCGG + Intergenic
1122783523 14:104153645-104153667 CATCCTGGGAGGGGTGGGCGGGG + Intronic
1123034450 14:105466270-105466292 CATCCTGACTGGGCTGGAAGTGG - Intronic
1124220650 15:27847341-27847363 CATCCTGTGAGGGGAGGGAGAGG - Intronic
1128579874 15:68801931-68801953 CATCCTGAGAGGGCCAGGCCAGG + Intronic
1128834618 15:70799202-70799224 CATCCAGAGAAGGCTTGGGGAGG - Intergenic
1131250744 15:90828407-90828429 GCTCCTGGGAGGGCTGGGAGTGG + Intergenic
1133171013 16:3982508-3982530 CTCCCTGAGGGGGCTCGCAGCGG - Intronic
1138551092 16:57748894-57748916 CAAGCTGAGTGGGCTGGGAGCGG + Intronic
1141878397 16:86841963-86841985 CATCCTGAGAGACCTGGGAGGGG - Intergenic
1142564736 17:832683-832705 CATCCAGAGAGGATTCCGAGAGG - Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1146291464 17:31610568-31610590 CACCCTGAGAGGTCCCTGAGGGG + Intergenic
1148605444 17:48925841-48925863 CATCCTGAGTGGGATGGCAGTGG - Intronic
1148684196 17:49491588-49491610 CATGGAGAGAGGGCTCGTAGGGG - Intergenic
1150443493 17:65210539-65210561 CATCCTGAGACAGCTGGAAGAGG + Exonic
1150454780 17:65298479-65298501 CCTCCTAAAAGGGCTTGGAGAGG + Intergenic
1153239251 18:3015643-3015665 CAGCCTGAGGGGGAACGGAGGGG - Intergenic
1155071070 18:22316770-22316792 CATCCTAAGGTGGCTCGCAGTGG + Intergenic
1156282484 18:35653642-35653664 CAGCCTGAGAGACCTCAGAGAGG - Intronic
1160748653 19:723278-723300 CAGGCTGAGAGGGCTGGGGGTGG + Intronic
1161377197 19:3946044-3946066 CATTCTTATAGGGCTCAGAGAGG + Intergenic
1162933684 19:13969908-13969930 CTGCCTGAGATGACTCGGAGTGG + Intronic
1163548683 19:17953176-17953198 CAGCCTGAGGAGGCTGGGAGCGG - Intronic
1165288961 19:34867789-34867811 CATCCAGAAATGGCTCAGAGAGG + Intergenic
1166683083 19:44779869-44779891 CATCCTGAGAGGACATGCAGAGG + Intronic
1202695622 1_KI270712v1_random:122740-122762 CCTCCTGTGAGGGCTCCCAGTGG - Intergenic
925292951 2:2760698-2760720 CAGCCTGAGTGGGCTTGGAAGGG - Intergenic
925492242 2:4407626-4407648 CAACCTGAGTGAGCTTGGAGTGG + Intergenic
928079005 2:28292063-28292085 CATCCTGAGAGGACTGGAAATGG + Intronic
928087627 2:28355840-28355862 CATCCTCAGTGGGCTGGGTGAGG - Intergenic
928425048 2:31170923-31170945 CAACCTGAGAGGGCCAGGGGAGG - Intergenic
933764683 2:85698566-85698588 CAAGGTGAGAGGGCTCAGAGGGG - Exonic
934568600 2:95354164-95354186 CAACCTGAGGGGGCAGGGAGAGG - Intronic
935374470 2:102380676-102380698 CTTTCTGAGAGGGCTCAGGGAGG + Intronic
937315979 2:120932368-120932390 GATCCTGAGAGGGAACGGGGAGG - Intronic
937320612 2:120958581-120958603 TATCCTGAGGGGGCTAGAAGTGG - Intronic
940019891 2:149145723-149145745 CTTCCTGAGAAGTCTCTGAGGGG - Intronic
944897618 2:204181167-204181189 AATCCTGACAGGGCTAGGATAGG - Intergenic
944992738 2:205256160-205256182 CATCCTGAGAGGGATCTTTGAGG - Intronic
946415258 2:219537005-219537027 CTTCCTGAGAAGGCTGGCAGGGG - Intronic
