ID: 1006157776

View in Genome Browser
Species Human (GRCh38)
Location 6:32025120-32025142
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 2, 1: 0, 2: 0, 3: 27, 4: 690}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006157776_1006157778 -6 Left 1006157776 6:32025120-32025142 CCAGCTGGAGCTCAGCGTGGACG 0: 2
1: 0
2: 0
3: 27
4: 690
Right 1006157778 6:32025137-32025159 TGGACGGTGCCAAGCAGTACCGG 0: 2
1: 0
2: 2
3: 5
4: 62
1006157776_1006157781 1 Left 1006157776 6:32025120-32025142 CCAGCTGGAGCTCAGCGTGGACG 0: 2
1: 0
2: 0
3: 27
4: 690
Right 1006157781 6:32025144-32025166 TGCCAAGCAGTACCGGAACGGGG 0: 2
1: 0
2: 0
3: 0
4: 42
1006157776_1006157779 -1 Left 1006157776 6:32025120-32025142 CCAGCTGGAGCTCAGCGTGGACG 0: 2
1: 0
2: 0
3: 27
4: 690
Right 1006157779 6:32025142-32025164 GGTGCCAAGCAGTACCGGAACGG 0: 2
1: 0
2: 0
3: 2
4: 54
1006157776_1006157780 0 Left 1006157776 6:32025120-32025142 CCAGCTGGAGCTCAGCGTGGACG 0: 2
1: 0
2: 0
3: 27
4: 690
Right 1006157780 6:32025143-32025165 GTGCCAAGCAGTACCGGAACGGG 0: 2
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006157776 Original CRISPR CGTCCACGCTGAGCTCCAGC TGG (reversed) Exonic
900095618 1:938959-938981 GGTCCAGGCTGAGCTGGAGCAGG + Intronic
900113299 1:1018627-1018649 CGCCCACTCGGAACTCCAGCTGG + Intergenic
900318682 1:2071766-2071788 TGGCCACGCTGAGCTCCCACAGG - Intronic
901601501 1:10426675-10426697 CGCCCACCCGGAACTCCAGCTGG + Intergenic
901629809 1:10642605-10642627 CGTCCTCTCTGAGCCACAGCGGG - Intronic
902610073 1:17592075-17592097 TGTCCACCCTGAGCTCTCGCTGG + Intronic
903813484 1:26047379-26047401 TGTCTACTCTGAGCACCAGCAGG + Intergenic
905375605 1:37518296-37518318 CGCCCACCCGGAACTCCAGCTGG - Intergenic
905662671 1:39739331-39739353 CTAGCCCGCTGAGCTCCAGCGGG + Intronic
906083237 1:43107825-43107847 CGCCCACCCGGAACTCCAGCTGG + Intergenic
906409301 1:45566312-45566334 TGGCCAGGCTGACCTCCAGCTGG + Intronic
907393537 1:54174310-54174332 AGTCCAGGCTGAGCCCCAGGAGG - Intronic
907889470 1:58623476-58623498 CGCCCACCCGGAACTCCAGCTGG - Intergenic
908027780 1:59969980-59970002 CGCCCACCCGGAACTCCAGCTGG + Intergenic
908291310 1:62669934-62669956 CGCCCACCCGGAACTCCAGCTGG - Intronic
908888564 1:68817765-68817787 CGCCCACCCGGAACTCCAGCTGG - Intergenic
909377099 1:74952363-74952385 CGCCCACCCGGAACTCCAGCTGG + Intergenic
909904591 1:81178927-81178949 CGCCCACCCGGAACTCCAGCTGG + Intergenic
910609779 1:89128360-89128382 CGCCCACCCGGAACTCCAGCTGG + Intronic
910685732 1:89914274-89914296 CGCCCACCCGGAACTCCAGCTGG + Intronic
911205904 1:95091435-95091457 CGCCCACCCGGAACTCCAGCTGG - Intergenic
911839275 1:102660328-102660350 CGCCCACCCGGAACTCCAGCTGG + Intergenic
912166125 1:107044800-107044822 CGCCCACCCGGAACTCCAGCTGG - Intergenic
912312904 1:108641176-108641198 CGCCCACCCGGAACTCCAGCTGG + Intronic
913161089 1:116146871-116146893 CGCCCACCCGGAACTCCAGCTGG + Intergenic
913692138 1:121289420-121289442 CGCCCACCCGGAACTCCAGCTGG + Intronic
914203455 1:145506168-145506190 CGCCCACCCTGAACTCCGGCTGG + Intergenic
914438466 1:147681082-147681104 CGCCCACCCAGAACTCCAGCTGG + Intergenic
914482577 1:148079322-148079344 CGCCCACCCTGAACTCCGGCTGG + Intergenic
915261196 1:154678082-154678104 CGCCCACCCGGAACTCCAGCTGG - Intergenic
915764512 1:158349304-158349326 CGCCCACCCTGCACTCCAGCTGG + Intergenic
915865581 1:159494924-159494946 CGCCCACTCGGAACTCCAGCTGG + Intergenic
915895684 1:159809223-159809245 CCTGCACTCTGACCTCCAGCTGG - Exonic
915920599 1:159972997-159973019 CCTGCACTCTGACCTCCAGCTGG + Intergenic
916910136 1:169337393-169337415 CGCCCACCCGGAACTCCAGCTGG + Intronic
916960257 1:169882156-169882178 CGCCCACCCAGAACTCCAGCTGG - Intronic
917578575 1:176349586-176349608 CGCCCACCCGGAACTCCAGCTGG + Intergenic
917860492 1:179138885-179138907 CGCCCACCCGGAACTCCAGCTGG - Intronic
917933026 1:179837246-179837268 CGCCCACCCGGAACTCCAGCTGG + Intergenic
918225478 1:182477447-182477469 CGTCTGCCCTGAGATCCAGCAGG + Intronic
918659783 1:187074132-187074154 CGCCCACCCGGAACTCCAGCTGG + Intergenic
918792066 1:188841490-188841512 CGCCCACCCGGAACTCCAGCTGG + Intergenic
918853237 1:189718613-189718635 CGTCCACCCGGAACTCCAGCTGG + Intergenic
919091876 1:192986955-192986977 CGCCCACCCGGAACTCCAGCTGG - Intergenic
919167978 1:193919228-193919250 CGGCCACCCGGAACTCCAGCTGG + Intergenic
919201377 1:194358585-194358607 CGCCCACCCGGAACTCCAGCTGG + Intergenic
920306420 1:205020964-205020986 CCACCACGCAGAGCTCAAGCAGG - Exonic
920479462 1:206307768-206307790 CGCCCACCCGGAACTCCAGCTGG + Intronic
920731393 1:208488754-208488776 CGCCCACCCGGAACTCCAGCTGG + Intergenic
920756654 1:208739723-208739745 CGCCCACCCAGAACTCCAGCTGG - Intergenic
920882921 1:209897276-209897298 CGTCCATGCTGTGCTGAAGCTGG + Intergenic
920883174 1:209899116-209899138 CGCCCACCCGGAACTCCAGCTGG + Intergenic
921396413 1:214673462-214673484 CGCCCACCCGGAACTCCAGCTGG + Intergenic
921903873 1:220476010-220476032 CGCCCACCCAGAACTCCAGCTGG + Intergenic
921983703 1:221285974-221285996 CGCCCACCCGGAACTCCAGCTGG + Intergenic
922056804 1:222049791-222049813 CGCCCACCCGGAACTCCAGCTGG - Intergenic
922423185 1:225472751-225472773 CGCCCACCCGGAACTCCAGCTGG - Intergenic
922485400 1:225969814-225969836 CGCCCACCCGGAACTCCAGCTGG - Intergenic
922540880 1:226418455-226418477 CCTCCACCCTGAGCCCCAGGAGG - Intergenic
922855767 1:228773750-228773772 CGCCCACCCGGAACTCCAGCTGG - Intergenic
923157259 1:231289791-231289813 CGCCCACCCAGAACTCCAGCTGG + Intergenic
923324835 1:232871760-232871782 CGCCCACCCGGAACTCCAGCTGG + Intergenic
924117495 1:240762535-240762557 CGCCCACCCGGAACTCCAGCTGG - Intergenic
924219262 1:241855893-241855915 CGCCCACCCGGAACTCCAGCTGG + Intronic
1063663181 10:8047654-8047676 CGTCCCGGCTGAGGTCCACCGGG + Intergenic
1063769670 10:9183394-9183416 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1063889524 10:10615359-10615381 CATCCCCGCTGAGGTCCAGGAGG + Intergenic
1064197763 10:13259650-13259672 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1064790382 10:18951593-18951615 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1065802584 10:29366239-29366261 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1066190234 10:33049270-33049292 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1066234018 10:33468078-33468100 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1066567427 10:36734935-36734957 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1068373995 10:56155167-56155189 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1068863143 10:61867689-61867711 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1068902088 10:62280422-62280444 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1068978111 10:63033633-63033655 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1069186549 10:65429732-65429754 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1071003730 10:80859280-80859302 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1071085382 10:81863003-81863025 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1071963805 10:90832491-90832513 CGCCCACCCGGAACTCCAGCTGG + Intronic
