ID: 1006151103

View in Genome Browser
Species Human (GRCh38)
Location 6:31990486-31990508
Sequence AACATTCTGGCGCCCAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 3, 1: 1, 2: 2, 3: 8, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006151103_1006151116 23 Left 1006151103 6:31990486-31990508 CCCACGTTGGGCGCCAGAATGTT 0: 3
1: 1
2: 2
3: 8
4: 67
Right 1006151116 6:31990532-31990554 GTAGGGTACCTGAAGTCTGGTGG 0: 4
1: 4
2: 13
3: 22
4: 112
1006151103_1006151110 5 Left 1006151103 6:31990486-31990508 CCCACGTTGGGCGCCAGAATGTT 0: 3
1: 1
2: 2
3: 8
4: 67
Right 1006151110 6:31990514-31990536 CCAGCCTCAACACCACCTGTAGG 0: 8
1: 20
2: 22
3: 34
4: 220
1006151103_1006151111 6 Left 1006151103 6:31990486-31990508 CCCACGTTGGGCGCCAGAATGTT 0: 3
1: 1
2: 2
3: 8
4: 67
Right 1006151111 6:31990515-31990537 CAGCCTCAACACCACCTGTAGGG No data
1006151103_1006151115 20 Left 1006151103 6:31990486-31990508 CCCACGTTGGGCGCCAGAATGTT 0: 3
1: 1
2: 2
3: 8
4: 67
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006151103 Original CRISPR AACATTCTGGCGCCCAACGT GGG (reversed) Intronic
900814986 1:4836864-4836886 ATCATTCTGGCTCCAAATGTCGG + Intergenic
902956981 1:19932141-19932163 AACATTCTGGCGCCCAACGTGGG - Intergenic
903178247 1:21593092-21593114 GCCAGTCTGGGGCCCAACGTTGG - Intergenic
907510887 1:54957859-54957881 AACAATTTGGCACCAAACGTGGG + Intergenic
917838891 1:178961607-178961629 AACATTCTGGAGCTCATAGTGGG - Intergenic
920423931 1:205858176-205858198 AAATTTCAGGCACCCAACGTGGG + Intergenic
920999407 1:211027356-211027378 AACATTTTGGAGGCCAATGTAGG + Intronic
923074486 1:230597509-230597531 AATATTCTTGAGCCCAATGTAGG + Intergenic
1069941086 10:71955755-71955777 ACATTTCTGGCGCCCAACATGGG + Intergenic
1074411619 10:113233783-113233805 AGCACTCTGGGGCCCAAGGTAGG - Intergenic
1085327194 11:75615639-75615661 AACATTCTGGTGCCCAGAGTGGG + Intronic
1091644138 12:2260729-2260751 AACATTCTTGCTCCTAAAGTGGG + Intronic
1098310127 12:69140271-69140293 AATAATCTGGCGCCCAATGTGGG + Intergenic
1099444095 12:82731302-82731324 GACACTCTGGAGCCCCACGTTGG - Intronic
1102220932 12:111193930-111193952 AACATTCTGGATGCCAAGGTTGG + Intronic
1103031242 12:117615102-117615124 AAGATTCTTGCTCCCAAAGTGGG - Intronic
1107017589 13:35720179-35720201 AAGATTTTGGGGCCCAATGTAGG + Intergenic
1110256625 13:73440484-73440506 ACATTTTTGGCGCCCAACGTGGG + Intergenic
1111132569 13:83996379-83996401 ACCATTTTGGCGCGCAACGTGGG + Intergenic
1118949827 14:70426027-70426049 CAAATTTTGGTGCCCAACGTGGG - Intergenic
1120974819 14:90239349-90239371 AGTAATCTGGCGCCCAACATGGG + Intergenic
1121775458 14:96587700-96587722 AACATTCTGGTCCCTAATGTGGG - Intergenic
1122642823 14:103170587-103170609 ACATTTCTGGCACCCAACGTGGG + Intergenic
1126645913 15:50874683-50874705 AATAATCTGGTGCCCAACATTGG - Intergenic
1127362478 15:58256768-58256790 AACATTCTGCCCCCCACCCTCGG - Intronic
1131098216 15:89669377-89669399 AACATTCTCTCTTCCAACGTGGG - Intronic
1135223799 16:20637909-20637931 AACATTCTGCCACCCAACACAGG - Intronic
1137330742 16:47492841-47492863 AACAGTTTAGCACCCAACGTGGG - Intronic
1152430329 17:80245286-80245308 AACGTTAGGGCGTCCAACGTGGG - Intronic
1153580544 18:6569206-6569228 AGAATTCTGGGTCCCAACGTGGG - Intronic
1155180526 18:23341570-23341592 AACATGCTGGCACCCAGTGTAGG + Intronic
1156098667 18:33566512-33566534 AACATTTTGGCACCCAATGTGGG - Intergenic
1158727973 18:59992075-59992097 AACATTTTGGGGGCCAAGGTGGG - Intergenic
