ID: 1006159064

View in Genome Browser
Species Human (GRCh38)
Location 6:32030816-32030838
Sequence CAAGAGACACAGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 2, 1: 1, 2: 4, 3: 64, 4: 674}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006159064_1006159069 7 Left 1006159064 6:32030816-32030838 CCTTCTTCATTCTGTGTCTCTTG 0: 2
1: 1
2: 4
3: 64
4: 674
Right 1006159069 6:32030846-32030868 GGTGGGAGCCCCTCCCAGCCAGG 0: 2
1: 2
2: 6
3: 58
4: 491
1006159064_1006159076 29 Left 1006159064 6:32030816-32030838 CCTTCTTCATTCTGTGTCTCTTG 0: 2
1: 1
2: 4
3: 64
4: 674
Right 1006159076 6:32030868-32030890 GAGCCCAGCCACTACTCTAGAGG 0: 2
1: 0
2: 0
3: 5
4: 102
1006159064_1006159068 -10 Left 1006159064 6:32030816-32030838 CCTTCTTCATTCTGTGTCTCTTG 0: 2
1: 1
2: 4
3: 64
4: 674
Right 1006159068 6:32030829-32030851 GTGTCTCTTGTCTGGCTGGTGGG 0: 2
1: 0
2: 0
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006159064 Original CRISPR CAAGAGACACAGAATGAAGA AGG (reversed) Intronic
900398905 1:2464888-2464910 CAACTCACACAGACTGAAGACGG + Intronic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
901143263 1:7049415-7049437 CAAGAGACACAAAATGAAGATGG - Intronic
902066505 1:13692597-13692619 AGAGAGACACAGAGAGAAGATGG + Intergenic
902138678 1:14333677-14333699 CAAGAGAAACAGCATGGACATGG + Intergenic
903904185 1:26672095-26672117 CACGAGACACAGCATCAAGATGG + Intergenic
904037397 1:27566216-27566238 GAAGAGAGACAGAAAGATGAAGG + Intronic
904890609 1:33776771-33776793 CAAGAGGCTTAGAATGAAGAAGG + Intronic
905502521 1:38450947-38450969 GAAAAGACACAGAGGGAAGATGG - Intergenic
907498343 1:54860348-54860370 GAAGAGACTGAGAATGGAGAGGG - Intronic
907967801 1:59350163-59350185 CAAGAATTAAAGAATGAAGAAGG - Intronic
908146516 1:61250975-61250997 CCATAGACACAGAAAAAAGATGG + Intronic
910430242 1:87152855-87152877 AAAGACACACAAAATGAATAAGG - Intronic
910861008 1:91742309-91742331 CAAGGGATTCAGAATGAACAAGG - Intronic
911179951 1:94851516-94851538 TAAGAGACACAGAAAGAAAAAGG - Intronic
911950543 1:104168483-104168505 CAAGAGACACTGAAAATAGACGG + Intergenic
913418413 1:118637275-118637297 GAAGTCACACAGAATGAAAATGG - Intergenic
914706957 1:150178059-150178081 GAAGAGACACAAAATAATGAAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915436424 1:155910239-155910261 TAAGAGACAAAGACTAAAGATGG + Intronic
915457254 1:156048979-156049001 GAAGAGACACAGAAAGAAAGGGG + Intronic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
917730296 1:177868337-177868359 GAAGAGACACAGGGAGAAGATGG + Intergenic
918433989 1:184492002-184492024 AAAGTTACAAAGAATGAAGATGG - Intronic
918485306 1:185022466-185022488 CAAGAGAGACAGAATGAAAAGGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
919015636 1:192030854-192030876 CAAGAGAAAGAGAATGCACAAGG - Intergenic
919019856 1:192091553-192091575 AAAGTGACACAGAATTGAGAGGG - Intergenic
919266482 1:195273841-195273863 CAAGAGACCCATAGTGCAGAGGG + Intergenic
919319936 1:196023124-196023146 CCAGATACATAGAATGAAAATGG - Intergenic
920100463 1:203514045-203514067 CCTGAGCCACAGCATGAAGAGGG - Intergenic
920869141 1:209778980-209779002 GAAGAGACACAGAGAGAAGACGG - Intronic
921341468 1:214138519-214138541 GAAGAGACACAGAGTAAAGAGGG + Intergenic
921500712 1:215899352-215899374 CAAGCTACACAGAGTGAATAAGG - Intronic
922114526 1:222599051-222599073 GAAGAGAGAAAGAATGATGATGG - Intergenic
922183187 1:223252269-223252291 CGAGACACACAGAGGGAAGACGG + Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922494284 1:226043741-226043763 AAAGAGACACAGGGAGAAGACGG - Intergenic
922703960 1:227779211-227779233 CATGAGAAACAGTATGAAGGCGG - Intronic
923202837 1:231728666-231728688 CAATAGTAACAGAATGCAGATGG - Intronic
923242923 1:232103199-232103221 CAAGACACCTCGAATGAAGAAGG + Intergenic
924197014 1:241618687-241618709 AAAGAGACACAGAACGATGGCGG - Intronic
1062999871 10:1906324-1906346 CATGTGGCACAGAAGGAAGATGG + Intergenic
1062999885 10:1906425-1906447 CATGTGGCACAGAAGGAAGATGG + Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1063737151 10:8771221-8771243 AAAGAGTCCCAGACTGAAGAAGG + Intergenic
1064625352 10:17255717-17255739 GGAGAGACAGAGCATGAAGAGGG - Intergenic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065986608 10:30959780-30959802 CCAGAGAGACAGAATGAATCAGG - Intronic
1066219997 10:33327385-33327407 CAACAGACATATAATGAAGCTGG + Intronic
1068828354 10:61465199-61465221 CCAGAGAAACAGAATTAATAGGG + Intergenic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1070398588 10:76033513-76033535 AAAACGACACAGCATGAAGATGG - Intronic
1070701271 10:78603359-78603381 ACAGAGACACAGGTTGAAGATGG - Intergenic
1070771517 10:79085153-79085175 GAAGAGACACAGTAAGAACATGG - Intronic
1070801784 10:79248173-79248195 CAAGAGCTATAGAAGGAAGAGGG + Intronic
1070948571 10:80412945-80412967 CAAGAACCACAGAATGAATCTGG - Intronic
1071021175 10:81058943-81058965 AAAGAGACACACAGAGAAGAAGG - Intergenic
1071223017 10:83491985-83492007 AGAGATACACAGAAGGAAGATGG + Intergenic
1071227664 10:83549752-83549774 CAAAATAAAAAGAATGAAGATGG - Intergenic
1071390235 10:85166614-85166636 CATGAGATAAGGAATGAAGAGGG - Intergenic
1071417635 10:85456009-85456031 CAAGAGGCACACAGTAAAGATGG + Intergenic
1071563426 10:86659683-86659705 GAAGGCACACAGAATCAAGAGGG + Intronic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1071898697 10:90094434-90094456 CAAGAGAAACAGAAACAATAGGG + Intergenic
1072205713 10:93203624-93203646 CCACAGGCACAGGATGAAGAGGG + Intergenic
1072846814 10:98840602-98840624 GAAGAGACAAAAAATGAGGAGGG + Intronic
1072918362 10:99554666-99554688 AAAGAGAGACGGAATGAATAGGG + Intergenic
1073002380 10:100295234-100295256 AATGAGACACATATTGAAGAAGG + Intronic
1073125854 10:101148719-101148741 CAAAAGAAACAGAATGGAAAAGG - Intergenic
1073616578 10:105002482-105002504 TAAGGGCCACAGAATGAATAAGG + Intronic
1074060701 10:109962891-109962913 CAAGAGACCAGGAATGACGAAGG + Intergenic
