ID: 1006156513

View in Genome Browser
Species Human (GRCh38)
Location 6:32015787-32015809
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006156513_1006156517 0 Left 1006156513 6:32015787-32015809 CCCTGCTCCCTCTGTGGAGTTTG 0: 2
1: 0
2: 0
3: 22
4: 244
Right 1006156517 6:32015810-32015832 ACCCACCCTCCCCTTGCACATGG 0: 2
1: 0
2: 0
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006156513 Original CRISPR CAAACTCCACAGAGGGAGCA GGG (reversed) Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
903890447 1:26566783-26566805 GAAACAACACAGAGGGAGCCTGG - Intronic
905363842 1:37438187-37438209 GAGACTTCCCAGAGGGAGCAAGG - Intergenic
905506974 1:38487695-38487717 CAAACTCCACATGGGGTGCTTGG - Intergenic
909538365 1:76764000-76764022 CAGACCCTTCAGAGGGAGCATGG - Intergenic
910252024 1:85207987-85208009 CAATCTCAACAGAGAAAGCAGGG - Intergenic
914827272 1:151145363-151145385 CACCTTCCTCAGAGGGAGCAGGG + Intronic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
916470756 1:165119947-165119969 CAAAGTGCACAGTGGGAGCAGGG + Intergenic
916832227 1:168504779-168504801 AAAACTCTACAGAGCCAGCATGG - Intergenic
917211964 1:172640698-172640720 CAAACTCCAGGGAGGGAAGAGGG + Intergenic
920748771 1:208654330-208654352 CTAACTCCACAGAGTGAAGAGGG + Intergenic
921047634 1:211488805-211488827 CAGACTCCACGGAGGGAATATGG - Intronic
922610525 1:226923781-226923803 CACAGTCCAAAGAGGGAGCAGGG + Intronic
922714903 1:227864249-227864271 CAAACTCAATAGAATGAGCATGG + Intergenic
923151513 1:231237629-231237651 CAAAGCCCTCAGAGGGAGCATGG + Intronic
923569068 1:235098409-235098431 CAAACTCTAGGGAGGGAGGAAGG + Intergenic
924078540 1:240367348-240367370 CAAGCTCCAAAGTGGGAGCAGGG - Intronic
924103547 1:240628362-240628384 CAAATTCCTCAGAGGGATCTTGG + Intergenic
1064690231 10:17909437-17909459 CAAATTCTACTGAGAGAGCAGGG - Intronic
1065901127 10:30209086-30209108 GAAAATCAACAGAGGAAGCATGG - Intergenic
1067076749 10:43191886-43191908 CAAACCCCACCGAGGGACCTAGG - Intergenic
1067668453 10:48298983-48299005 CAAAATTTACACAGGGAGCAAGG - Intergenic
1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG + Intronic
1069219494 10:65865573-65865595 CAAACTCTACCGAAGTAGCATGG - Intergenic
1070154072 10:73822831-73822853 CAAACTAGACAGAGAGAACAGGG - Intronic
1070158330 10:73850354-73850376 CAAACTCCTGACAGGGAGCGGGG + Intronic
1070679238 10:78437112-78437134 CGAAGACCACAGAGGGAGCAGGG - Intergenic
1070736166 10:78865234-78865256 GTAACTCCCCAAAGGGAGCAGGG - Intergenic
1072470887 10:95712024-95712046 CAGATTCCACAGAGGGAGAGAGG - Intronic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1076287132 10:129311355-129311377 CACACACCAGAGAGGGAGCTGGG + Intergenic
1076450003 10:130550928-130550950 CACACTGCACTGTGGGAGCAGGG - Intergenic
1077194198 11:1271119-1271141 CCCACTCCACAAAGCGAGCAGGG + Intergenic
1077657038 11:4029402-4029424 CAAACTCCACAAAGAGACAATGG - Intronic
1078029457 11:7734906-7734928 CAAACTGCAAGGAGGCAGCAAGG + Intergenic
1078540222 11:12207119-12207141 CAAATCCCACAGAGAGAGGAAGG - Intronic
1078862166 11:15258920-15258942 CAAATTCCAAAGAGAGAGGAAGG + Intergenic
