ID: 1006151115

View in Genome Browser
Species Human (GRCh38)
Location 6:31990529-31990551
Sequence CCTGTAGGGTACCTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 3, 1: 4, 2: 10, 3: 28, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006151104_1006151115 19 Left 1006151104 6:31990487-31990509 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151103_1006151115 20 Left 1006151103 6:31990486-31990508 CCCACGTTGGGCGCCAGAATGTT 0: 3
1: 1
2: 2
3: 8
4: 67
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151108_1006151115 7 Left 1006151108 6:31990499-31990521 CCAGAATGTTGGGGACCAGCCTC 0: 3
1: 3
2: 3
3: 16
4: 160
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151102_1006151115 21 Left 1006151102 6:31990485-31990507 CCCCACGTTGGGCGCCAGAATGT 0: 3
1: 2
2: 4
3: 8
4: 82
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141
1006151109_1006151115 -8 Left 1006151109 6:31990514-31990536 CCAGCCTCAACACCACCTGTAGG 0: 7
1: 20
2: 21
3: 29
4: 214
Right 1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG 0: 3
1: 4
2: 10
3: 28
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006151115 Original CRISPR CCTGTAGGGTACCTGAAGTC TGG Intronic
900342321 1:2194893-2194915 CCTGTAGGGAAACTGAGGCCAGG + Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
905695509 1:39970580-39970602 CCTGTGGGGTCCCTGGAGACTGG + Intergenic
905927694 1:41763492-41763514 GCTGTAGGGGACATGAAGTCAGG - Intronic
906375204 1:45290944-45290966 CCTGCAGATTACCTGAGGTCAGG + Intronic
909177218 1:72376560-72376582 CCAGCAGAGTACCTGAAGTATGG - Intergenic
912319876 1:108703154-108703176 CCAGTAGGTCACCTGAGGTCAGG + Intergenic
914430024 1:147612651-147612673 ACTGTAGGGTTCCTGAAACCTGG + Intronic
915381782 1:155448250-155448272 TCTGTAGCATAACTGAAGTCAGG + Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
916562509 1:165945292-165945314 CCTGTAGGTTCCCTGAAAGCAGG + Intergenic
918725482 1:187916503-187916525 CCTGCAGGGCACCAGAAGCCAGG + Intergenic
920365073 1:205444010-205444032 GCTGGAGGCTCCCTGAAGTCAGG + Intronic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
1065381740 10:25097550-25097572 CCTGTATGGTACTTGGAGCCAGG - Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067925472 10:50504151-50504173 CATGCAGGGTACCTGAAACCAGG + Intronic
1070103342 10:73409751-73409773 CTTGTAGTGTATTTGAAGTCTGG - Intronic
1074931026 10:118126375-118126397 CTTGTAGTGTACTTGAAGTCAGG + Intergenic
1075012984 10:118890824-118890846 TCTCTAGGGTACCCGAAGTGAGG - Intergenic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1076616572 10:131759094-131759116 GCTGTGGGGCTCCTGAAGTCCGG - Intergenic
1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1096243420 12:49971577-49971599 GCTGCAGGGTCCCTGAAGGCAGG + Intronic
1096892451 12:54785796-54785818 CCTTTAGGGAACCTGAAAACAGG - Intergenic
1098141641 12:67455831-67455853 CCTATAGGGGACATGAAGTGAGG + Intergenic
1102443896 12:112986639-112986661 CCATTAGGGAACCTGAAGACAGG - Intronic
1102692075 12:114769291-114769313 GCGGGAGGGTACCTGAGGTCAGG - Intergenic
1103201059 12:119088303-119088325 CCTTTGCGGAACCTGAAGTCAGG - Intronic
1104402943 12:128491765-128491787 CCTGGAGGCAACCTGAAGTTGGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1105805545 13:23949951-23949973 GCTGAAGGGGACCTGCAGTCAGG + Intergenic
1112397106 13:99043350-99043372 GCTGTAGGCTGCCTGAAGCCTGG + Intronic
1113939899 13:114013221-114013243 ACTGCAGTGTACCTGACGTCCGG + Exonic
1114438020 14:22724152-22724174 ACTGTTGGGTACCTCAAGTGTGG + Intergenic
1116524979 14:45892711-45892733 CATGTAGGGTAGAAGAAGTCAGG + Intergenic
1118333664 14:64833711-64833733 ACTGTAAGCTACCTGAGGTCAGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1121009492 14:90511668-90511690 CCTCTAGGGTGCCTGGATTCTGG - Intergenic
1123911451 15:24972026-24972048 CCGGCAGGTCACCTGAAGTCAGG + Intronic
1125035626 15:35121161-35121183 CCTGCAGGCTACCTGGAGCCCGG + Intergenic
1125250363 15:37695151-37695173 CCTTAAGGGTACATGAAGCCAGG + Intergenic
1125886871 15:43235826-43235848 CCTGGAGGGATCCTGAAGTTGGG + Exonic