947934679 2:233993722-233993744 CTTCCTCAGAGAGCTCAGAGTGG - Intronic
948561274 2:238854980-238855002 GGTGCTCAGAGGGCTCGGAGTGG + Intronic
1172733854 20:37111095-37111117 CTTCCTGAGGGGGCTGGGCGTGG - Intronic
1172940476 20:38650437-38650459 CATCCTGAAAGGATTCTGAGAGG - Exonic
1173026869 20:39315745-39315767 CATCCTGAGAGGGTGCAGGGAGG - Intergenic
1174536528 20:51255612-51255634 CATCCTCAGAGGGTTAGGTGGGG - Intergenic
1179618107 21:42594803-42594825 CATCCCCAGAGGGCTCTGATAGG - Intergenic
1179779778 21:43691997-43692019 CATCCTCAAAGGGCTGTGAGTGG + Intronic
1181030541 22:20147216-20147238 CATCCTGCTAGGGCCCCGAGAGG - Exonic
1181134527 22:20755252-20755274 CAACCTGAAAGAGCTCCGAGTGG - Intronic
1181512764 22:23396155-23396177 CATCCTGCTAGGGCCCGGAAAGG + Intergenic
1181688063 22:24542939-24542961 CATCCTGAGCGGGCCCGGCTGGG + Exonic
1182277037 22:29196151-29196173 CCTCCTGGGAGAGCACGGAGGGG + Intergenic
1183098346 22:35568067-35568089 CATCCTCTGAGGGCTCAGTGGGG - Intergenic
1184402645 22:44282723-44282745 GCTCCTGAGAGGGCTGTGAGGGG + Intronic
1184615731 22:45637056-45637078 CATCCTGAAAGGGGTTGGAAAGG - Intergenic
1184693950 22:46129664-46129686 CATGCTGCGAGGCCTCAGAGGGG + Intergenic
1184735075 22:46393250-46393272 TATCCTGAGAGGGCTGGGGAGGG + Intronic
951155491 3:19348358-19348380 CATGCTGAAAGGGCACGGAAGGG - Intronic
954532918 3:51336451-51336473 CAACCTGAGAGGCCTGGGAAAGG - Intronic
955494341 3:59515980-59516002 GATGCTGGGAGGGCTGGGAGTGG - Intergenic
960869235 3:122232481-122232503 CATTCTGAGAGGGATGGGAAGGG + Intronic
961393308 3:126569483-126569505 CATCTTTAGAGGGTTAGGAGAGG - Intergenic
962263313 3:133928445-133928467 CTCCCTGAGAGGGCGCAGAGTGG + Exonic
962462128 3:135624014-135624036 CAGCCTGAGTGTGCTCAGAGAGG + Intergenic
962463430 3:135635636-135635658 CTTCCTGAGAGGGCTGGGGTGGG - Intergenic
968267762 3:197375930-197375952 CATCCTGACAGGGTTCACAGAGG + Intergenic
969275049 4:6129073-6129095 CATCCAAAGAGGGCTCCCAGGGG - Intronic
974020803 4:56690554-56690576 CATTCAGAGAGGGCTCAGTGGGG + Intergenic
975435058 4:74342663-74342685 CATCCTGCCAGGGCCAGGAGGGG - Intergenic
976162331 4:82216589-82216611 CCTCCTGAGAAGGTTCTGAGGGG - Intergenic
979193697 4:117894686-117894708 CATTCTGAGTGGGCAGGGAGAGG + Intergenic
982437690 4:155397599-155397621 CATCCTGGGAAGGCCAGGAGGGG - Intergenic
995018577 5:107341622-107341644 CATCCAGAGAGGGCTCACAGAGG - Intergenic
998403079 5:141858217-141858239 CCTCCAGAGAGGCCTGGGAGTGG + Intronic
998481107 5:142463626-142463648 CTTCCTGAGAGGCCACTGAGAGG - Intergenic
998861679 5:146450219-146450241 GATCCTGAGAGGGCCTGTAGAGG + Intronic
1001701210 5:173707728-173707750 CATGCTGAGAGCTCTGGGAGGGG - Intergenic
1002091035 5:176806507-176806529 CATCCTGAGAGGGCTCCATATGG + Intergenic
1003495062 6:6656518-6656540 TAGCCTGAGAGGGCTCGGCTTGG - Intergenic