1079605291 11:22357850-22357872 CAAACAGCACAGAGGAAGAATGG + Intronic
1080274477 11:30488027-30488049 CAAACTCCGCAAAGGAAGCCTGG + Intronic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1083535546 11:63463802-63463824 CAAATGGCACAGAGGGAGGAAGG - Intronic
1084116363 11:67045098-67045120 CAGACTCCAAAAAGGGACCAGGG + Intronic
1084426236 11:69085852-69085874 CAAGTTCCACAGAGTGACCAGGG - Exonic
1084768574 11:71327905-71327927 CCAACACCACAGAGGGAGGAGGG - Intergenic
1085181252 11:74538639-74538661 CAAGCCCCACAGAGGGAGAAGGG - Intronic
1086559717 11:88153967-88153989 CAAATTCCAGGGAGGGAACATGG + Intronic
1088470977 11:110187344-110187366 CAAACTCCATACAGGAAGGATGG - Intronic
1089890340 11:121874485-121874507 CAAATGCCACAGAGCGAGCAGGG + Intergenic
1090268971 11:125372329-125372351 CAAACCCCACCTAGGGAGCCAGG + Intronic
1091347962 11:134867959-134867981 CAGAGCCCACACAGGGAGCATGG + Intergenic
1092536943 12:9398044-9398066 CAAAGTCCACAGAAGTAGCTTGG + Intergenic
1092783571 12:12008664-12008686 AAAACTCTACAGAGAGGGCATGG + Intergenic
1093309811 12:17564812-17564834 CAAACTGCAAGGAGGCAGCAAGG - Intergenic
1093314234 12:17628244-17628266 CAAACTGCAAGGAGGCAGCAAGG - Intergenic
1093624673 12:21331178-21331200 GAAACTCCACAGAGAAAGAAAGG + Intronic
1093916001 12:24803204-24803226 CAGACACCAGAGAGTGAGCAAGG - Intergenic
1094292582 12:28868770-28868792 CATACTTCAAAAAGGGAGCATGG - Intergenic
1094513559 12:31112642-31112664 CAAAGTCCACAGAAGTAGCTTGG + Intergenic
1096242929 12:49968854-49968876 CTAACTACACACAGGGAGGAGGG + Intronic
1096713930 12:53479489-53479511 GAAACTACACAGATGGATCATGG - Exonic
1097465651 12:59921265-59921287 CAAACACCAGAGAGTGAGTAAGG - Intergenic
1097515110 12:60594700-60594722 CGAACACCAGAGAGTGAGCAAGG + Intergenic
1103932780 12:124459382-124459404 CAAACCCAACACTGGGAGCAGGG - Intronic
1104143055 12:126006758-126006780 CAAGTTCCACAAAGGGATCAAGG - Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1108407043 13:50114938-50114960 AGAGCTCCACAGAGGGATCAGGG - Intronic
1110795254 13:79629678-79629700 CAAACTCTAGGGATGGAGCAAGG + Intergenic
1111844931 13:93496122-93496144 CAAACTGCAAGGAGGCAGCAAGG - Intronic
1112402811 13:99090123-99090145 TAAAGTCATCAGAGGGAGCATGG + Intergenic
1113775906 13:112944428-112944450 CCAACTCCACAGAGAGACCCAGG - Intronic
1114354403 14:21891345-21891367 CAGACACCAAAGAGTGAGCAAGG - Intergenic
1117575540 14:57093553-57093575 GAAACTAGACAGAGTGAGCATGG + Intergenic
1121142449 14:91555209-91555231 CAGATTCCACAGAGCCAGCAGGG - Intergenic
1121814865 14:96921465-96921487 CAAAGCCTTCAGAGGGAGCACGG - Intronic
1122939959 14:104976851-104976873 CGACCTCCTCAGAGGGAGAAGGG - Intronic
1123572219 15:21625468-21625490 CAGACACCGCAGAGTGAGCAAGG - Intergenic
1123608833 15:22068055-22068077 CAGACACCGCAGAGTGAGCAAGG - Intergenic
1123940385 15:25213872-25213894 GAAAGCCCACAGAGGGAGCCTGG - Intergenic
1123943766 15:25229191-25229213 CCAACCCCACACAGGGAGCCTGG - Intergenic
1124496036 15:30187720-30187742 CAGCCTCAACAGCGGGAGCAGGG + Intergenic
1124747538 15:32350927-32350949 CAGCCTCAACAGCGGGAGCAGGG - Intergenic