1073789795 10:106928409-106928431 CGCCCACCCGGAACTCCAGCTGG + Intronic
1076261685 10:129071668-129071690 CGTCCACCCGGAACTCCAGCTGG + Intergenic
1076560877 10:131362567-131362589 CGTGCACGCTGAGCACCACTGGG - Intergenic
1076581733 10:131516640-131516662 GGTCTGCCCTGAGCTCCAGCAGG + Intergenic
1076779493 10:132716346-132716368 CGTCGACGCTTGCCTCCAGCTGG - Intronic
1077036618 11:498536-498558 CGGCCAGGCTGAGCTCCTTCAGG + Exonic
1077539734 11:3140851-3140873 CGCCCATGCAGAGCTGCAGCTGG + Intronic
1077603222 11:3588772-3588794 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1077805736 11:5589924-5589946 CGCCCACCCGGAACTCCAGCTGG - Intronic
1077815591 11:5682992-5683014 CGCCCACCCGGAACTCCAGCTGG - Intronic
1078301225 11:10133620-10133642 CGCCCACCCGGAACTCCAGCTGG + Intronic
1078743718 11:14091643-14091665 CGCCCACCCAGAACTCCAGCTGG + Intronic
1079726245 11:23883747-23883769 CGCCCACCCAGAACTCCAGCGGG + Intergenic
1079730589 11:23935040-23935062 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1079731780 11:23942593-23942615 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1079767807 11:24416335-24416357 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1080557718 11:33432059-33432081 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1080621420 11:33990144-33990166 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1081125036 11:39311873-39311895 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1083546086 11:63550250-63550272 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1084107383 11:66988839-66988861 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1084210433 11:67619081-67619103 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1084813651 11:71631864-71631886 CGCCCACCCAGAACTCCAGCCGG + Intergenic
1085245576 11:75098251-75098273 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1085375858 11:76060610-76060632 CGCCCACCCGGAACTCCAGCTGG - Intronic
1085447271 11:76609345-76609367 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1085629256 11:78099838-78099860 CCTCCACCCTGTGTTCCAGCTGG - Intergenic
1086043007 11:82501204-82501226 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1086807988 11:91268801-91268823 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1088805169 11:113345655-113345677 CGTGCAGGCTGAGCTTCAGTGGG - Intronic
1089373599 11:117978803-117978825 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1089800213 11:121021704-121021726 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1090307710 11:125705018-125705040 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1090776749 11:129972136-129972158 CGCCCACCCAGAACTCCAGCTGG + Intronic
1091581515 12:1793348-1793370 GGTCCAAGCTGAGCTCACGCTGG + Exonic
1092137404 12:6159521-6159543 CGCCCACCCTGAACTCCAGCTGG - Intergenic
1092220271 12:6708354-6708376 CGGCCACCCGGAACTCCAGCTGG - Intergenic
1092350548 12:7752389-7752411 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1092430431 12:8404320-8404342 CGCCCACCCGGAACTCCAGCCGG - Intergenic
1092617181 12:10225948-10225970 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1093189372 12:16057427-16057449 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1093527116 12:20115545-20115567 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1093972932 12:25391473-25391495 CGGCCACCCGGAACTCCAGCTGG - Intergenic
1094327537 12:29256688-29256710 CGCCCACCCGGAACTCCAGCTGG - Intronic
1094409809 12:30156916-30156938 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1094589328 12:31806104-31806126 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1094661255 12:32472336-32472358 CGCCCACCCGGAACTCCAGCTGG - Intronic
1095636541 12:44440789-44440811 GGTCCACACTGTGCTCCAACAGG - Intergenic
1095776680 12:46018063-46018085 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1097017952 12:56000459-56000481 CGCCCACCCGGAACTCCAGCTGG + Intronic
1098168248 12:67719547-67719569 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1098588645 12:72185085-72185107 CGCCCACCCAGAACTCCAGCTGG - Intronic
1099790688 12:87330260-87330282 CGCCCACCCCGAACTCCAGCTGG - Intergenic
1101008962 12:100430346-100430368 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1101461989 12:104905828-104905850 CGCCCACCCGGAACTCCAGCTGG + Intronic
1102774208 12:115504816-115504838 CCTCCACACTGAGCCCCATCTGG + Intergenic
1103048718 12:117761027-117761049 CGTCCACGCGGTGCCCCAGCTGG + Exonic
1103439260 12:120950656-120950678 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1103668516 12:122592069-122592091 CATCCACCCGGAACTCCAGCTGG - Intronic
1103783422 12:123414429-123414451 CGCCCACCCGGAACTCCAGCTGG + Exonic
1103853263 12:123946992-123947014 CGCCCACCCAGAACTCCAGCTGG - Intronic
1103937897 12:124486166-124486188 CCTCCAAGCTGGGCTGCAGCAGG - Intronic
1104282456 12:127390450-127390472 GGTCCCAGCTGAGCTCAAGCTGG + Intergenic
1104614545 12:130256970-130256992 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1105037725 12:132938798-132938820 CGCCCACCCGGAACTCCAGCTGG - Intronic
1105722152 13:23127616-23127638 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1105876712 13:24561021-24561043 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1106227599 13:27796801-27796823 TGTGCACTCTTAGCTCCAGCAGG + Intergenic
1106617092 13:31339982-31340004 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1106674573 13:31944876-31944898 CAGCCATGCTGTGCTCCAGCTGG - Intergenic
1106674614 13:31945272-31945294 CTTCCATCCTGTGCTCCAGCTGG - Intergenic
1106810922 13:33358025-33358047 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1107259407 13:38472746-38472768 CGCCCACCCGGAGCTCCAGCTGG + Intergenic
1108435313 13:50396639-50396661 CGCCCACCCGGAACTCCAGCTGG - Intronic
1108851640 13:54737592-54737614 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1108858984 13:54829816-54829838 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1109141020 13:58714128-58714150 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1109159899 13:58958498-58958520 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1109446638 13:62448214-62448236 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1109506128 13:63305792-63305814 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1109745791 13:66621993-66622015 CGCCCACCCGGAACTCCAGCTGG - Intronic
1110024095 13:70512221-70512243 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1110368838 13:74718436-74718458 CGGCCACCCAGAACTCCAGCTGG - Intergenic
1110417461 13:75268493-75268515 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1110792423 13:79600474-79600496 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1110862106 13:80355591-80355613 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1110940325 13:81341086-81341108 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1111748299 13:92296710-92296732 CGCCCACACGGAACTCCAGCTGG - Intronic