1162601473 19:11673366-11673388 AACAGTCTGGCACCCATGGTTGG + Intergenic
1162693293 19:12451185-12451207 ACATTTCTGGCACCCAACGTGGG + Intronic
1166056699 19:40294161-40294183 GAGTTTCTGGTGCCCAACGTGGG + Intergenic
1166161204 19:40954749-40954771 CAACATCTGGCGCCCAACGTGGG + Intergenic
926792020 2:16583594-16583616 ACCATTATGGCACCCAACTTGGG - Intronic
936062351 2:109303372-109303394 AAAAGTCTGGCCCCCAAAGTGGG - Intronic
938806487 2:134810966-134810988 CACATTTTGGCACCCAATGTGGG - Intergenic
941537845 2:166743632-166743654 CACATTTTGGCGCCCAACGTGGG - Intergenic
941884981 2:170518729-170518751 AACATTCTTGGGCCCAACTTCGG - Intronic
1170318251 20:15065999-15066021 CACATTCTGGGGCCCAGCTTGGG + Intronic
1175408353 20:58750000-58750022 AACATGCTGGTGCCTAACCTGGG + Intergenic
1179498194 21:41788460-41788482 AACCTTCTGGTGCCCAGCTTGGG - Intergenic
1180616183 22:17129427-17129449 AACATTCTAGAGGCCAAGGTGGG + Intronic
1183191210 22:36323091-36323113 AACAGCCTGGAGCCCAAAGTGGG - Intronic
954232559 3:49228520-49228542 CACATTTTGGCGCCCAATGTGGG - Intronic
954598629 3:51850616-51850638 CACATTTTGGCACCCAACGTGGG + Intergenic
955612802 3:60775620-60775642 ATATTTTTGGCGCCCAACGTGGG + Intronic
957288418 3:78246643-78246665 ACAATTTTGGCACCCAACGTGGG + Intergenic
974665301 4:64953695-64953717 TATTTTTTGGCGCCCAACGTGGG + Intergenic
978310332 4:107380030-107380052 ACAATTCTGGTGCCCAACTTTGG + Intergenic
979667327 4:123326528-123326550 AACATTCTGTCTCCCATTGTTGG - Intergenic
984405926 4:179329758-179329780 AACATTCTGTGGCACAAGGTAGG + Intergenic
984938707 4:184912701-184912723 ACATTTCTGGCGCCCAATGTGGG - Intergenic
992503637 5:77365144-77365166 AACATAGTGGCTCCCAACCTTGG + Intronic
1002668121 5:180842014-180842036 ATCACTCTGTCGCCCAAGGTTGG - Intergenic
1005575789 6:27188067-27188089 AACATTCTGGTGCCCAACGTGGG + Intergenic
1005942909 6:30574382-30574404 AACATTTTGGGGACCAAGGTGGG - Intronic
1006151103 6:31990486-31990508 AACATTCTGGCGCCCAACGTGGG - Intronic
1006157404 6:32023224-32023246 AACATTCTGGCGCCCAACGTGGG - Intronic
1010453184 6:76026296-76026318 CATTTTTTGGCGCCCAACGTGGG + Intronic
1013336462 6:109167758-109167780 ACCATTCTGGTGCCCACAGTTGG - Intergenic
1014308655 6:119771467-119771489 ACAATTCTGGCGCCCAGTGTGGG - Intergenic
1014526886 6:122511528-122511550 AACATTTTGTCACCCAACATGGG - Intronic
1016233170 6:141830843-141830865 AACATTTTGAGGCCCAATGTGGG - Intergenic
1020392266 7:7670872-7670894 AACATTCTTGGGCCCAAGATAGG - Intronic
1033865574 7:145687131-145687153 AACATTTTGGCACCCCACATGGG + Intergenic
1041671292 8:60494071-60494093 ACATTTCTGGCGCCCAACATGGG + Intergenic
1044698286 8:94944574-94944596 AGCACTCTGTCGCCCAAGGTTGG - Intronic
1045884380 8:107078658-107078680 ACCATTCTGGGGCTCAAAGTTGG + Intergenic
1046770185 8:118110628-118110650 AACATTCTAGCGGCCATCGAGGG - Exonic
1049171981 8:141167176-141167198 AACATTCTGGAGGCCACTGTGGG + Intronic
1050920080 9:11189175-11189197 TGCATTATAGCGCCCAACGTGGG - Intergenic
1052693609 9:31848872-31848894 ACAATTTTGGCGCGCAACGTGGG + Intergenic
1053406943 9:37885615-37885637 AATAATACGGCGCCCAACGTGGG + Intronic
1057484921 9:95475435-95475457 AAGATTGTGGCGGCCAACTTAGG + Intronic
1190364043 X:49675140-49675162 AACATTCTGGAGCTCAATGTTGG + Intergenic
1193787999 X:85784036-85784058 AACATTTAGGCACCCCACGTGGG - Intergenic
1201347469 Y:13000517-13000539 AACATTCTGGCATCCAACGTGGG - Intergenic