ID: 1006158457

View in Genome Browser
Species Human (GRCh38)
Location 6:32028116-32028138
Sequence GAGGCGTGGCCTCCCTCTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 2, 1: 0, 2: 2, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006158445_1006158457 25 Left 1006158445 6:32028068-32028090 CCTCAGATCCATTGGACACTTTA 0: 2
1: 0
2: 1
3: 7
4: 97
Right 1006158457 6:32028116-32028138 GAGGCGTGGCCTCCCTCTTGAGG 0: 2
1: 0
2: 2
3: 10
4: 132
1006158447_1006158457 17 Left 1006158447 6:32028076-32028098 CCATTGGACACTTTAGGCTCTGA 0: 2
1: 0
2: 0
3: 6
4: 138
Right 1006158457 6:32028116-32028138 GAGGCGTGGCCTCCCTCTTGAGG 0: 2
1: 0
2: 2
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006158457 Original CRISPR GAGGCGTGGCCTCCCTCTTG AGG Exonic
900177097 1:1295719-1295741 GGGGCATGGCCTCCCACCTGAGG + Exonic
902036293 1:13460669-13460691 GAGTGCTGGCCTCCCTGTTGGGG + Intergenic
904261130 1:29288502-29288524 CAGCCGTGTCCTCCCTCGTGGGG + Intronic
904807455 1:33141978-33142000 GAGGCTGTGCCTCCCTTTTGTGG + Intergenic
904841185 1:33372957-33372979 GAGGCAATGCCTCCTTCTTGAGG + Intronic
907855096 1:58295502-58295524 CAGGAGAGGCCTCCCTGTTGAGG - Intronic
912508472 1:110172570-110172592 GAGGAGGGACCTCCCTCATGGGG - Intronic
912512458 1:110198499-110198521 CAGGCCTGGCCTCTTTCTTGAGG + Exonic
913963264 1:143354922-143354944 GGAGCGTGACCTCCCTCATGGGG - Intergenic
914057620 1:144180508-144180530 GGAGCGTGACCTCCCTCATGGGG - Intergenic
914121526 1:144785858-144785880 GGAGCGTGACCTCCCTCATGGGG + Intergenic
916375915 1:164152949-164152971 GACACATGGCCTCCCTGTTGGGG - Intergenic
919755309 1:201062659-201062681 GAGGCGTGAACTCGCCCTTGGGG + Intronic
920194770 1:204219617-204219639 GAAGCCTGGCCTCCCACCTGGGG - Exonic
922753006 1:228079734-228079756 CAGCCCTGCCCTCCCTCTTGGGG - Intergenic
923103550 1:230836914-230836936 GAGGGGTGGGCTCTGTCTTGGGG - Intergenic
1063575236 10:7256095-7256117 GTGGGGTGGAATCCCTCTTGTGG + Intronic
1065433621 10:25684566-25684588 CAGGCGTGGTCTGACTCTTGGGG + Intergenic
1068333434 10:55602056-55602078 GAGGCGTTGCCTCACTCGGGAGG + Intronic
1071343683 10:84671156-84671178 GCGGATTGGCCTCCCTATTGTGG + Intergenic
1071553567 10:86585596-86585618 TAGGCGTGGTCCCCCTCCTGAGG + Intergenic
1072268722 10:93754970-93754992 AAGGTGTGGCCACCCACTTGTGG - Intergenic
1075193760 10:120336098-120336120 GAGCCAGGTCCTCCCTCTTGAGG + Intergenic
1076719796 10:132388095-132388117 GAGGCGGGGCCTGCGTCCTGGGG - Intergenic
1076855922 10:133115619-133115641 GGGTCCTGGCCTCCCTCCTGGGG - Intronic
1078570841 11:12456728-12456750 GAAGCATGTCCTCCCTCTTGAGG + Intronic
1081604821 11:44520551-44520573 GAGGCCTGGCCTCCTTCCTTAGG + Intergenic