1111841441 13:93455101-93455123 CGCCCACCCGGAACTCCAGCTGG + Intronic
1112375045 13:98831435-98831457 ACTCCAAGCTGAGCTCCATCAGG - Exonic
1112518616 13:100077560-100077582 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1112533196 13:100224365-100224387 CGCCCACCCGGAACTCCAGCTGG + Intronic
1112613068 13:100975741-100975763 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1113482712 13:110633345-110633367 CGCCCACCCGGAACTCCAGCTGG + Intronic
1113506612 13:110821204-110821226 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1113538161 13:111084188-111084210 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1113678029 13:112221761-112221783 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1114560336 14:23585198-23585220 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1115906742 14:38209779-38209801 CGTCCACGCTGAGCACGAGGCGG - Exonic
1116076683 14:40119739-40119761 CACCCACGCTGAGCTCCTGTGGG + Intergenic
1116114523 14:40629954-40629976 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1116251058 14:42482705-42482727 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1116452332 14:45080481-45080503 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1116656935 14:47665576-47665598 CGCCCACCCGGAACTCCAGCTGG - Intronic
1117297546 14:54393499-54393521 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1118017908 14:61679196-61679218 CGTGTAAGCAGAGCTCCAGCCGG - Intergenic
1119038813 14:71254340-71254362 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1119429611 14:74557898-74557920 CTTCCAGGCTGAGCTCCCACTGG - Intronic
1119673477 14:76537066-76537088 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1120844135 14:89111692-89111714 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1121115399 14:91339450-91339472 GGTCCACGATCAGCTGCAGCCGG + Exonic
1121350678 14:93170399-93170421 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1122178140 14:99936379-99936401 CGTTCACTCTGAGATCCAGGGGG + Intronic
1122476817 14:102015936-102015958 GGTCCATGATGTGCTCCAGCTGG - Exonic
1122493485 14:102135826-102135848 CGCCCACCCGGAACTCCAGCTGG + Intronic
1123208573 14:106737393-106737415 CACCCACGCCGAGGTCCAGCTGG - Intergenic
1124114886 15:26831495-26831517 CGCCCACCCGGAACTCCAGCTGG + Intronic
1124215551 15:27805190-27805212 CGTCCACGCTGGCCTGGAGCAGG + Intronic
1125112187 15:36046999-36047021 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1125565779 15:40677243-40677265 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1125609675 15:40961662-40961684 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1128670003 15:69567672-69567694 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1128813337 15:70587490-70587512 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1129169490 15:73799003-73799025 CGTCCCCTCTGAGCACCAACAGG - Intergenic
1129280421 15:74480660-74480682 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1129674208 15:77623571-77623593 CGCCCAGGCTGAGCTCCTGCAGG + Intronic
1129903524 15:79169965-79169987 CCTCCACGCTGGGCCCCAGAAGG + Intergenic
1130132834 15:81158667-81158689 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1131507762 15:93031872-93031894 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1131554285 15:93383381-93383403 TGACCATGCTGGGCTCCAGCAGG + Intergenic
1131846148 15:96492153-96492175 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1132089168 15:98933809-98933831 TGTCCACGCTGGGCACCACCGGG + Intronic
1133570369 16:7034454-7034476 CTTCCTTGCTGGGCTCCAGCTGG + Intronic
1134018773 16:10907361-10907383 CGTCCTCCCCAAGCTCCAGCAGG - Exonic
1134914079 16:18054542-18054564 TGGCCATGCTGAGCTCCCGCAGG - Intergenic
1135262151 16:20989956-20989978 CGCCCACCCGGAACTCCAGCTGG + Intronic
1135280822 16:21152642-21152664 CGCCCACCCGGAACTCCAGCTGG - Intronic
1135299418 16:21313096-21313118 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1135404737 16:22190132-22190154 CGGCCACGCTGCGCACCTGCGGG - Exonic
1135751096 16:25059226-25059248 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1136163270 16:28435414-28435436 CGCCCACTCGGACCTCCAGCTGG - Intergenic
1136199696 16:28679573-28679595 CGCCCACTCGGACCTCCAGCTGG + Intergenic
1136216043 16:28793746-28793768 CGCCCACTCGGACCTCCAGCTGG + Intergenic
1136779535 16:32887544-32887566 CGCCCACCCTGCGCTCCTGCTGG - Intergenic
1136891081 16:33973974-33973996 CGCCCACCCTGCGCTCCTGCTGG + Intergenic
1137399679 16:48143261-48143283 CCTTCTGGCTGAGCTCCAGCTGG - Intronic
1137442488 16:48508751-48508773 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1138690957 16:58768318-58768340 CCTCCCAGCTGAGCCCCAGCAGG - Intergenic
1139517282 16:67459480-67459502 TGGCCACACTGAGCCCCAGCTGG + Intronic
1141963391 16:87424579-87424601 CATGCACGCTAAGCTCCAGGGGG + Intronic
1203081951 16_KI270728v1_random:1149632-1149654 CGCCCACCCTGCGCTCCTGCTGG - Intergenic
1142505643 17:361638-361660 CGCCCACCCGGAACTCCAGCTGG - Intronic
1143664303 17:8347435-8347457 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1144467129 17:15505742-15505764 CGCCCACCCGGAACTCCAGCTGG - Intronic
1146461900 17:33052683-33052705 CGTGCCCACTGAGCTCTAGCGGG + Intronic
1146740495 17:35279229-35279251 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1146794937 17:35774214-35774236 GGTGCACGCTGAGCTGCAGTTGG - Intronic
1147373596 17:40010978-40011000 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1147431795 17:40375873-40375895 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1147997505 17:44368868-44368890 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1148366206 17:47057598-47057620 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1150772254 17:68051918-68051940 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1150804635 17:68309225-68309247 CGCCCACCCGGAACTCCAGCTGG + Intronic
1151782704 17:76257964-76257986 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1151990389 17:77570678-77570700 TGTCCAGGCTGAGCTCAGGCTGG - Intergenic
1152619078 17:81352357-81352379 AGCCCACGCGGAACTCCAGCTGG + Intergenic
1153644084 18:7178981-7179003 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1153832491 18:8935738-8935760 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1155208079 18:23577946-23577968 CGCCCACCCGGAACTCCAGCTGG + Intronic
1155295063 18:24376901-24376923 CGCCCACACGGAACTCCAGCCGG + Intronic
1155611737 18:27674178-27674200 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1155856404 18:30839473-30839495 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1156038641 18:32794620-32794642 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1156943147 18:42795293-42795315 CGCCCACCCGGAACTCCAGCTGG - Intronic
1157085942 18:44580778-44580800 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1157979827 18:52367219-52367241 CGCCCACCCGGAACTCCAGCTGG + Intronic