1075290664 10:121227835-121227857 CAAGGGAGGCAGAATGAAAATGG + Intergenic
1075419963 10:122293449-122293471 CAGGGGACACACATTGAAGAGGG + Intronic
1076228528 10:128800586-128800608 CCAGAGAAACAGAATCAATAGGG + Intergenic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1077246335 11:1541032-1541054 GAAGAGACACAGGAAGGAGAAGG + Intergenic
1077740705 11:4842497-4842519 GGAGAGAGACAGAGTGAAGAGGG + Intronic
1077924235 11:6664350-6664372 CAAGAGCCAGAGAAAGTAGAAGG + Intergenic
1077980629 11:7296571-7296593 AAAGAGACACAGGAAGAAGAAGG - Intronic
1078712486 11:13807846-13807868 CAAGACACAGAGAAAGAAGACGG - Intergenic
1078724178 11:13913912-13913934 CTACAGCAACAGAATGAAGAGGG - Intergenic
1080798404 11:35587254-35587276 CAAGAGACCCAGATTGAGTATGG + Intergenic
1080907953 11:36565552-36565574 CAAGAGACAAAGAACGAAAAGGG - Intronic
1081574410 11:44310228-44310250 AGAGAGACAGAGAAAGAAGAGGG - Intergenic
1082731293 11:56801128-56801150 CAAGTGACACAGTAGGAAAATGG - Intergenic
1082953508 11:58844014-58844036 CACATGACACAGAAGGAAGAAGG + Intronic
1082969909 11:59009274-59009296 CACATGACACAGAAGGAAGAAGG + Intronic
1084013284 11:66364344-66364366 CACGTGGCACAGCATGAAGAGGG + Exonic
1084478008 11:69399893-69399915 CCAGAGAAACAGAATCAATAGGG + Intergenic
1085392288 11:76188681-76188703 AAACAGACACAGAAGGGAGAGGG + Intronic
1086568042 11:88249273-88249295 CAGGAGCCACAGGATAAAGACGG + Intergenic
1087820656 11:102707969-102707991 CAACAGACCCAGACTGGAGAAGG - Intergenic
1087856967 11:103103848-103103870 CCAGAGAAACAGAATCAACAGGG + Intergenic
1088109121 11:106241558-106241580 TAAGAGACACAGAAACTAGAAGG - Intergenic
1088933432 11:114375535-114375557 GAAGAGACACTTAATGAAGGAGG + Intergenic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1089946461 11:122479256-122479278 CAAGAGAAACAGAATGCAGCAGG - Intergenic
1090487529 11:127127358-127127380 TAAAAGACACAGATTTAAGATGG + Intergenic
1091876200 12:3935366-3935388 AAACAGTCACAGAATGAAAAGGG + Intergenic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1092964003 12:13624374-13624396 GAAGAGAAACAGAATGAAGCAGG - Intronic
1093103203 12:15053026-15053048 AAAGAGACACAGGGTAAAGAAGG - Intergenic
1093425933 12:19028927-19028949 CAAGAGAAACAAAATTAATAGGG + Intergenic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1093816570 12:23556142-23556164 TAAGATACTCAGAATTAAGAAGG + Intronic
1094701560 12:32875352-32875374 AAAGAGAGAGAGAATGAATATGG + Intronic
1095849298 12:46783886-46783908 CAACAGAAACAGTATGAAGCTGG + Intronic
1096980541 12:55726044-55726066 CAAGAGACCCAGGATGGAGGTGG - Intronic
1097201545 12:57283177-57283199 CAAGAGTCATAGAATGAAAGTGG + Intronic
1097508072 12:60501409-60501431 CATGAGAAACAGAATGAATATGG + Intergenic
1098875942 12:75866791-75866813 CCAGAGAAACAGAACGAATATGG - Intergenic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1099399306 12:82182283-82182305 CAAGTGCCACAAAATGAATAGGG + Intergenic
1099747450 12:86723506-86723528 GAAGAAACACAGCAAGAAGATGG - Intronic
1099876813 12:88418022-88418044 CAAGAGAGCCCTAATGAAGATGG - Intergenic
1100163374 12:91888129-91888151 CAAGAGAGAGATAATGAAGAAGG + Intergenic
1100764444 12:97848245-97848267 CATGAGCCAAAGAATGCAGATGG - Intergenic
1100784646 12:98066038-98066060 CAATAGCCAAAGAATGAAGGTGG + Intergenic
1100790604 12:98126089-98126111 ACATAGACACAGAAGGAAGAAGG - Intergenic
1101443289 12:104719441-104719463 CGAGAGAGACAGAGTGAAGTGGG - Intronic
1101561643 12:105862834-105862856 CACGAGCCACAGAATGCAGGCGG - Intergenic
1101626241 12:106444844-106444866 TAAGTGTCACAGAATTAAGAGGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102449186 12:113027910-113027932 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
1102709141 12:114909977-114909999 GAAGAGGCAGAGAAAGAAGAAGG - Intergenic
1102741444 12:115211088-115211110 CAATAGACACAGAGCCAAGAAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103082403 12:118035667-118035689 CAACAGACACAAAAGGAAAAAGG + Intronic
1103542180 12:121673613-121673635 CAAGAGACAGACAATAAATAAGG - Intergenic
1103636962 12:122314859-122314881 CAAGTGACACAAATAGAAGATGG - Intronic
1105907180 13:24823538-24823560 GAAGAGACAGAGAAAGAGGAAGG + Intronic
1106029707 13:25988923-25988945 CCAGAGAGACAGCATGAAGCAGG + Intronic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1106584676 13:31046670-31046692 GAAGTGACACAGTAGGAAGACGG + Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107640116 13:42433447-42433469 CAAGAGACAGAGTGTGAAGATGG - Intergenic
1107729269 13:43331925-43331947 CAGGAAACAGAGAATGAATACGG + Intronic
1107806276 13:44156784-44156806 TAAGAAACAAAGAATGAAGATGG - Intronic
1107812677 13:44215439-44215461 GGAGAGACACAGAGAGAAGAGGG - Intergenic
1108063517 13:46554389-46554411 CAAAAGGCACGGAAGGAAGAGGG - Intronic
1108277406 13:48825502-48825524 CAGGAGACAGAGAGTGAAGGGGG + Intergenic
1108779842 13:53816178-53816200 AAACAGACACAGAAGGAAGAAGG + Intergenic
1108983462 13:56550481-56550503 CAAAAGATACATAATTAAGATGG + Intergenic
1109110355 13:58310337-58310359 CAAGAGAAACAGAAAAAAGGAGG - Intergenic
1109123323 13:58486175-58486197 CCAGAGACACAGAATGCATAAGG + Intergenic
1110237371 13:73230838-73230860 AAAGCCACACAAAATGAAGATGG + Intergenic
1110678756 13:78283001-78283023 CAAGAGACATAGAATGAGGCAGG - Intergenic
1110816576 13:79866989-79867011 CAAGTGAAACAAAATGAAGGAGG + Intergenic
1110834451 13:80067287-80067309 CAAAAGAGAGAGCATGAAGAGGG + Intergenic
1111223304 13:85235567-85235589 CAAAAGACACAGAATAACCAAGG + Intergenic
1112409154 13:99147024-99147046 GAAGAGACATAGAGAGAAGATGG - Intergenic
1112443368 13:99441853-99441875 AGAGAGACACAGAGTGAAGACGG + Intergenic
1112684492 13:101808331-101808353 AAAGAAGCACAGAAAGAAGATGG - Intronic
1114208265 14:20593665-20593687 CAGGTGCCACAGAATAAAGAAGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114593815 14:23893988-23894010 AAAGAGACAAAGACTGCAGATGG - Intergenic
