ID: 1006155047

View in Genome Browser
Species Human (GRCh38)
Location 6:32009370-32009392
Sequence GCGCGTGGACCTGCGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006155047_1006155054 4 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155054 6:32009397-32009419 AGTAGTCACCTGCCTGTGTCAGG No data
1006155047_1006155061 29 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155061 6:32009422-32009444 GTGCAGGGCCTCATTGCCTGGGG No data
1006155047_1006155060 28 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155060 6:32009421-32009443 TGTGCAGGGCCTCATTGCCTGGG No data
1006155047_1006155056 13 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155056 6:32009406-32009428 CTGCCTGTGTCAGGCTGTGCAGG No data
1006155047_1006155059 27 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155059 6:32009420-32009442 CTGTGCAGGGCCTCATTGCCTGG No data
1006155047_1006155062 30 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155062 6:32009423-32009445 TGCAGGGCCTCATTGCCTGGGGG No data
1006155047_1006155057 14 Left 1006155047 6:32009370-32009392 CCCCAGCCCGCAGGTCCACGCGC No data
Right 1006155057 6:32009407-32009429 TGCCTGTGTCAGGCTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006155047 Original CRISPR GCGCGTGGACCTGCGGGCTG GGG (reversed) Intergenic
No off target data available for this crispr