1125591799 15:40858913-40858935 CCAAGGTCACAGAGGGAGCATGG - Intergenic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1128394599 15:67211282-67211304 CAACCTCAACAGTGGCAGCATGG + Intronic
1129963194 15:79708497-79708519 CAACCTCCAAAGAGTGAGCCAGG - Intergenic
1131040242 15:89257864-89257886 CATTCTCCACACAAGGAGCAAGG + Intronic
1131436816 15:92429573-92429595 GAAATTCAACAGAGGCAGCAAGG - Intronic
1202981074 15_KI270727v1_random:359855-359877 CAGACACCGCAGAGTGAGCAAGG - Intergenic
1132925483 16:2427192-2427214 TGAACTCCACAGAGAGAGAAAGG - Intergenic
1134836494 16:17365530-17365552 GAAACCCCACAGAGAGAACAAGG + Intronic
1135039368 16:19106135-19106157 GAAACTCCGCAGCTGGAGCAGGG - Intergenic
1138239139 16:55412337-55412359 CAAAGCCTGCAGAGGGAGCAAGG + Intronic
1138614963 16:58157986-58158008 CAGACTCCACAGTGGGGGGACGG - Exonic
1138956054 16:61971678-61971700 CAAACTCCAGGGAGGGAAGAGGG - Intronic
1140588212 16:76319803-76319825 CTAAGCCCACAGAGGGAGTATGG + Intronic
1141437637 16:84009456-84009478 TAGAGCCCACAGAGGGAGCATGG + Intergenic
1142129479 16:88426146-88426168 CCGCCTCCACAGAGGCAGCAGGG + Intergenic
1142637532 17:1267436-1267458 CAAATTCCACTTAGGAAGCAAGG - Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1148438501 17:47699715-47699737 CAAACATCACGGAGGGACCAGGG - Intronic
1149656155 17:58310584-58310606 CCAGCTCCACCCAGGGAGCACGG - Exonic
1152272968 17:79336005-79336027 CAAACAGCACAGAGGGAGGGCGG - Intronic
1154096108 18:11416681-11416703 GAAACATCACAGTGGGAGCAGGG + Intergenic
1155248961 18:23937666-23937688 AAGACTCCAGAGAGGGAGCAAGG + Intronic
1155369160 18:25079715-25079737 TTAACTCCACAGAGGGATAAGGG + Intronic
1155500436 18:26482122-26482144 CAATCACCACAGGGGCAGCATGG - Intronic
1155760117 18:29554647-29554669 AACACTCCACAGAGGGAAAACGG - Intergenic
1157448584 18:47767738-47767760 CAAAATCCACAGAGGCACCCTGG + Intergenic
1157826003 18:50813139-50813161 CCAAATCCACCCAGGGAGCAAGG - Intronic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1159704999 18:71675223-71675245 CACACTCCACAGAGCCAGCAGGG - Intergenic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1160146590 18:76370587-76370609 CAAACACCACTGTGGGAACAAGG + Exonic
1160281867 18:77498758-77498780 TAAAGTCTGCAGAGGGAGCATGG - Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1162108231 19:8384023-8384045 AAAACATCACAGAGAGAGCAGGG + Intronic
1163152272 19:15422525-15422547 CAGGCCCCACAGAGGGAGCGTGG + Exonic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
925590908 2:5508043-5508065 CAGACTCCGCACAGGGAGCAGGG - Intergenic
925706248 2:6686677-6686699 CAAATTCCACAAAGGGGTCAAGG - Intergenic
926698565 2:15787482-15787504 GAAAGTCCACAGAGAAAGCAGGG + Intergenic
928410131 2:31048306-31048328 CAAAAGCCACAGAGCCAGCAGGG - Intronic
928438616 2:31272877-31272899 CCAACTCCACAGAGAGAGTCTGG + Intergenic
928759160 2:34561029-34561051 CAAACTGCAAAGTGGCAGCAAGG - Intergenic
930221767 2:48753372-48753394 CAACCTCCACAGAGTGACAAGGG + Intronic
934746713 2:96764065-96764087 CAAACACCACAGAGGCAGTGAGG - Intronic
934757343 2:96833226-96833248 CAGCCTCCAGGGAGGGAGCAGGG - Exonic