1114748780 14:25180754-25180776 GAAGACAAACAGAATGATGAGGG + Intergenic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115475201 14:33806682-33806704 TAGGAGACACAGAAAGCAGAAGG - Intergenic
1115873468 14:37833750-37833772 CAACAGACACACAAAGGAGAAGG - Intronic
1116288287 14:43001431-43001453 CAATTGAGACAGAAGGAAGAAGG + Intergenic
1116402290 14:44522569-44522591 GCACAGACACAGAAGGAAGATGG + Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1117560554 14:56933613-56933635 CCAGAGAAACAGAATCAATAAGG + Intergenic
1117807044 14:59504908-59504930 GAAGATACACAGAATAAAAAGGG + Intronic
1118215461 14:63803993-63804015 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
1118337346 14:64865284-64865306 GAAGAGGCACAGAATGAATTGGG - Intronic
1118963766 14:70560713-70560735 CAAGAGAGAGAGAGTGAAGGGGG - Intergenic
1119086713 14:71745920-71745942 CACGAATCACAGAATCAAGATGG + Intergenic
1119110781 14:71971945-71971967 CAACAGGCAGAGAAGGAAGATGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120469510 14:84904364-84904386 GGAGAGACAGAGAATGAAGGAGG - Intergenic
1120647603 14:87092077-87092099 ACAGAGACACACAGTGAAGAAGG + Intergenic
1120792451 14:88597652-88597674 CAGGAGGCAGAGAATGAAGTTGG - Intronic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1121142248 14:91553936-91553958 AAAGAGACTGAGAAAGAAGATGG - Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1121707539 14:96010272-96010294 CAAGAAAGAGAGAATGGAGAGGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122150403 14:99722470-99722492 AAAGAGACACAAAATAAAGGAGG - Intronic
1123475485 15:20589251-20589273 CAAGACATGCAGAATCAAGATGG + Intergenic
1123576362 15:21674043-21674065 CAAGAGACAGAAAATTAACAAGG - Intergenic
1123612986 15:22116511-22116533 CAAGAGACAGAAAATTAACAAGG - Intergenic
1123642526 15:22411112-22411134 CAAGACATGCAGAATCAAGATGG - Intergenic
1123807810 15:23893186-23893208 CAGGAGACACAAAAGCAAGAAGG + Intergenic
1124079457 15:26477917-26477939 AAAGAGAAACAGAGTGAAAATGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125269907 15:37927361-37927383 TAAGAGATACACACTGAAGAGGG + Intronic
1125285682 15:38090175-38090197 AGAGAGAGACAGAATGAAGCGGG - Intergenic
1126096571 15:45094764-45094786 CAAGAGACAGAGAATGGGGAGGG + Intronic
1126282099 15:46965404-46965426 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
1126373570 15:47972068-47972090 CAAGAGACAGAGGAGGAAGAAGG - Intergenic
1126552108 15:49943180-49943202 AAAGAGAAAAAGAATGAAAAAGG + Intronic
1127693279 15:61418864-61418886 CAAGGGACACAGAAAGGAGTTGG + Intergenic
1127743351 15:61937053-61937075 AGAGAGAGACAGAATGGAGATGG - Intronic
1128313017 15:66643495-66643517 GTAGAGACACAGGAAGAAGATGG + Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129527976 15:76234592-76234614 CAACAGAAACAGAAAGAAGGAGG + Intronic
1130104156 15:80916837-80916859 GATGACACACAGAATCAAGAGGG - Intronic
1130143602 15:81254357-81254379 GAATGGACCCAGAATGAAGATGG - Intronic
1130267389 15:82419672-82419694 CAAAAAAAACAGAATGAAAAAGG + Intergenic
1130671198 15:85914410-85914432 AAAGAGACACAGGGAGAAGATGG - Intergenic
1131565628 15:93483112-93483134 CAAGAGCCACAGAATGCTAAAGG + Intergenic
1131770904 15:95736392-95736414 CAGGAGACAGAGAGTGAAGGGGG + Intergenic
1131871253 15:96767466-96767488 CAAGAGGAACAGAAAAAAGAGGG - Intergenic
1132077231 15:98831970-98831992 CGAGAGACAAAGGATGAGGAAGG + Intronic
1202985230 15_KI270727v1_random:408288-408310 CAAGAGACAGAAAATTAACAAGG - Intergenic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133190243 16:4128369-4128391 ACAGAGGCACAGAAGGAAGATGG + Intergenic
1133368233 16:5228167-5228189 AAAGAGACAAAGAATCAAAAGGG - Intergenic
1133389911 16:5401968-5401990 CAAAAGACACACAATGAAACTGG + Intergenic
1133505101 16:6403919-6403941 GAAGAGACACAGTAGGAAGGTGG + Intronic
1134814384 16:17193983-17194005 CAAGAGACACAGAGTGACCTGGG + Intronic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1137873890 16:51976905-51976927 AAAGAGACACAGAGAAAAGATGG - Intergenic
1137971170 16:52986535-52986557 GGAGAGACACAGGAAGAAGATGG - Intergenic
1138187994 16:54991385-54991407 CCAGAGAAACAGAATCAATAGGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138589356 16:57991280-57991302 GGAGAGACACACAATAAAGAAGG + Intergenic
1138694875 16:58803726-58803748 GAAGAGACACAGGAAGAAGGTGG - Intergenic
1138725979 16:59139622-59139644 GAAGAGACATAGAGAGAAGATGG - Intergenic
1138852390 16:60644471-60644493 GAAGGGACACAGGATGAAGGAGG - Intergenic
1139339740 16:66260329-66260351 AAAGAGAGAGAGAATGAAGCTGG - Intergenic
1140160554 16:72487670-72487692 GAAGAGACAAAGAATGGAGTAGG - Intergenic
1140351563 16:74266718-74266740 TAGAAGACACAGAATGGAGAAGG - Intergenic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140871479 16:79110611-79110633 CAAGAGAGACAGAGTGGGGACGG - Intronic
1140984663 16:80146695-80146717 CAAGTCACACAGAAAGATGATGG - Intergenic
1141474537 16:84263882-84263904 CAAGACACACAGAGAGAAGCTGG + Intergenic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1142660053 17:1422529-1422551 CAAGTTGCACAGAATGCAGAGGG + Exonic
1143456689 17:7072403-7072425 CCAGGGCCACAGAATGTAGAGGG - Intergenic
1144219985 17:13091140-13091162 CAAGAGACACAGTTTGGATATGG + Intergenic
1144268957 17:13600131-13600153 CAAAAGATAAAGAATGAAAACGG + Intronic
1144460292 17:15453087-15453109 TGAGAAACACAGAATGAGGAAGG + Intronic
1144750319 17:17644103-17644125 GAAGAGACACAGGGAGAAGACGG + Intergenic
1144852940 17:18253193-18253215 CAAGTCAGACAAAATGAAGATGG - Intronic
1145356414 17:22159098-22159120 CAAGAGAAACAGAATTCAAATGG - Intergenic
1145981993 17:29018403-29018425 CAAAAGACACTTTATGAAGATGG + Intronic
1146040022 17:29443323-29443345 CAAGAGCAACAAAAAGAAGATGG - Intronic
1146830849 17:36068227-36068249 CACCAGACACAGTAAGAAGAAGG + Intronic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1149530990 17:57395138-57395160 AAACAGACACAGAAAGAAGGTGG - Intronic