1083993023 11:66258181-66258203 GCGGCTTGGCCTGCCTTTTGGGG + Intronic
1086491662 11:87362363-87362385 AAGCAGTGGCGTCCCTCTTGCGG + Intergenic
1089149485 11:116353882-116353904 GAGGCGGGGCCTGACTCTGGAGG - Intergenic
1092169329 12:6363494-6363516 GTAGCGTGGCCTCCAGCTTGCGG - Exonic
1092260518 12:6951300-6951322 GAGGCGCGGCCGACCCCTTGGGG - Exonic
1092672758 12:10882431-10882453 GGGGGATGGCCTCCCTGTTGGGG + Exonic
1092676936 12:10930844-10930866 GGGGGATGGCCTCCCTGTTGGGG - Exonic
1096100093 12:48965620-48965642 GCAGCCTGGGCTCCCTCTTGTGG - Exonic
1100362892 12:93894481-93894503 CAGGCTTGGCCTCTCTCCTGTGG + Intronic
1102594833 12:113984286-113984308 GATCCCTGGGCTCCCTCTTGAGG + Intergenic
1103474664 12:121209930-121209952 GGGGAGTGGCCTCGCCCTTGAGG - Intronic
1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG + Exonic
1105924868 13:24998720-24998742 GAGCGGTGGCCTCCTTCTTTTGG + Intergenic
1106241836 13:27919237-27919259 AAGACGCGGCCTTCCTCTTGGGG - Intergenic
1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG + Exonic
1111935061 13:94549487-94549509 GCGGCGCGGCCTCGCTCCTGGGG + Intergenic
1118780287 14:69003426-69003448 GAGCCTTGGCCTCCGACTTGTGG - Intergenic
1119856452 14:77904695-77904717 GAGCAGAGGCCTCCCTCCTGTGG - Intronic
1119935612 14:78589787-78589809 CAGCCCTGGCCTCCCTCCTGCGG - Intronic
1120228500 14:81817883-81817905 GAGGCTTGCCCACCTTCTTGGGG - Intergenic
1121630437 14:95417991-95418013 GAGGACTGGGCTCCCTCTTCCGG - Exonic
1126857507 15:52853335-52853357 CAGGCGTAGCCTCCCTGTGGAGG + Intergenic
1131056770 15:89379462-89379484 GGGCCGTGGCCGCCCTCCTGGGG + Intergenic
1134598268 16:15513001-15513023 GTGGGGTGGGCTCCATCTTGGGG + Intronic
1140584839 16:76277247-76277269 GAGGCGCGGCCTCCCGTTCGTGG - Intergenic
1141679514 16:85536121-85536143 GTGGCTGGGCCTCCCTCCTGGGG - Intergenic
1142129472 16:88426130-88426152 GAGGCGGGGGCTGCCTCCTGAGG - Intergenic
1142186731 16:88698282-88698304 GAGGCCTGGGCACCCTCTAGTGG + Intronic
1143117313 17:4588363-4588385 CAGGCCTGGGCTCCCTCATGGGG + Intronic
1143541557 17:7572550-7572572 GAGGCCTGGCAGCCATCTTGGGG - Exonic
1146456650 17:33014386-33014408 GAGTCCTGACCTCTCTCTTGGGG + Intronic
1146625282 17:34430691-34430713 GAGGCGAGGCCTTCCTCTTGGGG + Intergenic
1147976941 17:44253269-44253291 GTGGGGTGGCCGCCCTCTTTGGG - Exonic
1149868536 17:60163488-60163510 GAGGCCTGGCCTTCCTTCTGAGG - Intronic
1152925034 17:83083301-83083323 GACACGTTGCCTCCCTCTCGGGG - Intronic
1153155670 18:2146221-2146243 GATGCAGGGCCTCCATCTTGAGG + Intergenic
1162127349 19:8506614-8506636 GAGGCGTGGCCTAGATCTGGGGG + Intergenic
1163827588 19:19532385-19532407 GAGGCGCGGGCGCCCTCTGGTGG - Intronic
1166247286 19:41538196-41538218 GAGGCATGGCCTCCTTCTGTGGG - Intergenic