1005199366 6:23325779-23325801 CAACCTGAGTGAGCTTGGAGAGG + Intergenic
1005708319 6:28479304-28479326 CATCCTGTTAGGGTCCGGAGAGG - Intergenic
1006150193 6:31982953-31982975 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1006156494 6:32015691-32015713 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1007203682 6:40132044-40132066 CCTCCTGAAGGGGCTAGGAGAGG + Intergenic
1007648113 6:43398350-43398372 AATCCTGGGTGGGCTCGGGGTGG - Intergenic
1007752870 6:44080877-44080899 CATCCTGAGAGGGCCCACTGGGG + Intergenic
1014894565 6:126886223-126886245 CATCCTGTCAGTGCTGGGAGTGG - Intergenic
1017653122 6:156601266-156601288 CATCCCCAGAGGGCTGGGTGTGG - Intergenic
1018368200 6:163143825-163143847 GATCCTGAGAGGGGACGGGGAGG + Intronic
1018908228 6:168087521-168087543 CATCGTGAGACGGCTCTGTGGGG + Intergenic
1022180554 7:27914739-27914761 CATCCTGAGAGGCCCCTGTGTGG - Intronic
1024548461 7:50541094-50541116 CAGCCTGAGAGGGGTCTGAATGG - Intronic
1024748607 7:52436352-52436374 CATCCACAGTGGGCTCAGAGGGG + Intergenic
1028123490 7:87084591-87084613 CATCCTGAGAGAGGACGGAAAGG - Intergenic
1031986978 7:128169520-128169542 CATCCTCAGAGGTCTCTGGGTGG - Intergenic
1033597943 7:142869997-142870019 CAACCTGGGAGGGATCGGGGTGG - Intronic
1034471934 7:151259534-151259556 GATCCTGAACGGGCTTGGAGTGG - Intronic
1035187521 7:157138505-157138527 CACCCGGAGCGGGCTGGGAGCGG - Intergenic
1035828403 8:2668790-2668812 CATCCTGAGAGGGCCTGGCTGGG - Intergenic
1036910860 8:12755663-12755685 CACCCGGAGGGGGCTCGGAAGGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1042291640 8:67175004-67175026 CATCCTGGCAGGGCTAGGACAGG + Intronic
1043929426 8:86074057-86074079 CCTCCTGAGACAGCTCTGAGAGG + Intronic
1049410743 8:142472982-142473004 CATCAGGAGAGGCTTCGGAGGGG - Intronic
1049781888 8:144432835-144432857 CAGCCTGAGTGGGCTCACAGTGG + Intronic
1053179030 9:35951940-35951962 CTTCCTGAGAGGCCTGGAAGAGG - Intergenic
1053463471 9:38288486-38288508 CATCCTGACAGGGGTAGGGGAGG - Intergenic
1060040444 9:120295825-120295847 CAGCCTGACAGGGCTGGGTGTGG - Intergenic
1061945036 9:133903820-133903842 GACCCGGAGAGGGCTCGGGGAGG + Intronic
1185456469 X:313229-313251 CATCGTGAGCGGGCTCAGTGGGG + Intronic
1185592699 X:1288109-1288131 CTTCCTCCGAGGGCTCTGAGTGG - Intronic
1189701715 X:43719843-43719865 CATCCTGAAATGACCCGGAGGGG + Intronic
1189801328 X:44694576-44694598 CCTCCTGAGAGGGCTCAGCTGGG + Intergenic
1190880030 X:54485297-54485319 CATCCTGAGAGGCCAGTGAGGGG - Intronic
1198422274 X:136479897-136479919 AATCCTGAGACAGCTCTGAGAGG - Intergenic
1199529402 X:148830127-148830149 CACTCTGAGAGGGCCCTGAGAGG + Intronic
1199602724 X:149552210-149552232 GATCCTGAGAGGCCACGGGGAGG - Intergenic
1199647665 X:149927265-149927287 GATCCTGAGAGGCCACGGGGAGG + Intergenic