1150971208 17:70030107-70030129 CAAAAGACAAAGAATAAAGATGG - Intergenic
1151418320 17:73981246-73981268 TAAGAAACACAGAAGGAGGAAGG + Intergenic
1151809336 17:76428178-76428200 CAAAAGACTGGGAATGAAGATGG - Intronic
1151928843 17:77217994-77218016 CAACAGACACAGAAATATGAGGG - Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1153082222 18:1241022-1241044 CAACAAACAAAGAAGGAAGAAGG + Intergenic
1153222085 18:2870866-2870888 GAAGAGACACAGGGAGAAGACGG - Intronic
1154928978 18:20972783-20972805 CAAGAGAGAATGAAAGAAGACGG + Intronic
1155352194 18:24917685-24917707 CAAAGGACACAGAAAGGAGACGG + Intergenic
1155393316 18:25360291-25360313 AAAGAGAGAGAGAAAGAAGACGG - Intergenic
1155645156 18:28068927-28068949 CAAAAGAGAAAGAATAAAGATGG - Intronic
1155767091 18:29649472-29649494 AGACAGACACAGAATGGAGAAGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156773159 18:40754544-40754566 CAAGCAAGACAGAATGAGGAAGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157116038 18:44863736-44863758 GTAGAGAGACAGAGTGAAGATGG - Intronic
1157138526 18:45082526-45082548 AAAGTGCCACAGAAGGAAGAAGG + Intergenic
1157682137 18:49615458-49615480 CCACAGACACAGAAAGCAGAGGG - Intergenic
1158447335 18:57532785-57532807 GAAGAGACTCAGAGGGAAGACGG - Intergenic
1158565755 18:58553009-58553031 ACAGAGACACAGAGGGAAGAAGG + Intronic
1158660189 18:59380277-59380299 CCATAGAGACAGAATGCAGATGG + Intergenic
1158660409 18:59382188-59382210 ACAGAAACACAGAAGGAAGATGG - Intergenic
1158840537 18:61381619-61381641 CAAGAGAGACAAAAGGGAGATGG + Intronic
1159175721 18:64831234-64831256 CAAGAGAGAGAGAATAAGGAGGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159359831 18:67385697-67385719 GATAAGAGACAGAATGAAGAGGG - Intergenic
1159534474 18:69698377-69698399 GAAGAGACGAAGAATGGAGAAGG - Intronic
1159857169 18:73602791-73602813 CAAGAAGCACAGTTTGAAGACGG - Intergenic
1159868977 18:73739440-73739462 AAAGAGACACAGAAGCAAGGTGG - Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1160350869 18:78177095-78177117 CCAGAGGCACCGAAGGAAGAAGG - Intergenic
1161415810 19:4145709-4145731 CAAGAGGAACAGAATGGAGAGGG + Intergenic
1161625942 19:5326829-5326851 CAAGAGAGAAAGAAAGAAAAAGG + Intronic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161932431 19:7349813-7349835 CAGGAGACAGAGAATGAATGGGG + Intronic
1162006578 19:7784250-7784272 TAAAAGCCTCAGAATGAAGAGGG + Intergenic
1162855581 19:13465955-13465977 CCATAGAGACAGAATGCAGATGG + Intronic
1163758688 19:19121370-19121392 CCAGAGCCACAGGATGAACAGGG + Exonic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164777904 19:30868528-30868550 GCAGAGCCACAGAATGAAGGAGG + Intergenic
1164844038 19:31416652-31416674 CAAGACACAGAGGAAGAAGATGG + Intergenic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1165881527 19:39047422-39047444 AAAGATACACAGAAAGAAGGGGG - Intergenic
1166643353 19:44512968-44512990 CTAGAGGCACAGAATAATGAGGG - Intronic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167322720 19:48806451-48806473 CAAGAGACACAGCAAGGAGGAGG + Intronic
1167676157 19:50887438-50887460 CAAGAGACAGAGAAGAGAGAGGG + Intergenic
1168087840 19:54061500-54061522 AGAGACACACAGAAGGAAGACGG + Intronic
1168372041 19:55843879-55843901 CAAGAGACTAAGGATGAAAAGGG - Intronic
1168516121 19:57011563-57011585 GAAGAGAGAGAGAAAGAAGAGGG - Intergenic
1168589390 19:57619974-57619996 TAAGAGTCACAGAATGGAGATGG - Intronic
925612992 2:5718807-5718829 TAAGAGACACTCAATGAACAAGG + Intergenic
925683205 2:6444819-6444841 GAAGAGACACAGGAAGAAGATGG - Intergenic
925921969 2:8644559-8644581 GAAGAGACACAGGGAGAAGATGG + Intergenic
925958948 2:8996804-8996826 TAAGAGATACAGATTGAAGTAGG - Intronic
926357623 2:12056049-12056071 GGAGAGACACAGGAAGAAGACGG - Intergenic
926590071 2:14731175-14731197 CAAGAGAGGCAGAATGGAGCCGG + Intergenic
926756654 2:16241873-16241895 CCACCCACACAGAATGAAGAGGG - Intergenic
927140891 2:20130101-20130123 CAAGTGAGACAGGAGGAAGAGGG - Intergenic
927202241 2:20584974-20584996 CAAGGGACAGAAAATGGAGAGGG + Intronic
927967033 2:27276888-27276910 AAAGAGATACAGAAAGAAAAAGG - Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928210966 2:29323416-29323438 CCAGAGACAGAGAATGCTGATGG - Intronic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929094601 2:38251494-38251516 CAACAGCCACAGCCTGAAGAGGG + Intergenic
929246401 2:39708008-39708030 CTAAAGACACACAATGAATAAGG + Intronic
929373388 2:41254238-41254260 CAAGGGAGACACAAAGAAGAAGG + Intergenic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
930454311 2:51585492-51585514 AAACAGACAAAGCATGAAGATGG + Intergenic
930483759 2:51985783-51985805 AAAGAAAGACAAAATGAAGAAGG + Intergenic
931360700 2:61575365-61575387 CAAGAGGTATAGGATGAAGAAGG - Intergenic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
932907275 2:75767551-75767573 CCAGAAAGACTGAATGAAGAAGG - Intergenic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
933571789 2:84022429-84022451 CAAGAGACTGAGGATGAGGAGGG + Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
934513139 2:94964348-94964370 CAGGGGACACAGAATCACGATGG - Intergenic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936014373 2:108946670-108946692 CAAGAGAAAGACAGTGAAGAGGG + Intronic
936068336 2:109348763-109348785 CAAGAGACAGGAGATGAAGATGG - Intronic
936625420 2:114143124-114143146 CAAGACACAGAAAATGAAGGAGG - Intergenic
936637058 2:114270905-114270927 TGAGAGACACAGAGAGAAGAGGG + Intergenic
936816226 2:116464200-116464222 AGAGAGCCACAGAAGGAAGATGG - Intergenic
937295143 2:120805600-120805622 CCAGAGACACAAAATGCAGAGGG + Intronic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
937755406 2:125531250-125531272 GAAGAGGCTCAGAAAGAAGAGGG - Intergenic
937820323 2:126303079-126303101 CAAGGGGCAAAGAATGGAGACGG + Intergenic
938594829 2:132777314-132777336 CAAGAGACACAGGGGGAAAAGGG + Intronic
939794789 2:146629559-146629581 GAAGAGACACAGGGAGAAGATGG - Intergenic
