ID: 1006157416

View in Genome Browser
Species Human (GRCh38)
Location 6:32023267-32023289
Sequence CCTGTAGGGTACCTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006157409_1006157416 7 Left 1006157409 6:32023237-32023259 CCAGAATGTTGGGGACCAGCCTC 0: 3
1: 3
2: 3
3: 16
4: 160
Right 1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG No data
1006157404_1006157416 20 Left 1006157404 6:32023224-32023246 CCCACGTTGGGCGCCAGAATGTT 0: 3
1: 1
2: 2
3: 8
4: 67
Right 1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG No data
1006157405_1006157416 19 Left 1006157405 6:32023225-32023247 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG No data
1006157410_1006157416 -8 Left 1006157410 6:32023252-32023274 CCAGCCTCAACACCACCTGTAGG 0: 7
1: 20
2: 21
3: 29
4: 214
Right 1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG No data
1006157403_1006157416 21 Left 1006157403 6:32023223-32023245 CCCCACGTTGGGCGCCAGAATGT 0: 3
1: 2
2: 4
3: 8
4: 82
Right 1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006157416 Original CRISPR CCTGTAGGGTACCTGAAGTC TGG Intronic
No off target data available for this crispr