935361997 2:102253127-102253149 CAAACTCCCCAGATGGAACCAGG - Intergenic
936236722 2:110748449-110748471 CAAAGTCTACAAAGGTAGCAGGG - Intronic
940223971 2:151382749-151382771 CACTCTCCAAAGAGGGAGCCTGG + Intergenic
946357334 2:219196281-219196303 CAAACTCCTCAGACTGTGCAGGG + Intronic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
1169010162 20:2243865-2243887 CAAAATCCATAAAGGGAGAAGGG + Intergenic
1169820631 20:9705873-9705895 CAAGCTCCTCAGAGGCAGAATGG - Intronic
1170131751 20:13028041-13028063 CAAACTCAACAAAGGAACCAAGG - Intronic
1171065394 20:22009835-22009857 CAAACTGCAAGGAGGCAGCAAGG + Intergenic
1173222347 20:41140356-41140378 CAACCTCCTCAGAGGCCGCAGGG - Intronic
1173262212 20:41446641-41446663 CTATCCCCACAGAGGGAGCTGGG - Intronic
1173528756 20:43752381-43752403 CCAAGGCCACACAGGGAGCAAGG + Intergenic
1175990042 20:62784229-62784251 GAAACCCCACAGCGGGAGCGAGG - Intergenic
1176155138 20:63615800-63615822 GAACCCCCACAAAGGGAGCATGG - Intronic
1176256268 20:64154723-64154745 CAAACCCCACTGAGGAAGCCAGG - Intronic
1176948823 21:15018978-15019000 CAAACTACACATAGGGAAGAGGG - Intronic
1177956661 21:27606555-27606577 CACAGTCCACAGAGAAAGCATGG + Intergenic
1179095643 21:38312248-38312270 AAAATACCTCAGAGGGAGCATGG - Intergenic
1179257041 21:39726216-39726238 CAAAGTCCACACAGGAATCAAGG - Intergenic
1181496909 22:23292332-23292354 GAAATTCCACAGAGCGGGCAGGG + Intronic
1181883864 22:26003355-26003377 CAAACTGGACAGAGAGAGCCAGG - Intronic
1185213405 22:49584943-49584965 CAAGCACCCCAGAGGGTGCAGGG + Intronic
950380121 3:12606064-12606086 CAAGTTCCACAGAAGCAGCAAGG + Intronic
950422309 3:12906314-12906336 CAAGCTCCCCAGCGGCAGCATGG - Intronic
952572336 3:34732082-34732104 CAAATTCCTCAGAGTCAGCAGGG - Intergenic
952632212 3:35482840-35482862 CAAACTCCAAGGTGGGAGCGAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953876009 3:46667300-46667322 CATACTCCAGACAGGGAACAGGG + Intergenic
957118709 3:76060883-76060905 CAAATTCCACGGTGGGAACAGGG - Intronic
960157888 3:114316626-114316648 TAAAATATACAGAGGGAGCAGGG - Intergenic
961041229 3:123679876-123679898 CACACTTAACAGAGGCAGCAGGG + Intronic
961291497 3:125850219-125850241 CAAACTGCAAGGAGGCAGCAAGG + Intergenic
963117645 3:141745497-141745519 CACACACCACAGAGGTAGGAAGG - Exonic
964451888 3:156821294-156821316 AAAACTGTACAAAGGGAGCATGG - Intergenic
965623908 3:170668099-170668121 CAAACTGCAAAGTGGCAGCAAGG - Intronic
967144282 3:186593044-186593066 CAGACTCCCCAGATGGTGCAGGG - Intronic
967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG + Intergenic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
969655616 4:8496217-8496239 TACACTCCACAGTGGGAGCAGGG - Intergenic
969671586 4:8592958-8592980 CACACTCCCCAGAGGTTGCAGGG - Intronic
970542738 4:17095911-17095933 CTTACTCCACAGGGGGAGCCTGG - Intergenic
971018592 4:22512726-22512748 TAAAGTCCTCAGAGAGAGCATGG + Intronic
971659543 4:29394416-29394438 CAAACTCCAGAGAGGAAAGAGGG - Intergenic
972574776 4:40341672-40341694 CACACTCCACAGAGTGGGTATGG - Intronic
975250927 4:72176853-72176875 CAGACTTCAGAGAGAGAGCATGG - Intergenic
977002103 4:91518037-91518059 CAGAGCCCTCAGAGGGAGCATGG - Intronic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
980822499 4:138035991-138036013 CAATCTCCTCAGAGGGACAATGG + Intergenic
982373487 4:154660242-154660264 CATGCTCAACAGAGGGAACAAGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
987624362 5:20378412-20378434 CAAACTCCTCAGAAGGAGGATGG + Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
989768767 5:45117516-45117538 CAAACTGCAAAGTGGCAGCAAGG - Intergenic
990302314 5:54461156-54461178 CAAACTGCACTGAGGTATCAGGG + Intergenic
993756877 5:91742660-91742682 CAGGCTCCCTAGAGGGAGCAAGG - Intergenic
996359200 5:122626899-122626921 CAAATTCCACTGAGGCATCAAGG + Intergenic
998160932 5:139812661-139812683 CCACCTCCTCAGAGAGAGCAGGG - Intronic
998804580 5:145906156-145906178 CACACTCCACAGACTGAGAAGGG - Intergenic
998877889 5:146618840-146618862 CAAACTCCTCAGAGACATCAGGG + Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
999639895 5:153662144-153662166 CAAACACCAAAGAGTAAGCAAGG - Intronic
999877212 5:155820919-155820941 CATAGACCACAGAGAGAGCATGG + Intergenic
1003105601 6:3212820-3212842 GAAACTTCACAGAGAGAGCTTGG + Intergenic
1003393495 6:5733131-5733153 CAATCTCCGCAGAGGCAGAAGGG - Intronic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004910614 6:20279278-20279300 AAAACTCCAAAGAGGGAGGAAGG - Intergenic
1005061115 6:21777889-21777911 CAAACCTCACAGAGGGAGGGAGG - Intergenic
1006150212 6:31983049-31983071 CAAACTCCACAGAGGGAGCAGGG - Intronic
1006156513 6:32015787-32015809 CAAACTCCACAGAGGGAGCAGGG - Intronic
1007770282 6:44186547-44186569 AAAAGTCCCCAGAGAGAGCAGGG + Intergenic
1007904143 6:45442432-45442454 CCAAGTCCACAGATGGAACAAGG - Intronic
1010240902 6:73614608-73614630 CAAACTCCAGAGAGGGGAGAGGG + Intronic
1010276995 6:73980144-73980166 GAAACTCCTCAGAGGCAGTAGGG + Intergenic
1010790060 6:80054092-80054114 CAAACTGCAAAGTGGCAGCAAGG - Intergenic
1011264511 6:85501076-85501098 TAAACTCCACAGATGAAGTAAGG + Intergenic
1013275505 6:108581060-108581082 CAACTTCCACAGAAGGGGCAGGG - Intronic
1015602502 6:134924115-134924137 CAAAATCCAAATAGGGAGCTGGG + Intronic
1015867154 6:137739266-137739288 CAAACCCCAGAGAGTGAGGAAGG - Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016686274 6:146885879-146885901 CAAACTCCAGAAAAGGAACAAGG + Intergenic
1018028363 6:159822832-159822854 CAAGCTCCACACAGGCAGGATGG + Intergenic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1018388818 6:163327807-163327829 CAATCTCCACAGAGGGCCCAGGG - Intergenic
1021320546 7:19205010-19205032 CACACTCCACAGAGTGGGAAAGG + Intergenic
1022987656 7:35674673-35674695 CAACCTCCAGAGAGGGAGAGTGG + Intronic
1023613879 7:41998935-41998957 CACACTCCATAGAGGGTGAAAGG - Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024453373 7:49575421-49575443 CAAATTTCACCCAGGGAGCAAGG - Intergenic
1027231935 7:76277787-76277809 CAAACTCCAGAGTTGGAGCCAGG + Intronic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1030090264 7:105852075-105852097 GGAACTTCACAGAGGGAGGATGG - Intronic
1031000450 7:116409266-116409288 CAAACTGCAAGGAGGCAGCAAGG + Intronic
1031601424 7:123715308-123715330 CAAAGACCACATAGAGAGCAAGG + Intronic