940173668 2:150855029-150855051 GAACAGAGACTGAATGAAGATGG - Intergenic
940442327 2:153732259-153732281 CAAAAGACACTGAAACAAGAAGG - Intergenic
940896992 2:159090390-159090412 CGAGAGCCACAGAAGCAAGAAGG - Intronic
940986022 2:160053167-160053189 GAAGAGACACAGGGAGAAGATGG - Intronic
941256187 2:163234252-163234274 CAAGAGAGACAGAAAGAGAAGGG + Intergenic
941440092 2:165523868-165523890 AAAGAGCAATAGAATGAAGATGG - Intronic
941684409 2:168433671-168433693 CTAGACACACAGAGTGGAGAAGG + Intergenic
941727800 2:168882781-168882803 GATGAAACACAGAATGCAGATGG + Intronic
941802191 2:169672334-169672356 CCAGAGAAACAGAACCAAGAGGG + Intronic
942322772 2:174750422-174750444 CATGGGACACAGGAAGAAGATGG + Intronic
943465394 2:188222901-188222923 AAAGACACACAGAAGGAAGATGG - Intergenic
943546353 2:189284469-189284491 CAAGAGAGACAGAGAGAAGGGGG + Intergenic
943964466 2:194315035-194315057 CAAAAGAAACAGAATGAAAAGGG - Intergenic
944188139 2:196972134-196972156 CATGAGCCACAGGTTGAAGATGG + Intronic
944472809 2:200072978-200073000 AAAGAGACACAGACAGAAGAAGG - Intergenic
944821122 2:203432484-203432506 CAACAGACAAACACTGAAGATGG + Exonic
945092405 2:206187664-206187686 AAAGAGACACAAAAAGAAAATGG + Intronic
945283530 2:208060054-208060076 CAAGAGAGAGAGAGTGAAGGTGG + Intergenic
945755978 2:213847456-213847478 CAAGAGAGAAAGACTGAAGGAGG + Intronic
946002369 2:216493268-216493290 CAAGAGGCACAGTCTGAAAAGGG + Intergenic
946041312 2:216785086-216785108 GAAAACACACAGAAAGAAGATGG - Intergenic
946323415 2:218968060-218968082 AAAGAGAGAGAGAAGGAAGAGGG + Intergenic
946566059 2:220966975-220966997 GAAGAGACACAGGGAGAAGATGG - Intergenic
946627335 2:221628000-221628022 CAAGGGACATAGACTCAAGATGG - Intergenic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947280657 2:228450090-228450112 GTAGAGACACAGAAGTAAGATGG + Intergenic
947406531 2:229783264-229783286 CAATAGACACTGAATGAGCATGG - Intronic
947569511 2:231221253-231221275 ACACAGACACAGAAGGAAGACGG - Intronic
947944806 2:234092363-234092385 CAAGAGACACAAAATGTATGTGG - Intergenic
948006511 2:234613572-234613594 CAAGAGACAGGGAATAAAAATGG + Intergenic
948056307 2:235011331-235011353 ACAGAGACACAGACAGAAGAGGG - Intronic
948204381 2:236155341-236155363 AAAGAGACACATAATGAAGAGGG - Intergenic
948259578 2:236592837-236592859 CGAGAGAGACAGGATGAAGGCGG - Intergenic
948550475 2:238768964-238768986 CATGAGACACAGAAAGACAAAGG - Intergenic
948715718 2:239860524-239860546 CCAGAAAGACAGGATGAAGATGG + Intergenic
948773041 2:240261832-240261854 GAAGAGAGAGAGAATGAAGGGGG - Intergenic
1169119243 20:3085284-3085306 CAAGGGACACAGAATGAGAGGGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170273957 20:14562735-14562757 CAAGAGACCCAGCAAGAAGGAGG - Intronic
1170366179 20:15600501-15600523 AAAGAGATAGAGAAAGAAGAAGG - Intronic
1170509699 20:17063999-17064021 CTAAAGACACAAATTGAAGAAGG - Intergenic
1171001726 20:21422360-21422382 GGAGAGACAGAGAATGAAGGGGG + Intergenic
1171045505 20:21806462-21806484 CCAGAGAAACAGAATCAATAGGG + Intergenic
1171101391 20:22386686-22386708 CCAGAGACACAAAAAGTAGAAGG - Intergenic
1171310263 20:24139815-24139837 ACAGAGACACAGAAGGTAGAAGG + Intergenic
1172266048 20:33615205-33615227 CCATGGACACAGAATGCAGATGG - Intronic
1172289808 20:33767973-33767995 CAAGATAAACAGAAAGCAGAGGG + Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1173842269 20:46165662-46165684 TAAGAGACACAGAGAGAAGATGG + Intergenic
1174464416 20:50706263-50706285 CTAGAGAGACAGAATGTAGAGGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174705834 20:52655182-52655204 GAAGACACACAGAGAGAAGATGG - Intergenic
1176426818 21:6553274-6553296 CAAGAGACATCCAATGAGGAAGG + Intergenic
1176913321 21:14595015-14595037 CAAGAGCAAAAGAATGAAGGCGG + Intronic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177660826 21:24081580-24081602 GAAAAGACACAGAGAGAAGATGG + Intergenic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1177972117 21:27803037-27803059 CTAGAGAAAGAGAATGGAGAGGG - Intergenic
1178338477 21:31765293-31765315 CAAGAAGTCCAGAATGAAGAGGG - Intergenic
1178867440 21:36341235-36341257 CAAGAGAAAAAGAAAGAAAACGG - Intronic
1178978762 21:37243602-37243624 CCAGAGACACTGAAAGGAGACGG + Intronic
1179328027 21:40369182-40369204 AAAGATGTACAGAATGAAGATGG - Exonic
1179702309 21:43161596-43161618 CAAGAGACATCCAATGAGGAAGG + Intronic
1181139388 22:20792878-20792900 CATGAGACACAGGATGAAAGTGG + Intronic
1181792641 22:25280025-25280047 CAAGAAAAAGAGAAAGAAGAGGG + Intergenic
1181813176 22:25417610-25417632 CAAGAAAAAGAGAAAGAAGAGGG + Intergenic
1182634061 22:31710280-31710302 TTAGAGACACACAATGAACAAGG + Intronic
1182818374 22:33189438-33189460 CAAGAAACTCAGAAAGAAAAAGG - Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183207990 22:36432649-36432671 CCAGAGGAACAAAATGAAGAAGG - Intergenic
1183888675 22:40906922-40906944 GAAGAGACAGAAAATCAAGAGGG + Intronic
1184606380 22:45576952-45576974 GCAGAGGCACAGAATGGAGAAGG - Intronic
1185114490 22:48923931-48923953 CCAGAGAAACAGAATAAACAGGG - Intergenic
949151171 3:769153-769175 CGAGAGACAGAGAATAAAGAGGG + Intergenic
949214555 3:1550242-1550264 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
949911095 3:8908455-8908477 CAAGAGACATAGGGAGAAGATGG + Intronic
949941122 3:9155540-9155562 TAAGAGACACAGGAAGTAGATGG - Intronic
951008334 3:17646165-17646187 GGAGACACACAGAAAGAAGATGG + Intronic
951539092 3:23765433-23765455 CTAGAGACACTGAACGAACAGGG + Intergenic
951801252 3:26598556-26598578 CAAGAGTCAAAGTCTGAAGATGG + Intergenic
952258880 3:31720315-31720337 CAAGAGCCTCAGAATTAAGCCGG - Intronic
952326225 3:32322848-32322870 CCAGAGACAGAGAAAGCAGAGGG + Intronic
952727697 3:36605347-36605369 CAAGGGACCCAGAATGAACCAGG + Intergenic
953244108 3:41175318-41175340 CCATAGAGACAGAATGGAGAAGG - Intergenic
953824728 3:46241197-46241219 CAAAAGACAAAGAAAGAGGAAGG - Intronic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