1158705781 18:59790766-59790788 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1159230767 18:65605299-65605321 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1160176650 18:76600445-76600467 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1160383437 18:78478224-78478246 CGTCTACGCTGACCACCTGCTGG - Intergenic
1160818977 19:1049354-1049376 AGTCCAGGCTGAGCCCCCGCAGG - Exonic
1161493094 19:4573169-4573191 CGGCCTCGCTGCACTCCAGCTGG + Intergenic
1162106971 19:8375805-8375827 CGCCCACCCGGAACTCCAGCTGG - Intronic
1162230116 19:9259559-9259581 CGCCCACCCGGAACTCCAGCGGG - Intergenic
1162233141 19:9283769-9283791 CGCCCACCCGGAACTCCAGCCGG + Intergenic
1162237621 19:9321443-9321465 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1162632728 19:11941610-11941632 CGCCCACCCAGAACTCCAGCTGG + Intronic
1162814758 19:13187024-13187046 CGCCCACCCGGAACTCCAGCCGG + Intergenic
1163109633 19:15151767-15151789 AGTCCTCGCTGAACTCCAGCTGG - Intergenic
1163181750 19:15608960-15608982 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1163783251 19:19261469-19261491 CGGCCACGCTGCGCCCCCGCAGG + Exonic
1164270617 19:23668842-23668864 CGCCCACCCGGAACTCCAGCTGG + Intronic
1164310432 19:24041359-24041381 CGCCCACCCGGAACTCCAGCTGG - Intronic
1164975766 19:32571633-32571655 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1165871394 19:38975759-38975781 CGGCGACTCTGAGATCCAGCGGG + Exonic
1166036251 19:40170456-40170478 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166487039 19:43222247-43222269 CGCCCACCCGGAACTCCAGCTGG + Intronic
1167002786 19:46755867-46755889 CCTCCACCATGCGCTCCAGCAGG - Exonic
1167416502 19:49375962-49375984 CTTCCACGCTTAGCTCCAAGAGG + Intergenic
1168423007 19:56217530-56217552 CGGCCACCCTGAGCTCCTCCAGG + Intergenic
925098999 2:1229910-1229932 CGCCCACCCGGAACTCCAGCTGG + Intronic
925537835 2:4935629-4935651 CGCCCACCCGGAACTCCAGCTGG + Intergenic
926331540 2:11829760-11829782 CGCCCACGGTGAGATTCAGCAGG - Intergenic
926616662 2:15002850-15002872 CGCCCACCCGGAACTCCAGCTGG + Intergenic
927408114 2:22795553-22795575 TGTCCTCACTCAGCTCCAGCTGG + Intergenic
928493058 2:31803764-31803786 CGCCCACCCGGAACTCCAGCTGG - Intergenic
928936867 2:36688306-36688328 CGCCCACCCGGAACTCCAGCTGG - Intergenic
929070028 2:38020557-38020579 CGCCCACCCGGAACTCCAGCTGG - Intronic
929201830 2:39244320-39244342 CGCCCACCCGGAACTCCAGCTGG - Intergenic
929233686 2:39585411-39585433 CGCCCACCCGGAACTCCAGCTGG - Intergenic
930485478 2:52006844-52006866 CGCCCACCCGGAACTCCAGCTGG - Intergenic
933487286 2:82938760-82938782 CGCCCACCCAGAACTCCAGCTGG + Intergenic
933979854 2:87540628-87540650 CACCCACCCTCAGCTCCAGCAGG - Intergenic
935896884 2:107747654-107747676 CGCCCACCCGGAACTCCAGCTGG + Intergenic
936251784 2:110873347-110873369 AGTCCACACTGGGCCCCAGCTGG - Intronic
936313966 2:111410163-111410185 CACCCACCCTCAGCTCCAGCAGG + Intergenic
936346858 2:111681895-111681917 CGCCCACCCGGAACTCCAGCTGG - Intergenic
937209623 2:120260066-120260088 CGCCCACCCGGAACTCCAGCTGG + Intronic
937711877 2:124987726-124987748 CGCCCACCCGGAACTCCAGCTGG + Intergenic
938126107 2:128672440-128672462 CGCCCACCCGGAGCTCTAGCTGG + Intergenic
938448408 2:131394754-131394776 CGGCGGGGCTGAGCTCCAGCTGG + Intergenic
939229728 2:139410386-139410408 CGCCCACCCGGAACTCCAGCTGG - Intergenic
939465099 2:142546106-142546128 CGCCCACCCGGAACTCCAGCTGG - Intergenic
939738809 2:145881224-145881246 TGCCCACCCTGAACTCCAGCTGG + Intergenic
940038192 2:149331073-149331095 CGTCCACCAGGAACTCCAGCCGG + Intronic
940666736 2:156618373-156618395 CGCCCACCCGGAACTCCAGCTGG + Intergenic
941240054 2:163026320-163026342 CGCCCACCCGGAACTCCAGCTGG - Intergenic
941309757 2:163913659-163913681 CGCCCACCCGGAACTCCAGCTGG - Intergenic
941705900 2:168657754-168657776 CGCCCACCCGGAACTCCAGCTGG + Intronic
941712151 2:168725213-168725235 CGCCCACCCGGAACTCCAGCTGG + Intronic
941820763 2:169841578-169841600 CGCCCACCCGGAACTCCAGCTGG - Intronic
942701912 2:178720928-178720950 TGTCAACGCTGTGCTGCAGCTGG + Exonic
943494784 2:188606709-188606731 CGCCCACCCGGAACTCCAGCTGG + Intergenic
943680379 2:190761279-190761301 CGCCCACCCGGAACTCCAGCTGG + Intergenic
944228403 2:197370617-197370639 CGCCCACCCGGAACTCCAGCTGG - Intergenic
944857961 2:203785889-203785911 CGCCCACCCGGAACTCCAGCTGG + Intergenic
945575506 2:211524691-211524713 CGCCCACCCGGAACTCCAGCTGG + Intronic
945745753 2:213718536-213718558 CGCCCACCCGGAACTCCAGCTGG - Intronic
946378943 2:219331708-219331730 GGTCCACGCCGAGCCCGAGCGGG - Intronic
947720393 2:232366385-232366407 CGCCCACCCGGAACTCCAGCTGG - Intergenic
948449144 2:238058173-238058195 CGCCCACCCGGAACTCCAGCTGG + Intronic
948635444 2:239331677-239331699 CTTCCACTCTGGGCTACAGCGGG + Intronic
1169814483 20:9641904-9641926 CGCCCACCCGGAACTCCAGCTGG + Intronic
1169849167 20:10031726-10031748 CGCCCACCCAGAACTCCAGCTGG - Intronic
1170246440 20:14226553-14226575 CGCCCACCCGGAACTCCAGCTGG - Intronic
1170536704 20:17347651-17347673 AATGCACGCTGTGCTCCAGCAGG + Intronic
1170553268 20:17495205-17495227 GGCCCAGGCTGAGGTCCAGCTGG + Intronic
1170649475 20:18226810-18226832 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1170806878 20:19639949-19639971 CGCCCACCCGGAACTCCAGCTGG + Intronic
1171318880 20:24221036-24221058 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1171380715 20:24732112-24732134 GCTCCACACTGAGCTCCAGTAGG + Intergenic
1171387301 20:24778998-24779020 AGTCCAAGCTCAGCTCCAGAAGG + Intergenic
1172431887 20:34899118-34899140 CGCCCACTCGGAACTCCAGCTGG + Intronic
1173195554 20:40910785-40910807 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1173195657 20:40911228-40911250 CGCCCACGCGGAACTCCAGCTGG - Intergenic
1173832432 20:46099769-46099791 CGGCCACCCTGAGCTCCTCCAGG - Intergenic
1175210037 20:57348441-57348463 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1175254123 20:57628839-57628861 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG + Intronic
1175994626 20:62806615-62806637 GCTCCCCGCTGAGCTCCAGCTGG - Intronic
1176966646 21:15218891-15218913 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1177496902 21:21902462-21902484 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1177565857 21:22819155-22819177 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1177637589 21:23807062-23807084 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1178100317 21:29261013-29261035 CGTCCACTCTTAGCTCCATGAGG + Intronic
1178398714 21:32265376-32265398 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1178585671 21:33868632-33868654 CGCCCACCCGGAACTCCAGCTGG + Intronic
1178983379 21:37283501-37283523 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1179726917 21:43345992-43346014 CGTCCTCACTGAGCTCTGGCTGG - Intergenic
1180183966 21:46130418-46130440 CATCCAGGCTGGGCTCCTGCCGG + Intronic
1180199393 21:46215517-46215539 CCTCCACCCTGAGAACCAGCTGG - Intronic