1126481730 15:49131206-49131228 CATGTAGTGTACATGAAGCCTGG - Intronic
1128991932 15:72267977-72267999 CCGGTAGGTCACCTGAAGTCGGG - Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134511966 16:14855759-14855781 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134563940 16:15234995-15235017 CGAGTAGATTACCTGAAGTCAGG + Intergenic
1134699607 16:16254259-16254281 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134738554 16:16521701-16521723 CGAGTAGATTACCTGAAGTCAGG - Intergenic
1134928946 16:18190459-18190481 CGAGTAGATTACCTGAAGTCAGG + Intergenic
1134972222 16:18540412-18540434 CCTGTAAGTTCCCTGAGGTCAGG - Intronic
1135061887 16:19278007-19278029 TCTGTAGGCTAACTCAAGTCTGG + Intergenic
1135548227 16:23379749-23379771 CCTGTAGGGAACTGGTAGTCAGG + Intronic
1140196924 16:72862774-72862796 CTTGTAGGATCCCTGCAGTCGGG - Intronic
1141772826 16:86101411-86101433 CCTGTAGGTTACCTGCGGTCCGG - Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1151029135 17:70715281-70715303 CCGGTGGGTCACCTGAAGTCAGG + Intergenic
1155646220 18:28081099-28081121 CCTGTGGTGTACAGGAAGTCAGG - Intronic
1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG + Intronic
1158895121 18:61905534-61905556 CCTGTAGGGTTTGTGAACTCAGG - Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG + Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164157214 19:22603978-22604000 CCTGTGGGGCACCTGCACTCTGG - Intergenic
1164272183 19:23682959-23682981 CCAGCAGGTCACCTGAAGTCAGG + Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167800904 19:51741091-51741113 CAGGTAGGTTACCTGAGGTCAGG - Intergenic
926226225 2:10968707-10968729 CCTGTAAGCTACTCGAAGTCGGG - Intergenic
927579190 2:24226142-24226164 CGTGTTGGCTACCTGCAGTCAGG + Intronic
929009592 2:37427873-37427895 CCTGGAGGGTTCTTCAAGTCAGG + Intergenic
929654397 2:43716126-43716148 GCTGGAGGGAACCTGGAGTCAGG + Intronic
933210122 2:79556936-79556958 CATGTAGGGTAACTTAACTCAGG - Intronic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
934651072 2:96091705-96091727 CCTGCAGGGCACATGCAGTCTGG - Intergenic
934886429 2:98029445-98029467 CCTGCAGGGTCCCTGAGGCCAGG + Intergenic
937866437 2:126754646-126754668 CCTGGAGGGCACCTTAACTCAGG - Intergenic
938183665 2:129208020-129208042 CGGGTAGATTACCTGAAGTCAGG + Intergenic
939193456 2:138943292-138943314 CCTGTAGGTTAGTTGAAGTGTGG + Intergenic
940330987 2:152474455-152474477 CATGTAGATCACCTGAAGTCAGG + Intronic
942153312 2:173100671-173100693 TCTGTAGGGTTCCTGATGTCTGG + Intronic
942616383 2:177795586-177795608 CTTCTTGGGTACCTAAAGTCAGG + Intronic
1169032900 20:2425576-2425598 TCTTAAAGGTACCTGAAGTCAGG + Intronic
1169978032 20:11352863-11352885 CCTGTTGAGTACCTGAAATGAGG + Intergenic
1170550374 20:17471275-17471297 CCTGTAAGGAATCTGAGGTCCGG + Intronic
1173230458 20:41192210-41192232 CCTCTTGGGTACCTGAGGTTGGG - Intronic
1174615217 20:51830206-51830228 CTTGGATGGTACCTGTAGTCTGG - Intergenic
1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG + Intergenic
1180169453 21:46050344-46050366 CCTGCTGGGTCCCTGAAGTGAGG + Intergenic
1181142732 22:20818952-20818974 CCTGTAGGGTATTTGATGTTTGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
950861751 3:16153830-16153852 CCTCTAGGGTACCTCAAATGAGG + Intergenic
951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG + Intronic
952443959 3:33362202-33362224 CGTGTAGTTTACCTGAAGTTTGG + Intronic
953319421 3:41958998-41959020 CAGGTAGGTCACCTGAAGTCAGG + Intronic
955284266 3:57623822-57623844 CATGTAGGATCCATGAAGTCCGG + Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
956183292 3:66537646-66537668 CCTGTATCCAACCTGAAGTCTGG - Intergenic
957491235 3:80930108-80930130 CATGTAGGGTACCTTTTGTCAGG - Intergenic
962917576 3:139918436-139918458 CCTGTTTGGAACCTGAAGCCTGG + Intergenic
967914673 3:194569781-194569803 CGTGTGGGTCACCTGAAGTCAGG + Intergenic
968660717 4:1797716-1797738 CCTGTAGGGACCCCGCAGTCAGG - Intronic
968791687 4:2669068-2669090 CGGGTAGGTCACCTGAAGTCAGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
970674305 4:18431412-18431434 CGGGTAGATTACCTGAAGTCAGG - Intergenic