954811293 3:53249937-53249959 CAAGAGACAATGAATGTTGAGGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956400929 3:68878958-68878980 TAAGAGACACAGAAGAAAGGTGG - Intronic
956516368 3:70052920-70052942 CAAGAGAAGCAGAAAGAAAAGGG - Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957111505 3:75965513-75965535 CAAGAGACTCACAAACAAGATGG - Intronic
957415478 3:79897272-79897294 AAACAGTCAAAGAATGAAGATGG - Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
958159872 3:89804913-89804935 CAAATGACACAGAAAGAAAATGG + Intergenic
958970860 3:100608940-100608962 GAAGAGACAGAGAGAGAAGACGG - Intergenic
959032469 3:101315940-101315962 TAAGTGGAACAGAATGAAGAGGG + Intronic
959183059 3:103006974-103006996 CAATAAACACAGAATCATGATGG + Intergenic
959785902 3:110296844-110296866 TCAGAGACACAAAATGAAGCAGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961617977 3:128198714-128198736 GAAGAGCCACACAATGCAGAGGG + Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962045149 3:131750976-131750998 CAAAAGACATAGAAGAAAGAAGG - Intronic
962077114 3:132094319-132094341 CAAAAGACAAACAATGAAGTAGG - Intronic
962327971 3:134451529-134451551 CAAAAGAGACAGAGTGAAGTGGG - Intergenic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
963007794 3:140742023-140742045 CAAGAGAAACAGAAGCAATAGGG + Intergenic
963033216 3:140999812-140999834 CAGGTGACACTGAATCAAGATGG - Intergenic
963254451 3:143130833-143130855 AAAGAAACACGGAAGGAAGAGGG - Intergenic
963625730 3:147670203-147670225 CACGAGCCAAAGAATGCAGATGG - Intergenic
964417924 3:156469133-156469155 GAAGAGAAAAAGAATGGAGAAGG + Intronic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
966396347 3:179507620-179507642 CAAGAACAACAGGATGAAGATGG - Intergenic
967111663 3:186298991-186299013 GGAGAGACACAGCAGGAAGAGGG - Intronic
967330280 3:188283095-188283117 CTAGAGAGACAGGATTAAGAAGG - Intronic
967450199 3:189614628-189614650 CAAGAGATACAAAATAATGAAGG - Intergenic
967571325 3:191032117-191032139 GAAGTGGCACAGAATGAAGTTGG + Intergenic
968637816 4:1691141-1691163 TAAGAGTCACAGAATTAACATGG - Intergenic
968691962 4:1995298-1995320 CCAGAGAAACAGAACCAAGAGGG - Intronic
969182378 4:5452102-5452124 CAAGAAGCACAGAATGTGGATGG - Intronic
969879470 4:10161208-10161230 CAAAAGACCTAGAATGAAGAGGG + Intergenic
970495648 4:16622455-16622477 CAAGAGACCTTGGATGAAGAAGG - Intronic
971109194 4:23563845-23563867 CCAGAGAAACAGAATAAAAAGGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
972336046 4:38107871-38107893 CAAGAAACACAGAAGCAACATGG - Intronic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972728208 4:41765300-41765322 CAAGAGAATGAGAATGAATAAGG + Intergenic
972998458 4:44913618-44913640 CCAGAGAGACAGAATCAATAAGG - Intergenic
973177815 4:47229726-47229748 AAAGAGACACACAGAGAAGATGG + Intronic
973769748 4:54195504-54195526 GAAAAGAAAGAGAATGAAGAGGG + Intronic
974515469 4:62902545-62902567 AAAGAGAGAGAGAAAGAAGAAGG + Intergenic
974529968 4:63096205-63096227 CCAGAGAAACAGAACCAAGAGGG + Intergenic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
975177446 4:71304148-71304170 CCAGAGAAACAGAACCAAGAGGG + Intronic
975608167 4:76176993-76177015 CCAGAGAAACTGAATCAAGAGGG - Intronic
975857258 4:78637656-78637678 CAAGAGGGAAAGATTGAAGAGGG + Intergenic
976084085 4:81389343-81389365 AAAAAGAGACAGAATGAACATGG + Intergenic
976184696 4:82431636-82431658 TAACAGACAAAGAATAAAGAAGG - Intronic
976541191 4:86278858-86278880 CAAGAGACAAAGAAAGACAAAGG + Intronic
976650642 4:87430180-87430202 CATGAGCCACAGAATGCAGGTGG + Intronic
977076902 4:92464980-92465002 CAAGAGAGAGAGAGTGAAGAGGG - Intronic
977156602 4:93581500-93581522 CAAGAGTCACAGAGTTAAGAGGG + Intronic
977200239 4:94106697-94106719 ACAGAGACACAGAGGGAAGATGG - Intergenic
978742457 4:112152605-112152627 CAACAGAGACAGAAAGGAGATGG - Intronic
979443898 4:120787650-120787672 CATGAGACACAAAAAGAAGGAGG + Intronic
979508370 4:121524099-121524121 GAAGTGACACAGGATGAAGAAGG + Intergenic
979527713 4:121735085-121735107 GAAGAGACACAGAAGGAATGAGG - Intergenic
979938287 4:126725168-126725190 CAAGATACATAGAATGAATTGGG + Intergenic
980046733 4:127997541-127997563 GAAGAGAGGCAGACTGAAGAGGG - Intronic
980094249 4:128473188-128473210 GAAGAGAAACAGATTGAAGATGG + Intergenic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
980843553 4:138296471-138296493 CAAGAGACACAAAATAATCAAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981457838 4:144976788-144976810 CAATAGACACACCATGAAAAAGG + Intronic
981491854 4:145348129-145348151 CAAGAAATATAGAATGATGATGG + Intergenic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
981874288 4:149521920-149521942 CAAGAAACACTGAATGCTGAGGG + Intergenic
982321065 4:154077991-154078013 GAAGAGACACGGAATGAAGTGGG + Intergenic
982567352 4:157002392-157002414 GAAGAGAAACACAAAGAAGAAGG - Intergenic
983441043 4:167785227-167785249 GATGAGACAGGGAATGAAGAAGG - Intergenic
983787762 4:171755479-171755501 CAAAATAAACAGGATGAAGAGGG + Intergenic
984781412 4:183529613-183529635 AAAGAGCCAGAGAAAGAAGAGGG - Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
986129726 5:4917724-4917746 CAAGAAACAGAGAAAGAAGAGGG + Intergenic
987212821 5:15701218-15701240 CCAGAGACACAGAAAGTAGTCGG - Intronic
987229404 5:15877911-15877933 GAAGAGACACAGAGTAAGGATGG - Intronic
987268729 5:16282665-16282687 CTAGAGATACAGGAAGAAGAAGG + Intergenic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
988813247 5:34805915-34805937 CAAGAAACACAGTATGAGAAAGG - Intronic
988932687 5:36052471-36052493 CAAGAGGCAAAGAGTGAAAATGG - Intronic
989279412 5:39623400-39623422 CAAGAAAAACATAATTAAGAAGG - Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990151476 5:52822755-52822777 CCAGGGACACATAATGAAGATGG + Intronic
990177823 5:53127292-53127314 CAAGAAACAGAGAATGAATTAGG + Intergenic
990288915 5:54329041-54329063 GAAGAGACACAGAAGGAAGATGG - Intergenic