1166881836 19:45934736-45934758 GGGGCGTGGCCTCCCTCAAATGG - Exonic
1167469943 19:49670128-49670150 GAGGCGTGGCTTCCCGGTTCAGG - Intronic
1202697103 1_KI270712v1_random:133181-133203 GGAGCGTGACCTCCCTCATGGGG - Intergenic
925146181 2:1584745-1584767 GAGGGGTGGTCTCACTCTAGAGG + Intergenic
925306458 2:2850644-2850666 GAGGCCTGGCCTTCCTCGCGAGG - Intergenic
925737614 2:6978099-6978121 GAGGTGTGGGCACCCTCGTGAGG + Intronic
926418132 2:12670906-12670928 GGTGCGTGGCCTGCCTGTTGAGG - Intergenic
932433744 2:71690963-71690985 CAGGGCTGGCCTCCCTCCTGAGG - Intergenic
934985300 2:98880865-98880887 GAGGCAAGGCTTCCCCCTTGCGG - Intronic
936936731 2:117846333-117846355 GGGGTGTGGCCTCCTTGTTGAGG + Intergenic
939933183 2:148257586-148257608 AAGTGGTGGCATCCCTCTTGTGG - Intronic
943366705 2:186973461-186973483 GGGCAGTGCCCTCCCTCTTGGGG + Intergenic
946355237 2:219180354-219180376 GAGGCCTGGGCGCCTTCTTGAGG + Intronic
948172001 2:235911365-235911387 GAAGCCTGGCCTACCTCCTGGGG - Intronic
1171144016 20:22766217-22766239 GAGGGGTGGCTTTCGTCTTGGGG + Intergenic
1172480947 20:35271095-35271117 GAGGCTAGGACTCCCTGTTGGGG + Intronic
1172766077 20:37351575-37351597 GAAGCATGGCCTCCCTGTTGGGG + Intronic
1173380021 20:42531826-42531848 GAGGGCTGGCCTCCCTGCTGAGG - Intronic
1173519122 20:43686246-43686268 GGGGCCTGGCCTGGCTCTTGTGG + Intronic
1174407314 20:50310656-50310678 GAGGCCTGCCCTCCCTCCTGGGG + Intergenic
1175301132 20:57943477-57943499 CAGGCCTGGCCTCCCTCAGGAGG - Intergenic
1179981893 21:44900088-44900110 GAGGCCCGGCCTCGCCCTTGTGG - Intronic
1179992875 21:44957707-44957729 GAGGCCTGGGCTCTGTCTTGGGG + Intronic
1181606828 22:23985193-23985215 CGGGCGTGGCCTCTCTCTTATGG - Intergenic
1181620240 22:24086143-24086165 GAGCCCTGGCCGTCCTCTTGGGG + Intronic
1182546754 22:31081167-31081189 GGGGCGGGGCCTTCCTCTCGGGG + Intronic
1183664127 22:39237595-39237617 GAGGCGTGGTCTCTCTTCTGAGG - Intronic
1184987651 22:48146416-48146438 GTGGGGTGGCCTCACTCTGGAGG + Intergenic
950099737 3:10349518-10349540 GTGGTGTGCCCTCCCTCTGGAGG + Intronic
950621510 3:14209445-14209467 TAGGTGTGGCCTCCCTGTAGAGG - Intergenic
953723104 3:45373456-45373478 GATGCGGGGCCTGCCTGTTGCGG + Intergenic
955419016 3:58718630-58718652 GAGGTGAGGCTTCCCTCTTTGGG - Intronic
959074424 3:101735326-101735348 GAAGAGTGGGCTCCCACTTGGGG + Intronic
960834786 3:121894612-121894634 GAGGAATGGCCTCCCTCTTTTGG + Intronic
960948880 3:122985759-122985781 CTGGCGTGGCCACCCTGTTGGGG - Intronic
961657789 3:128452870-128452892 GAAGCGTGGCCACTCTCCTGGGG + Intergenic
963083114 3:141413016-141413038 CAGGCCTGGCCTCCCTCCAGAGG + Intronic
968718221 4:2177785-2177807 GATGCCTGGCCTCCCTGGTGGGG + Intronic