970798330 4:19942105-19942127 CATTTAGGGTACTTGAAGACTGG - Intergenic
971635041 4:29047414-29047436 CCTGAAGGGCTCCTCAAGTCCGG - Intergenic
972636196 4:40886249-40886271 CATGTAGAGCACCTGAGGTCAGG + Intronic
972891475 4:43561416-43561438 CAGGCAGGTTACCTGAAGTCGGG + Intergenic
973810780 4:54568068-54568090 ACTGGGGGCTACCTGAAGTCTGG - Intergenic
976512852 4:85930923-85930945 CCTGTACGATGCCTGAAGACCGG + Intronic
977623883 4:99168571-99168593 CTTGTAGGATACTTGAAGTCTGG + Intergenic
978470200 4:109057507-109057529 CCGGCAGGTCACCTGAAGTCAGG - Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
983887388 4:172995547-172995569 CCTGAAAGGTACTTTAAGTCAGG - Intronic
985504406 5:270937-270959 CCAGTGGATTACCTGAAGTCGGG - Intergenic
987562160 5:19538622-19538644 CCTGTAGGGAAGCTGATGTTTGG - Intronic
988863852 5:35313398-35313420 TCTGTGGGATAGCTGAAGTCAGG + Intergenic
989406107 5:41062888-41062910 CCTGTAAGCAACCTGAAGTAAGG + Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
993070824 5:83161357-83161379 CCTGTGGATTACCTGAGGTCAGG - Intronic
997653110 5:135536380-135536402 CCTGGAGGGTACTTGGAGTTTGG + Intergenic
998938530 5:147256278-147256300 CCTGCAGGGTACCAGACTTCGGG + Intronic
1003200255 6:3953173-3953195 CCTGTAGTATAGTTGAAGTCAGG + Intergenic
1003820683 6:9893396-9893418 CGGGTGGGTTACCTGAAGTCAGG + Intronic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1004278016 6:14255183-14255205 GCTGTGGGTTACCTGAGGTCAGG + Intergenic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1010105800 6:72165861-72165883 CCAGTAGGATACCAGAGGTCAGG - Intronic
1012194723 6:96327029-96327051 CCTGTAGTATAGCTGGAGTCAGG - Intergenic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG + Intronic
1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG + Intronic
1030278064 7:107741296-107741318 CCTGTAGGATCCTTGAAGTAGGG + Intergenic
1031724918 7:125226356-125226378 CCTGTAGTGCAGCAGAAGTCTGG - Intergenic
1034612569 7:152385182-152385204 CCTGTAGAGTTCCTGTAGTCAGG - Intronic
1035885123 8:3283305-3283327 CATGTAGGGAACCTGGAATCGGG + Intronic
1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1040536619 8:48316417-48316439 GTTGTAGGGTTCCTGAAGGCAGG - Intergenic
1041144712 8:54861827-54861849 CGGGTAGATTACCTGAAGTCAGG - Intergenic
1044072435 8:87778657-87778679 CCTCCTGGGTACCTGAGGTCAGG + Intergenic
1045088626 8:98714868-98714890 CTTGTAGTGTATTTGAAGTCAGG - Intronic
1046611668 8:116432563-116432585 CATGTAGGCTCCTTGAAGTCTGG - Intergenic
1047564959 8:126034002-126034024 ACTGTAAAGTACCTCAAGTCTGG + Intergenic
1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG + Intergenic
1049753328 8:144296175-144296197 CCTGAGGGGTCCCTGAAGTAAGG + Intronic
1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG + Exonic
1051099311 9:13502831-13502853 CCTGCAGGGAACTTGAAGGCTGG - Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057807897 9:98233673-98233695 CATGTAGGGTGCCTGGAGTCTGG - Intronic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1060091298 9:120746311-120746333 CAGGTAGATTACCTGAAGTCAGG + Intergenic
1061077345 9:128349709-128349731 CCTCCAGGGAACCTCAAGTCTGG + Intronic
1188708081 X:33359897-33359919 CCGGTAGATTACCTGAGGTCAGG + Intergenic
1189232193 X:39461201-39461223 GATGTAGGGTACCTGGATTCTGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1191931839 X:66382154-66382176 CTTGCAGGGTTCCTGAAGGCAGG + Intergenic
1192705538 X:73526067-73526089 CCTGTAGGATCCCTGAAGCCAGG - Intergenic
1193364022 X:80608867-80608889 TCTGTAGGGTACCTGTGGTGTGG - Intergenic
1194773660 X:97936053-97936075 CCTTTAGGCTTCCAGAAGTCTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1199475981 X:148245722-148245744 CTTGTAGGGTTCCTGGAGTATGG + Intergenic
1200706551 Y:6447819-6447841 CCTGAAGGGTCCCTGAGGTCGGG - Intergenic
1200914281 Y:8557614-8557636 CCTGAAGGGGCCCTGAGGTCAGG + Intergenic
1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic
1202180163 Y:22132980-22133002 CCTGGAGGGTCCCTGAGGTTGGG - Intergenic
1202211197 Y:22453419-22453441 CCTGGAGGGTCCCTGAGGTTGGG + Intergenic