1032502428 7:132409989-132410011 TCAATTCCAAAGAGGGAGCAGGG - Intronic
1034227259 7:149493795-149493817 GAAACTCAACACAGGGAGAAGGG + Intronic
1034390617 7:150784793-150784815 CAAACTTCACAGAGAAAGCCTGG - Intergenic
1034470655 7:151252658-151252680 CCAGCTCCAGAGAGGGAGGAGGG + Intronic
1037992289 8:23329647-23329669 TCAACTCCACAGAGGGAGTGAGG + Intronic
1038521178 8:28233445-28233467 CAAACTCCCCAGAGAGAAGATGG - Intergenic
1039845073 8:41320372-41320394 CATACTCCACAGAGGGATTGAGG - Intergenic
1042837498 8:73091829-73091851 CAAACAGCACAGAGGCAGGAGGG + Intronic
1042987756 8:74603219-74603241 GAAACTACACAGATGGATCATGG + Intronic
1044317064 8:90762548-90762570 CAAATTCCAAAAAGGGAACATGG - Intronic
1044533989 8:93338984-93339006 CAAAACCTTCAGAGGGAGCATGG - Intergenic
1044622984 8:94208945-94208967 CAAACACAAAAGACGGAGCAGGG + Intronic
1044697618 8:94938555-94938577 CAAACTCCAGAGAGGGGAGAGGG + Intronic
1046122038 8:109859040-109859062 CAAACTGCAAGGAGGCAGCAAGG + Intergenic
1046913675 8:119657360-119657382 CAAACTCAATAGAGGAGGCATGG - Intronic
1048879029 8:138858100-138858122 CAAACAGAACAGAGGCAGCAAGG - Intronic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1053286818 9:36855114-36855136 CAAACTCCACTGCGGCATCACGG + Intronic
1055180094 9:73376828-73376850 CAAAAGGCACAGGGGGAGCAGGG - Intergenic
1055380227 9:75698711-75698733 CAAAGCCTTCAGAGGGAGCAGGG - Intergenic
1056052492 9:82784042-82784064 AAAAAGCGACAGAGGGAGCACGG - Intergenic
1057789062 9:98110656-98110678 CTCACTCCCCACAGGGAGCAGGG + Intronic
1058541081 9:106013408-106013430 GAAACTTCACTGGGGGAGCATGG + Intergenic
1058766186 9:108184925-108184947 CACACACCACAGAGGGACCTGGG - Intergenic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1060238352 9:121882527-121882549 AAAACACCACAGAGAGTGCATGG - Intronic
1061144795 9:128791361-128791383 GAATCTGCACAGAGGGAGAAGGG - Exonic
1061954288 9:133953568-133953590 CAAAGTCCCCAGAGGGACCCTGG + Intronic
1185880697 X:3737906-3737928 CAAACTCAACAAAGAAAGCATGG + Intergenic
1186747201 X:12582506-12582528 CAAACTCCCCTGTGGGAGGAGGG + Intronic
1187602311 X:20845852-20845874 CAAACTGCAAGGAGGCAGCAAGG + Intergenic
1188877253 X:35445185-35445207 CAAACTCCAGGGAGGGAAGAGGG + Intergenic
1189542289 X:42004705-42004727 CAAACTGCAAAGCGGCAGCAAGG + Intergenic
1191064236 X:56330718-56330740 CAAACTGCACGGAGGCAGCGAGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1192433280 X:71126708-71126730 TGAACTCCACAGTGGGAGGATGG - Intronic
1192685946 X:73305301-73305323 CAAACTGCAAGGAGGCAGCAAGG - Intergenic
1192833806 X:74778302-74778324 CAAGCCCCACAGAAGGGGCAAGG - Intronic
1193495669 X:82208506-82208528 CAAGTTTCACAGAGGAAGCAAGG - Intergenic
1196167993 X:112555965-112555987 CAGACTCCTCAGAGCGAGCAAGG - Intergenic
1197614989 X:128680918-128680940 AAAACACCACACAGGGTGCAGGG + Intergenic
1199159222 X:144587602-144587624 AAGAATCCACACAGGGAGCAGGG + Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1199826332 X:151504186-151504208 CAAAGCCCAGAGAGGGAGCAAGG - Intergenic
1200208688 X:154335738-154335760 CAAACTCCACTAAGGATGCATGG + Intergenic