1180741075 22:18053672-18053694 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1183032173 22:35114472-35114494 CGTGCACGTGGAGCTCCAGCTGG - Intergenic
1183422154 22:37718155-37718177 CGCCCACCCGGAACTCCAGCTGG + Intronic
1183685185 22:39357582-39357604 CGCCCACCCGGAACTCCAGCTGG - Intronic
1184228234 22:43143024-43143046 CGTGCAGGCTCAGTTCCAGCAGG + Exonic
1184584230 22:45436773-45436795 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1184906278 22:47488622-47488644 CGCCCACCCGGAACTCCAGCTGG + Intergenic
950256990 3:11513558-11513580 CGCCCACCCGGAACTCCAGCTGG + Intronic
950929371 3:16773762-16773784 CGCCCACCCAGAACTCCAGCTGG - Intergenic
951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG + Intronic
951903556 3:27680850-27680872 TGTCCTTGATGAGCTCCAGCAGG - Intergenic
951951117 3:28200728-28200750 CGCCCACCCGGAACTCCAGCTGG + Intergenic
952355360 3:32578799-32578821 CGCCCACCCGGAACTCCAGCTGG - Intergenic
952360442 3:32625684-32625706 CGCCCACCCGGAACTCCAGCTGG - Intergenic
952393683 3:32902839-32902861 CGCCCACCCAGAACTCCAGCTGG - Intergenic
952398205 3:32939728-32939750 CGCCCACCCAGAACTCCAGCTGG - Intergenic
952730611 3:36633952-36633974 CGCCCACCCGGAACTCCAGCTGG - Intergenic
953002862 3:38951197-38951219 CGCCCACCCGGAACTCCAGCTGG - Intergenic
953089797 3:39713361-39713383 CGCCCACCCAGAACTCCAGCTGG - Intergenic
953124540 3:40078240-40078262 CGCCCACCCGGAACTCCAGCTGG + Intronic
953469798 3:43156952-43156974 CCTCCAGGCTGAGATACAGCAGG + Intergenic
954620095 3:51990602-51990624 CGCCCACCCGGAACTCCAGCTGG - Intergenic
955183321 3:56691925-56691947 CGCCCACACGGAACTCCAGCTGG - Intergenic
955449458 3:59050903-59050925 CGCCCACCCGGAACTCCAGCTGG - Intergenic
956481432 3:69677498-69677520 CGCCCACCCGGAACTCCAGCTGG - Intergenic
956855232 3:73269238-73269260 CGCCCACCCGGAACTCCAGCTGG - Intergenic
957371457 3:79300264-79300286 CGCCCACCCGGAACTCCAGCTGG - Intronic
957419698 3:79951686-79951708 CGCCCACCCGGAACTCCAGCTGG + Intergenic
957556326 3:81767702-81767724 CGCCCACCCGGAACTCCAGCTGG + Intergenic
957665212 3:83217926-83217948 CGCCCACCCGGAACTCCAGCTGG + Intergenic
957804935 3:85134176-85134198 CGCCCACCCGGAACTCCAGCTGG + Intronic
957830047 3:85504991-85505013 CGCCCACCCGGAACTCCAGCTGG + Intronic
957921789 3:86757638-86757660 CGCCCACCCGGAACTCCAGCTGG - Intergenic
960282109 3:115791607-115791629 CGCCCACCCGGAACTCCAGCTGG - Intergenic
961154471 3:124667107-124667129 CGCCAACGCTGACATCCAGCAGG + Intronic
961280029 3:125758893-125758915 CGCCCACCCGGAACTCCAGCCGG + Intergenic
961874376 3:130010686-130010708 CGCCCACTCGGAACTCCAGCCGG - Intergenic
961976042 3:131026543-131026565 AGTCCTCGCTGGGCTCTAGCGGG - Exonic
962283777 3:134070574-134070596 CGCCCACCCGGAACTCCAGCTGG + Intronic
962591101 3:136890315-136890337 CGCCCACCCGGAACTCCAGCTGG + Intronic
962600533 3:136987902-136987924 CGCCCACCCGGAACTCCAGCTGG + Intronic
962671716 3:137714814-137714836 CGTCCACCCGGAACTCTAGCTGG + Intergenic
963397182 3:144749857-144749879 CGCCCACCCGGAACTCCAGCTGG - Intergenic
963440382 3:145333439-145333461 CGCCCACCCAGAACTCCAGCTGG - Intergenic
963509178 3:146225747-146225769 CGCCCACCCGGAACTCCAGCTGG + Intronic
963906700 3:150779114-150779136 CCGTCACGCAGAGCTCCAGCAGG + Intergenic
964032295 3:152152461-152152483 CGCCCACCCGGAACTCCAGCTGG - Intergenic
964117998 3:153156035-153156057 CGCCCACCCGGAACTCCAGCTGG + Intergenic
964443976 3:156740623-156740645 CGCCCACCCGGAACTCCAGCTGG - Intergenic
964452168 3:156822992-156823014 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965040267 3:163499069-163499091 CGCCCACCCGGAACTCCAGCTGG - Intergenic
965044164 3:163552636-163552658 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965200372 3:165649632-165649654 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965220917 3:165924620-165924642 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965245269 3:166258783-166258805 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965298102 3:166975879-166975901 CGCCCACCCGGAACTCCAGCTGG - Intergenic
965753260 3:171999186-171999208 CGCCCACCCGGAACTCCAGCTGG + Intergenic
966096823 3:176213743-176213765 CGCCCACCCGGAACTCCAGCTGG + Intergenic
966191046 3:177272042-177272064 CGCCCACCCGGAACTCCAGCTGG + Intergenic
966724975 3:183100942-183100964 CGCCCACCCGGAACTCCAGCTGG - Intronic
966725463 3:183104061-183104083 CGCCCACCCGGAACTCCAGCTGG + Intronic
967448477 3:189596169-189596191 CGCCCACCCGGAACTCCAGCTGG - Intergenic
967499181 3:190177364-190177386 CGCCCACCCGGAACTCCAGCTGG + Intergenic
968081535 3:195849798-195849820 CAGCCACGCTCAGCTCCAGCCGG + Intergenic
968690695 4:1988340-1988362 CGTCCTCGCTGAGGGTCAGCAGG + Intronic
968716138 4:2161315-2161337 CGCCCACCCTGAACTCCAGCTGG - Intronic
968744833 4:2354176-2354198 CTTCCACCCTGAGCAGCAGCCGG + Intronic
969362328 4:6672769-6672791 CGCCCACCCTGAACTCCAGCTGG - Intergenic
969440714 4:7215174-7215196 CGCCCACCCGGAACTCCAGCTGG - Intronic
969655001 4:8491724-8491746 CGCCCACCCGGAACTCCAGCTGG + Intronic
969736302 4:8993165-8993187 CGCCCACCCGGAACTCCAGCCGG + Intergenic
969795500 4:9524728-9524750 CGCCCACCCAGAACTCCAGCCGG + Intergenic
970391189 4:15614959-15614981 CGCCCACCCGGAACTCCAGCTGG - Intronic
970649356 4:18159584-18159606 CGCCCACCCGGAACTCCAGCTGG + Intergenic
970673195 4:18418653-18418675 CGCCCACCCGGAACTCCAGCTGG + Intergenic
971377144 4:26064294-26064316 CGCCCACCCGGAACTCCAGCTGG + Intergenic
971639798 4:29117398-29117420 CGCCCACCCGGAACTCCAGCTGG - Intergenic
971905222 4:32716540-32716562 CGCCCACCCGGAACTCCAGCTGG + Intergenic
972900101 4:43672403-43672425 CGCCCACCCGGAACTCCAGCTGG - Intergenic
973308055 4:48675386-48675408 CGCCCACCCGGAACTCCAGCTGG - Intronic
973817554 4:54632582-54632604 CGCCCACCCGGAACTCCAGCTGG - Intergenic
974484817 4:62492211-62492233 CGCCCACTCGGAACTCCAGCTGG + Intergenic
974590620 4:63943189-63943211 CGCCCACCCAGAACTCCAGCTGG + Intergenic
974781773 4:66561796-66561818 CGCCCACCCGGAACTCCAGCTGG + Intergenic
974804357 4:66860214-66860236 CGCCCACCCAGAACTCCAGCTGG - Intergenic
974992900 4:69115558-69115580 CGCCCACCCGGAACTCCAGCTGG + Intronic
975595213 4:76043601-76043623 CGCCCACCCAGAACTCCAGCTGG + Intronic
975755848 4:77570710-77570732 CGCCCACCCAGAACTCCAGCTGG - Intronic
976388951 4:84490079-84490101 CTTCCACGCAGCACTCCAGCTGG - Intergenic
976646892 4:87396261-87396283 CGCCCACCCGGAACTCCAGCTGG + Intergenic
977206491 4:94169890-94169912 CGCCCACCCAGAACTCCAGCTGG - Intergenic
977717376 4:100196835-100196857 CGCCCACCCGGAACTCCAGCTGG + Intergenic
977750991 4:100609080-100609102 CGCCCACCCAGAACTCCAGCTGG + Intronic
978241913 4:106525658-106525680 CGCCCACCCGGAACTCCAGCTGG + Intergenic
978999600 4:115200509-115200531 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979290845 4:118977364-118977386 CGCCCACCCGGAACTCCAGCTGG + Intronic
979424776 4:120551052-120551074 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979688559 4:123537962-123537984 CGCCCACCCGGAACTCCAGCTGG - Intergenic