990761327 5:59133148-59133170 CATGAAACACAAAATGAAAAAGG + Intronic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
992628876 5:78661450-78661472 AAAGAGAGAAAGAAAGAAGAAGG + Intronic
992728346 5:79632103-79632125 CCAGAGAAACAGAGTGCAGAAGG + Intronic
992778319 5:80106837-80106859 AAAGAGACACAGGGAGAAGATGG - Intergenic
993430193 5:87823355-87823377 CAAGAGAGAGAGAAAGAGGAAGG + Intergenic
993569177 5:89514999-89515021 AAAGAGAGAAAGAAAGAAGAAGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994565376 5:101439433-101439455 CAGGAGAGACAGAGTGAAGGAGG - Intergenic
994675123 5:102811357-102811379 CAGGAGCCACGGAATGCAGATGG - Intronic
995168187 5:109072957-109072979 GAAGACACACAGAGGGAAGAAGG - Intronic
995399255 5:111721754-111721776 CAAGAGAGAAAGAGTGAAGCAGG - Intronic
995952257 5:117730301-117730323 GGAGAGAGACAGAGTGAAGAAGG - Intergenic
996192939 5:120567687-120567709 CAGGAGACAGAGAGTGAAGGGGG - Intronic
996835595 5:127788647-127788669 CAAAAGATACAGAATCAAAATGG - Intergenic
996949804 5:129111769-129111791 AAAGAGAGACAGAAAGGAGAAGG - Intronic
997365733 5:133324183-133324205 CACCTGCCACAGAATGAAGATGG - Intronic
997753165 5:136369571-136369593 CAAGAGACAGAGAAGGAAGCTGG - Intronic
998209680 5:140185426-140185448 CAAGAGATATTGAATGAAGTAGG + Intronic
998756625 5:145388077-145388099 CAAGAGATAAAGGATGAGGATGG + Intergenic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999412744 5:151366561-151366583 CAGGAGGCACAGGATGATGAGGG + Intergenic
999550351 5:152679680-152679702 TAAGAGAAAAAGACTGAAGAAGG - Intergenic
999694680 5:154178631-154178653 CCAGTGACACAGAGGGAAGAAGG - Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
1000359579 5:160434581-160434603 AAAGAGACAGAGAAAGAAGGGGG + Intergenic
1000573658 5:162948239-162948261 AGAGAGACAGAGACTGAAGAAGG + Intergenic
1000987290 5:167874913-167874935 CAAAAACCACATAATGAAGAGGG + Intronic
1000988626 5:167888534-167888556 GGAGAGACAGAGAATGAAGAAGG + Intronic
1001293777 5:170484809-170484831 CCAGAGACACGGAAGGAAGAAGG - Intronic
1001668771 5:173456264-173456286 AAAGAGACATAGGAAGAAGATGG + Intergenic
1002106684 5:176882721-176882743 CAAGAAGCACAGAAAGAAAAAGG + Intronic
1002612929 5:180433223-180433245 CCAAAGACACAGAGTGAAGCAGG - Intergenic
1002851225 6:998036-998058 GAAGAGACACAGGAAGGAGACGG - Intergenic
1002922961 6:1586055-1586077 CAAAAGTCACAGAATGGAAAAGG - Intergenic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003374934 6:5568131-5568153 CAAGAGACACAGACAGAAAGGGG - Intronic
1003747765 6:9022447-9022469 CCAGAGACACAGAAGGGAGGGGG - Intergenic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1004475879 6:15970620-15970642 AACGTGACACAGAATAAAGAGGG + Intergenic
1004568445 6:16821671-16821693 GTAGGGACACAGAATGATGATGG + Intergenic
1004700140 6:18071107-18071129 ACAGACACACAGAAGGAAGATGG - Intergenic
1004926525 6:20421126-20421148 CAAGAGAACTAGAATGAAAATGG - Intronic
1005027070 6:21473508-21473530 AAAGAGACACAGGGAGAAGATGG - Intergenic
1005027459 6:21477122-21477144 GAAGAGACCCAGTAAGAAGATGG - Intergenic
1005350707 6:24932428-24932450 AAAGAGAGACAGAAAGAAAAGGG - Intronic
1005732604 6:28713172-28713194 CAAGACTCACAGAATAAAAATGG - Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006173453 6:32108420-32108442 GAAGGGGCACAGAGTGAAGACGG + Intronic
1006611060 6:35294815-35294837 ACAGAGACACAAAATGATGAAGG - Intronic
1007366183 6:41395388-41395410 CAGGACACAGAGAATGGAGAAGG + Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008051720 6:46906894-46906916 AAAGAGACACAAAAGGAAGGAGG + Intronic
1008350515 6:50484287-50484309 AAAGAGACAGAGAAGGAACAGGG + Intergenic
1008408516 6:51145817-51145839 CCAGAAAAACAGCATGAAGATGG + Intergenic
1008505347 6:52224682-52224704 AAAGAGAGACAGAAAGAAGAGGG - Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1009315826 6:62219281-62219303 TAAGAGATACAGAAAGCAGAGGG + Intronic
1009350257 6:62666781-62666803 AGAGAGACACAGAAAGAAGAAGG + Intergenic
1009399532 6:63237879-63237901 CAAGAGAGACAGTAGGAAGGGGG + Intergenic
1009761558 6:68013096-68013118 GAAGAGACAAAGAACGAAGTGGG + Intergenic
1010860298 6:80901417-80901439 CATGAGAGATAGCATGAAGAAGG + Intergenic
1010875652 6:81101956-81101978 CAGGAGAGACAGAGTGAAGGGGG - Intergenic
1011012927 6:82722262-82722284 AAAAAGACACAGAATAAAGGGGG + Intergenic
1011577528 6:88819367-88819389 CAAGAAAAAAAGAATGAAAAAGG + Intronic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1011765351 6:90613829-90613851 CAGGAGACAAAGAAAGCAGAAGG - Intergenic
1012170120 6:96006532-96006554 CCAGAGAAACAGAATGTAGTAGG - Intergenic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1013687271 6:112600275-112600297 CAAGTGACGTAGAATGAGGAAGG - Intergenic
1014353360 6:120372389-120372411 CAAGAAAAACAGAATGCAGTGGG - Intergenic
1015274599 6:131371206-131371228 AGAGAGACACAGACAGAAGAAGG + Intergenic
1015637044 6:135287409-135287431 GAAAAGAGACAGAATAAAGATGG + Intronic
1016878180 6:148884456-148884478 GAATAGAGACTGAATGAAGAGGG + Intronic
1017168942 6:151437741-151437763 CAGGAGATACAGAATGGAGGTGG - Intronic
1017219617 6:151950628-151950650 GAAGAGACACAGGAAGAGGACGG + Intronic
1017652069 6:156593119-156593141 AAAGAGAGAAAGAAGGAAGAGGG + Intergenic
1017663070 6:156692434-156692456 GCAGAGACACAGGAGGAAGATGG - Intergenic
1017979241 6:159385048-159385070 CAAGAGAGAGAGAGCGAAGAGGG + Intergenic
1018468424 6:164074024-164074046 AAAGAGACAGAGAAGGAAGTGGG + Intergenic
1018496984 6:164358927-164358949 GAATAGAGACTGAATGAAGAAGG - Intergenic
1018604676 6:165584548-165584570 CAAGAGACACAAAATGGTGCTGG - Intronic
1019393469 7:803022-803044 AAAGAGAGACAGAAGAAAGAAGG + Intergenic
1019532093 7:1508736-1508758 ACAGAGACACAGAGAGAAGACGG - Intergenic
1020726923 7:11827491-11827513 CAAGATACACTAGATGAAGACGG - Intronic
1021168727 7:17372307-17372329 CAAGAGCCACAGAATGCAGATGG - Intergenic
