ID: 1006153774

View in Genome Browser
Species Human (GRCh38)
Location 6:32003165-32003187
Sequence ACCTGAGGATTGCACAACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006153774_1006153778 4 Left 1006153774 6:32003165-32003187 CCGGAGTTGTGCAATCCTCAGGT No data
Right 1006153778 6:32003192-32003214 CAGTGTCTTCTTCCAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006153774 Original CRISPR ACCTGAGGATTGCACAACTC CGG (reversed) Intergenic
No off target data available for this crispr