979825733 4:125229906-125229928 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979899737 4:126201605-126201627 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979991438 4:127379980-127380002 CGCCCACCCGGAACTCCAGCTGG - Intergenic
980043410 4:127964552-127964574 CGCCCACTCGGAACTCCAGCTGG + Intronic
980230278 4:130038857-130038879 CGCCCACCCGGAACTCCAGCTGG + Intergenic
980628569 4:135406664-135406686 CGCCCACCCGGAACTCCAGCTGG - Intergenic
980799738 4:137733782-137733804 CGCCCACCCAGAACTCCAGCTGG - Intergenic
981021757 4:140036568-140036590 AGTCCAAGCACAGCTCCAGCAGG + Intronic
981146801 4:141333508-141333530 CGCCCACCCGGAACTCCAGCTGG + Intergenic
981275795 4:142897545-142897567 CGCCCACCCGGAACTCCAGCTGG - Intergenic
982679071 4:158408113-158408135 CGCCCACCCGGAACTCCAGCTGG - Intronic
982814610 4:159869349-159869371 CGCCCACCCAGAACTCCAGCTGG + Intergenic
982921239 4:161277288-161277310 CGCCCACCCGGAACTCCAGCTGG - Intergenic
983064110 4:163190020-163190042 CGCCCACCCAGAACTCCAGCTGG + Intergenic
983230684 4:165126252-165126274 CGCCCACCCCGAACTCCAGCTGG + Intronic
983553082 4:169036150-169036172 CGCCCACCCGGAACTCCAGCTGG + Intergenic
983752817 4:171298320-171298342 CGCCCACCCGGAACTCCAGCTGG - Intergenic
984191643 4:176613080-176613102 CATCCAAGCTGAGCTCTAACAGG - Intergenic
984192865 4:176625478-176625500 CGCCCACCCGGAACTCCAGCTGG + Intergenic
984238846 4:177193509-177193531 CGCCCACCCGGAACTCCAGCTGG + Intergenic
984776132 4:183482978-183483000 CGCCCACCCGGAACTCCAGCTGG + Intergenic
984948750 4:184990403-184990425 CGCCCACCCGGAACTCCAGCTGG + Intergenic
985087071 4:186324630-186324652 CGCCCACCCGGAACTCCAGCTGG - Intergenic
985195201 4:187421263-187421285 CGCCCACCCAGAACTCCAGCTGG + Intergenic
985203224 4:187505676-187505698 CGCCCACCCGGAACTCCAGCTGG - Intergenic
985366373 4:189236353-189236375 CGCCCACCCGGAACTCCAGCTGG - Intergenic
985403897 4:189616960-189616982 CGCCCACCCGGAACTCCAGCTGG + Intergenic
985815698 5:2126192-2126214 GCTCCACACTGAGCTGCAGCAGG - Intergenic
986151975 5:5137831-5137853 CGCCCACCCGGAACTCCAGCTGG - Intergenic
986912415 5:12574259-12574281 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987146278 5:14994120-14994142 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987358200 5:17083505-17083527 CGTCCACTCCGAACTCCAGCTGG - Intronic
987384040 5:17312087-17312109 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987532812 5:19143085-19143107 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987543801 5:19287790-19287812 CGCCCACCCGGAACTCCAGCTGG - Intergenic
987876924 5:23691170-23691192 CGTCCACCCAGAACTCCAGCTGG - Intergenic
987896267 5:23951342-23951364 CGCCCACCCGGAACTCCAGCTGG - Intronic
987990270 5:25200337-25200359 CGCCCACCCGGAACTCCAGCTGG + Intergenic
988073462 5:26324467-26324489 CGCCCACCCGGAACTCCAGCTGG - Intergenic
988087016 5:26485594-26485616 CGTCCACCCGGAACTCCAACTGG + Intergenic
988132131 5:27119943-27119965 CGCCCACCCGGAACTCCAGCTGG - Intronic
988155082 5:27439765-27439787 CGCCCACCCGGAACTCCAGCTGG + Intergenic
988177237 5:27743507-27743529 CGCCCACCCGGAACTCCAGCTGG - Intergenic
988684762 5:33515701-33515723 CGCCCACCCGGAACTCCAGCTGG + Intergenic
988915922 5:35893182-35893204 CGCCCACCCGGAACTCCAGCTGG + Intergenic
989003175 5:36782627-36782649 CGCCCACGGGGAACTCCAGCTGG - Intergenic
989346772 5:40438705-40438727 CGCCCACCCGGAACTCCAGCTGG - Intergenic
989965803 5:50465060-50465082 CGCCCACCCGGAACTCCAGCTGG - Intergenic
990345235 5:54865123-54865145 CGCCCACCCGGAACTCCAGCTGG - Intergenic
991567596 5:68020718-68020740 CGCCCACCCGGAACTCCAGCTGG + Intergenic
992296714 5:75333731-75333753 CGCCCACCCGGAACTCCAGCTGG - Intergenic
992947291 5:81823107-81823129 CGCCCACCCGGAACTCCAGCTGG + Intergenic
992947423 5:81823768-81823790 CGCCCACCCGGAACTCCAGCTGG - Intergenic
993031840 5:82714726-82714748 CGCCCACCCGGAACTCCAGCTGG - Intergenic
993328605 5:86569838-86569860 AGCCCACCCTGAACTCCAGCTGG + Intergenic
993822008 5:92631379-92631401 CGCCCACCCGGAACTCCAGCTGG - Intergenic
994096314 5:95851213-95851235 CGCCCACCCGGAACTCCAGCTGG - Intergenic
994254816 5:97580307-97580329 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994507084 5:100656809-100656831 CGCCCACCCGGAACTCCAGCTGG - Intergenic
994509867 5:100689181-100689203 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994605629 5:101962760-101962782 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994701726 5:103142351-103142373 CGCCCACCCAGAACTCCAGCTGG + Intronic
994769813 5:103966639-103966661 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994928791 5:106154352-106154374 CGCCTACGCGGAACTCCAGCTGG - Intergenic
994935264 5:106246299-106246321 CGCCCACCCGGAACTCCAGCTGG - Intergenic
995032294 5:107494291-107494313 CGCCCACCCGGAACTCCAGCTGG - Intronic
995596476 5:113753432-113753454 CGCCCACCCGGAACTCCAGCTGG + Intergenic
995656483 5:114432727-114432749 CGCCCACCCGGAACTCCAGCTGG - Intronic
995835327 5:116395000-116395022 AGTCCACTATGAGCTCCAGCAGG - Intronic
995920371 5:117304707-117304729 CGCCCACCCGGAACTCCAGCTGG - Intergenic
996234197 5:121107223-121107245 CGCCCACCCGGAACTCCAGCTGG - Intergenic
999406153 5:151309233-151309255 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1000021587 5:157323256-157323278 CTTCCACCCTGAACTTCAGCAGG + Intronic
1002372685 5:178767703-178767725 CATCCAAGCTGACCTCCAGAGGG + Intergenic
1002442822 5:179273179-179273201 GGTTCAAGCTGAGCACCAGCTGG - Intronic
1003060698 6:2860190-2860212 CGTCCACCCGGAACTCCAGCTGG - Intergenic
1003070196 6:2939676-2939698 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1003528360 6:6917134-6917156 GGTCCACTGTGATCTCCAGCAGG + Intergenic
1003645255 6:7909673-7909695 CATCCACCCTGAGCTGCAGGGGG + Intronic
1003671513 6:8164383-8164405 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1003747984 6:9024324-9024346 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1003770184 6:9290750-9290772 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1003862766 6:10337457-10337479 CGTCCACCCGGAACTCCAGCTGG - Intergenic
1003947254 6:11087263-11087285 CGCCCACCCGGAGCTCCAGCTGG - Intergenic
1004036940 6:11933127-11933149 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1004053179 6:12108704-12108726 CGCCCACCCGGAGCTCCAGCTGG + Intronic
1004220587 6:13743247-13743269 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1004235568 6:13872236-13872258 CGCCCACGCGGAACTCTAGCTGG + Intergenic
1004486296 6:16069501-16069523 CGCCCACCCGGAACTCCAGCGGG + Intergenic
1004665552 6:17745621-17745643 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1004689118 6:17976502-17976524 CGCCCACCCAGAACTCCAGCTGG + Intronic
1004866082 6:19854740-19854762 CGCCCACGCGGAACTCCAGCTGG + Intergenic