969032489 4:4226144-4226166 GGAGCGTGGCCTCCATCATGGGG + Intronic
970200523 4:13600061-13600083 GAGGGGTCGCCTTCCTCTTGAGG + Exonic
970857785 4:20668548-20668570 GAGGAATGGACTCCCTCTGGAGG + Intergenic
971134868 4:23857288-23857310 AAGGCGAGTCCTCCATCTTGTGG - Intronic
982288484 4:153758431-153758453 GAGGTATGGCCTCTCTGTTGAGG - Intronic
990068636 5:51750781-51750803 GAGTCGTGGCCTCTCCCATGAGG + Intergenic
992897242 5:81255632-81255654 GAGGCCTGCCCTGACTCTTGTGG + Intronic
996769192 5:127068056-127068078 GAGGATTTGCCTCCCTCTTTGGG - Intronic
997660056 5:135582518-135582540 CAGGAGTGGCCTCCCTCCTGTGG - Intergenic
999258450 5:150222843-150222865 CAGGCCTGGCCCCCTTCTTGGGG + Intronic
1001481618 5:172092787-172092809 GAGCCATGGCCTCCTTCTTAGGG - Intronic
1002060585 5:176623481-176623503 GAGGCCTGGCCTCCGTCTCCTGG + Intronic
1006152155 6:31995378-31995400 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1006158457 6:32028116-32028138 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1006165276 6:32061209-32061231 TTGGCGTGGCCTCCCTCTAATGG - Intronic
1012439888 6:99253154-99253176 GAAGCATGGCCTCCTTCTTTGGG - Intergenic
1019191037 6:170251022-170251044 GATTCGTGGCTTCCCTCGTGTGG + Intergenic
1019472919 7:1230613-1230635 GCGGCGCGGACTCGCTCTTGAGG + Intergenic
1019596642 7:1861360-1861382 GAGGCGTGTCCTGGCCCTTGTGG - Intronic
1019612212 7:1942270-1942292 CAGGCGTGGCCTCCTTCTGGAGG - Intronic
1024125402 7:46289919-46289941 GAGGTGTGACCTCCTTGTTGAGG - Intergenic
1024556682 7:50609655-50609677 GAGGCAAGACCTCCCTCTTGGGG + Intronic
1030983367 7:116211317-116211339 GAGGCAGTGCCTCCCTCTTAGGG + Intronic
1035634880 8:1137133-1137155 GCAGCGTGGCCTCCTCCTTGTGG + Intergenic
1035642421 8:1194185-1194207 AAGGCGTGGCCTCCCACAGGCGG - Intergenic
1037469452 8:19193337-19193359 AAGGCATGGCCTCCCTGTAGAGG + Intergenic
1043494062 8:80780788-80780810 CAGGGGTGTGCTCCCTCTTGGGG - Intronic
1051138413 9:13950602-13950624 GAGGCGTGGAGTTGCTCTTGAGG - Intergenic
1052192880 9:25678483-25678505 GAGGCGTGTCCTGTCTCCTGTGG + Intergenic
1056314977 9:85379494-85379516 GAGGGGTGGCCACCTTCTAGAGG - Intergenic
1060397697 9:123327617-123327639 GAGCCGTGGCCTTTCCCTTGAGG + Intergenic
1061748789 9:132760056-132760078 GAGACATTGCCTCCCTCTTAGGG + Intronic
1062024735 9:134335094-134335116 GAGGCCTGGCCTCCATCCTGGGG - Intronic
1062393409 9:136342910-136342932 GGGGCGTGGCCTTGCTGTTGTGG + Intronic
1062538751 9:137032255-137032277 CTGGCTTGGCATCCCTCTTGTGG - Exonic
1188178209 X:27021140-27021162 GTGACTTGGCCTCCCTCTTCTGG + Intergenic
1189834540 X:45006244-45006266 GAGGCATGCCCTGCCCCTTGTGG - Intronic
1194807711 X:98349915-98349937 CAGAGGTGGCCTCCCTCTTCTGG - Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic