ID: 1006151115

View in Genome Browser
Species Human (GRCh38)
Location 6:31990529-31990551
Sequence CCTGTAGGGTACCTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 3, 1: 4, 2: 10, 3: 28, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006151103_1006151115 20 Left 1006151103 6:31990486-31990508 CCCACGTTGGGCGCCAGAATGTT No data
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151108_1006151115 7 Left 1006151108 6:31990499-31990521 CCAGAATGTTGGGGACCAGCCTC 0: 3
1: 3
2: 3
3: 16
4: 160
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151109_1006151115 -8 Left 1006151109 6:31990514-31990536 CCAGCCTCAACACCACCTGTAGG 0: 7
1: 20
2: 21
3: 29
4: 214
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151102_1006151115 21 Left 1006151102 6:31990485-31990507 CCCCACGTTGGGCGCCAGAATGT 0: 3
1: 2
2: 4
3: 8
4: 82
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151104_1006151115 19 Left 1006151104 6:31990487-31990509 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006151115 Original CRISPR CCTGTAGGGTACCTGAAGTC TGG Intronic