1005035594 6:21552598-21552620 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005332906 6:24766250-24766272 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005749957 6:28872907-28872929 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005758919 6:28950107-28950129 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005759781 6:28957891-28957913 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1005978266 6:30816612-30816634 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1006005754 6:31000536-31000558 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1006033611 6:31195507-31195529 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1006151475 6:31992382-31992404 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006157776 6:32025120-32025142 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006477805 6:34269072-34269094 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1006904903 6:37526656-37526678 CATCCATGCTGAGCTCCACGAGG + Intergenic
1008005618 6:46406080-46406102 CGCCCACCCAGAACTCCAGCTGG + Intronic
1008038756 6:46774645-46774667 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1009407123 6:63326768-63326790 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1010235675 6:73572850-73572872 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1010617354 6:78029845-78029867 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1012189366 6:96261259-96261281 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1012760528 6:103294717-103294739 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1013081512 6:106817076-106817098 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1013143594 6:107364559-107364581 CGCCCACCCGGAACTCCAGCTGG + Intronic
1013410801 6:109881455-109881477 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1013960067 6:115889151-115889173 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014055861 6:117014807-117014829 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014507737 6:122280627-122280649 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014718538 6:124892019-124892041 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014921098 6:127214904-127214926 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1015572280 6:134633859-134633881 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1015600320 6:134904777-134904799 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1016092858 6:139999898-139999920 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1016858944 6:148698358-148698380 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1017298957 6:152834390-152834412 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1017325060 6:153133668-153133690 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1017839536 6:158210102-158210124 CGCCCACTCAGAACTCCAGCTGG + Intergenic
1018545650 6:164933346-164933368 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1019000290 6:168744099-168744121 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1019017915 6:168893192-168893214 CGAAGGCGCTGAGCTCCAGCAGG + Intergenic
1019159187 6:170057935-170057957 CCTCCAAGCTGAGCTCCACGTGG + Intergenic
1019288040 7:233519-233541 CGTGCAGGCTGAGCTCCCCCGGG + Intronic
1019944298 7:4314252-4314274 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1019965780 7:4497244-4497266 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1020437105 7:8176230-8176252 CATGCATGCTGAGCTACAGCAGG + Intronic
1021324097 7:19245530-19245552 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1021686788 7:23194041-23194063 CGCCCACTCGGAACTCCAGCTGG + Intronic
1023773559 7:43582920-43582942 CCCCCTCGCTGAGCTCCCGCGGG - Intronic
1023845524 7:44117942-44117964 CCTCCTCGCTGACCTCCCGCAGG + Exonic
1024269048 7:47628523-47628545 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1024834018 7:53495067-53495089 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1026335872 7:69393875-69393897 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1026512315 7:71037641-71037663 CGCCCACCCTGAACTCCAGCTGG - Intergenic
1026596586 7:71738393-71738415 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1027561641 7:79739346-79739368 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1027564067 7:79768278-79768300 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1028070064 7:86440613-86440635 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1028142474 7:87288770-87288792 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1028511248 7:91627707-91627729 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1028778299 7:94705541-94705563 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1029342108 7:99953611-99953633 AGTCAACGCTGAGCCTCAGCAGG + Intergenic
1029567485 7:101348621-101348643 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1030733454 7:113017389-113017411 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1030780386 7:113593366-113593388 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1031292283 7:119951825-119951847 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1031378770 7:121060016-121060038 CGCCCACCCGGAACTCCAGCTGG - Intronic
1031409184 7:121421776-121421798 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1032248048 7:130230068-130230090 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1032379029 7:131456565-131456587 CATCAACTCTGAACTCCAGCAGG - Intronic
1033664132 7:143424711-143424733 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1034091015 7:148363854-148363876 CGCCCACCCGGAACTCCAGCTGG - Intronic
1034097886 7:148426455-148426477 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1034154990 7:148949127-148949149 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1034656069 7:152730590-152730612 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1035151212 7:156874318-156874340 CGCCCACCCGGAACTCCAGCTGG + Intronic
1035706316 8:1678253-1678275 CGTCCAAGCTGACCTGGAGCTGG + Exonic
1035999217 8:4582873-4582895 CGCCCACCCGGAACTCCAGCTGG - Intronic
1036441062 8:8781706-8781728 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1036831342 8:12022708-12022730 CGCCCACCCGGAACTCCAGCCGG - Intergenic
1036914952 8:12796341-12796363 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1037241524 8:16783952-16783974 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1037957583 8:23071100-23071122 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1037971369 8:23174115-23174137 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1037983502 8:23272164-23272186 CGCCCACCCGGAACTCCAGCTGG - Intronic
1038196704 8:25374633-25374655 CTTGCACGCTGAGCTTCTGCAGG + Exonic
1039061277 8:33573949-33573971 CATCCACCCAGAACTCCAGCTGG - Intergenic
1039069143 8:33634147-33634169 CGCCCACACGGAACTCCAGCTGG + Intergenic
1039284840 8:36028872-36028894 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1039637271 8:39180160-39180182 CGCCCACCCGGAACTCCAGCTGG - Intronic
1040723098 8:50349964-50349986 CGCCCACCCAGAACTCCAGCTGG - Intronic
1040907607 8:52485331-52485353 CCTCCTCGCAGCGCTCCAGCCGG - Intergenic
1041034685 8:53776213-53776235 CGCCCACCCAGAACTCCAGCTGG + Intronic
1041914500 8:63126155-63126177 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1041918904 8:63162035-63162057 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1043435294 8:80231854-80231876 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1043709852 8:83402984-83403006 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1044633504 8:94300648-94300670 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1045131969 8:99163714-99163736 TGTCCACACAGAACTCCAGCTGG + Intronic
1045232352 8:100317095-100317117 CGCCCACCCGGAACTCCAGCTGG + Intronic
1045467790 8:102485826-102485848 CGCCCACTCGGAACTCCAGCTGG + Intergenic
1046149376 8:110202885-110202907 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1046265419 8:111823597-111823619 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1046445307 8:114311397-114311419 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1047631734 8:126714951-126714973 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1048493535 8:134916438-134916460 CTTCCAAGCTTACCTCCAGCTGG + Intergenic
1048757530 8:137755435-137755457 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1048789143 8:138084181-138084203 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1048973129 8:139656294-139656316 GGCCCAGGCTGAGCCCCAGCTGG - Intronic
1049087668 8:140490829-140490851 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1049500284 8:142959523-142959545 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1049539555 8:143201860-143201882 CTTTCACACTGAGCTCCTGCCGG - Intergenic
1051305119 9:15700356-15700378 CGCCCACCCGGAACTCCAGCTGG + Intronic
1051383275 9:16480554-16480576 CGCCCACCCGGAACTCCAGCTGG - Intronic
1051439832 9:17072651-17072673 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1051892669 9:21959297-21959319 CGCCCACCCGGAACTCCAGCTGG - Intronic
1052985377 9:34483079-34483101 CGCCCACCCGGAACTCCAGCTGG + Intronic
1053350831 9:37412290-37412312 CGTCCAAGCTGAGAAACAGCAGG - Intergenic
1053510921 9:38687104-38687126 CATCCACGAAGAACTCCAGCAGG + Intergenic
1054722419 9:68617069-68617091 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1055049332 9:71963585-71963607 CGCCCACCCGGAACTCCAGCTGG - Intronic
1056691699 9:88813480-88813502 CCTGCACCCTGAGCTGCAGCCGG + Intergenic
1056743720 9:89282471-89282493 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1056771425 9:89480733-89480755 CGCCCACCCGGAACTCCAGCTGG + Intronic
1057127700 9:92632106-92632128 TTTCCACGGTGACCTCCAGCGGG - Intronic
1057260801 9:93582184-93582206 GGTGCACTCTGAGCTGCAGCAGG + Intronic
1057383950 9:94591458-94591480 CGCCCACCCGGAACTCCAGCTGG + Intronic
1057511108 9:95680376-95680398 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1057542937 9:95992732-95992754 CCTCCACCCTGGCCTCCAGCTGG - Intronic
1058272231 9:102986558-102986580 CATCCATGCTGAGCTCCTGTGGG - Intergenic
1058286538 9:103186958-103186980 CGCCCACGCGGAACTCCAGCTGG - Intergenic
1059991590 9:119870597-119870619 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1061013898 9:127971127-127971149 CGCCCTCCCTGAGCACCAGCCGG + Intronic
1061578822 9:131524271-131524293 CGTGGACGCTGTTCTCCAGCCGG + Exonic
1061781907 9:133001069-133001091 CATCCCCGCTGAGCTCCAAGAGG - Intergenic
1061834951 9:133322717-133322739 CATCCACGCTGAGCTGCAGAAGG + Intergenic
1061922454 9:133789488-133789510 CGTCCATCCTGAGCACCAGCTGG - Intronic
1185508251 X:644390-644412 GGTCCAGGCTCAGCTGCAGCTGG + Exonic
1186323282 X:8452806-8452828 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1187139017 X:16575499-16575521 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1187304579 X:18083848-18083870 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1187557605 X:20367165-20367187 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1187903987 X:24049737-24049759 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1190045901 X:47111319-47111341 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1190413997 X:50163645-50163667 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1192186736 X:68952206-68952228 CGTCCACCTGGAACTCCAGCTGG - Intergenic
1192553671 X:72073195-72073217 CAGCCAGGCTGAGCTGCAGCAGG + Intergenic
1193538189 X:82738519-82738541 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1193804076 X:85972673-85972695 CGCCCACCCGGAACTCCAGCTGG + Intronic
1194071626 X:89331345-89331367 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1194118060 X:89926850-89926872 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1194650854 X:96512567-96512589 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1195256290 X:103094159-103094181 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1195259384 X:103117374-103117396 CGCCCACCCAGAACTCCAGCCGG + Intergenic
1196319564 X:114270875-114270897 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1196582663 X:117394726-117394748 CGCCCACTCGGAACTCCAGCTGG - Intergenic
1196705947 X:118717255-118717277 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1196728964 X:118922300-118922322 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1196762008 X:119208788-119208810 CGCCCACGGGGAACTCCAGCTGG + Intergenic
1196762375 X:119211195-119211217 CGCCCACGGGGAACTCCAGCTGG + Intergenic
1196775174 X:119331919-119331941 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1196775475 X:119333640-119333662 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1196794012 X:119488179-119488201 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1196827308 X:119751144-119751166 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1196845027 X:119890636-119890658 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1197340020 X:125255692-125255714 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1197376832 X:125690895-125690917 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1198664341 X:139004341-139004363 CGCCCACCCGGAACTCCAGCTGG + Intronic
1198694416 X:139320848-139320870 TGTCCACCCAGAACTCCAGCTGG - Intergenic
1198972623 X:142298561-142298583 CGTCCACCCGGAACTCCAGCTGG + Intergenic
1199050258 X:143229006-143229028 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1200470939 Y:3584419-3584441 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1200888650 Y:8298662-8298684 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1201479904 Y:14428135-14428157 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1201495719 Y:14590099-14590121 CGCCCACCCGGAACTCCAGCTGG + Intronic
1201496963 Y:14598512-14598534 CGCCCACCCAGAACTCCAGCTGG + Intronic
1201715774 Y:17043152-17043174 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1201982650 Y:19924031-19924053 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1202137127 Y:21676978-21677000 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1202307436 Y:23487613-23487635 CGCCCACCCGGAACTCCAGCTGG + Intergenic