1022109384 7:27219288-27219310 CAAGGGAGACATAATGAAGGAGG + Intergenic
1022756475 7:33297560-33297582 CAAGAAACAGAGAAGCAAGAAGG + Intronic
1023140806 7:37100602-37100624 CAGGAGGCACAGAATGAATTGGG - Intronic
1023508242 7:40922407-40922429 CAAGAGCCACCTAATGAAGAAGG - Intergenic
1024140308 7:46456320-46456342 AAACAGACACAGACTGAACAAGG + Intergenic
1024286484 7:47762323-47762345 GAAGAGACACAGAGAGAAGATGG + Intronic
1024459924 7:49649428-49649450 CAAGAGCAAAAGAGTGAAGAGGG + Intergenic
1024472747 7:49780225-49780247 CAATAGACACAGAATCAGAATGG - Intronic
1024538076 7:50454763-50454785 AAAGAGTCACAGAGGGAAGAAGG + Intronic
1024966330 7:55025273-55025295 CCAGAGACAGAGGATGAAGCAGG + Intronic
1026256014 7:68712028-68712050 CAAGAGAAATAGAATTAAAATGG - Intergenic
1026259705 7:68744447-68744469 CAAGCAACACAGAACGATGACGG - Intergenic
1027157164 7:75776597-75776619 CAAGAAAGAAAGAAAGAAGAAGG + Intronic
1027352987 7:77330554-77330576 AAAGAGACAGAAAATGAAGTGGG - Intronic
1027675622 7:81154406-81154428 CACAAGACACAGGAAGAAGATGG - Intergenic
1029216195 7:98951914-98951936 CAGGAGACACAGCCTGGAGAAGG - Intronic
1029369917 7:100142728-100142750 CAAGAGAGATAGAGTGAACATGG + Intergenic
1030381063 7:108812581-108812603 GGAGAGACAGAGAGTGAAGAGGG - Intergenic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1032326556 7:130934595-130934617 CCAGAGAAACAGAACCAAGAGGG + Intergenic
1033073765 7:138229225-138229247 CAAGAGAAACAGAACTAATAAGG - Intergenic
1033890757 7:146010385-146010407 CAAGAGAGGCATAATGAAAATGG - Intergenic
1034052447 7:147997580-147997602 CAAGAGACGCACAGTGAAGCGGG + Intronic
1034112053 7:148546897-148546919 AAAGGGACACAGAAAGAAGGAGG - Intergenic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034876012 7:154725461-154725483 CAAGAGAAAGAGAGTGAAGGGGG + Intronic
1035183105 7:157105108-157105130 CAAAAGACAGAGTTTGAAGAAGG - Intergenic
1035217633 7:157380669-157380691 CAAGAGACAGAAGAGGAAGAAGG - Intronic
1035846248 8:2868028-2868050 GGAAAGACACAGAATGAAAAAGG - Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036979907 8:13459258-13459280 AAAAAGACACAGAATGAAAGAGG - Intronic
1037325970 8:17691082-17691104 CAAGAGACACTGGAGGAATATGG - Intronic
1037371301 8:18182107-18182129 GAAGAGATACACACTGAAGAAGG - Intronic
1038093294 8:24278755-24278777 CCAGAGAAACAGAATTAACAGGG + Intergenic
1038767752 8:30444701-30444723 CAAGAAAGACAGAACAAAGAAGG + Intronic
1038907542 8:31922936-31922958 CAAAACACACAGAATGAAAGTGG + Intronic
1038972153 8:32647832-32647854 CCAGAGCCCCAGACTGAAGATGG + Intronic
1040350444 8:46561504-46561526 CAAAAGACAGAGAGTGATGAAGG + Intergenic
1040547688 8:48412077-48412099 GAAAAGACAGAGAAAGAAGAGGG + Intergenic
1041965510 8:63670346-63670368 CATGAGACAGAGGCTGAAGAGGG - Intergenic
1042031489 8:64480685-64480707 TAAGAGACACAAAGTGAAAAAGG + Intergenic
1042206768 8:66337460-66337482 GAAGAGATACAGGAAGAAGATGG - Intergenic
1042374542 8:68034619-68034641 AAAGAGACACAGAAAGAAATTGG + Intronic
1042391262 8:68238325-68238347 TAAGAAACACAGAATCAAGCAGG + Intergenic
1042724197 8:71854686-71854708 CTAGAGAAACACAATGAATAAGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043910082 8:85854153-85854175 CCAGAGAGACAGAATCAATAAGG + Intergenic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1044026433 8:87178160-87178182 GAATAAACACAGAATGAAGATGG - Intronic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1044327044 8:90870062-90870084 GAAGAGAGAGAGAGTGAAGAGGG - Intronic
1044493791 8:92851817-92851839 CAAGAGACAGAGAGTGGAGTAGG + Intergenic
1044534008 8:93339062-93339084 GAAGAAACACAGGAAGAAGATGG - Intergenic
1045286418 8:100795738-100795760 GAAGAGGCAGAGAATGAACATGG - Intergenic
1045618624 8:103948671-103948693 CAATAGACACTGACTGAAAATGG + Intronic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046311529 8:112443220-112443242 CAGGAGACATACAATGAATAAGG + Intronic
1047403692 8:124567502-124567524 AAAGGGCCACAGTATGAAGAGGG - Intronic
1047439166 8:124861236-124861258 GAAGAGACACAGGCAGAAGATGG + Intergenic
1047628472 8:126680664-126680686 CTAAAGAAACAGAATGAAGTGGG - Intergenic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1048415566 8:134224374-134224396 CAAGAGATAAACTATGAAGATGG - Intergenic
1048611052 8:136023513-136023535 TAAGAGGCCCAGAATAAAGAAGG - Intergenic
1048790403 8:138098442-138098464 AATGAGGCACAGATTGAAGATGG - Intergenic
1048997965 8:139805795-139805817 GAAAATACACAGAACGAAGAAGG + Intronic
1049089338 8:140502609-140502631 CCAGAGAGACAGAATCAACAGGG + Intergenic
1049930169 9:448641-448663 GAAGAGACACAGGGAGAAGAGGG - Intronic
1050139221 9:2500095-2500117 GAAGAGACACAGGGAGAAGATGG + Intergenic
1050199434 9:3128020-3128042 CAAGAAACATTGAGTGAAGAGGG - Intergenic
1051158017 9:14172386-14172408 CAATAGACACAGAAAGTTGATGG + Intronic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052066214 9:24023783-24023805 AAAGCTACAAAGAATGAAGAAGG - Intergenic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1052916942 9:33930585-33930607 CAAGAGAAAAAGAATAAAAAGGG + Intronic
1053471656 9:38350743-38350765 CATGAGTCAAAGAATGCAGACGG - Intergenic
1053472567 9:38357440-38357462 CAAGAGAGACAGGAGGAAGCTGG + Intergenic
1054706313 9:68466030-68466052 CAAGAGACAAAGAATGGGGAAGG - Intronic
1054898289 9:70338717-70338739 CAATGGACTCAGAATGAAAAAGG - Intronic
1055403200 9:75946465-75946487 CAAGTGACACTGATTCAAGATGG - Intronic
1055892542 9:81138809-81138831 GAAGAGAGAAAGAAGGAAGAAGG + Intergenic
1057517022 9:95730225-95730247 CCAGACACACAGAATCAGGAAGG + Intergenic
1057850291 9:98561488-98561510 GAAGAGAAACAGAAAGAAGCAGG + Intronic
1057860138 9:98634480-98634502 ACAGAGACACAAAATGAAGAAGG + Intronic
1058479088 9:105372584-105372606 TAAGAAACACAGTATGAAGACGG - Intronic
1058717044 9:107731856-107731878 GATGAGACAGAGAACGAAGAAGG - Intergenic
1058878536 9:109266103-109266125 CAAGAGACACAGTATAAACATGG + Intronic
1059008968 9:110435666-110435688 TCAAAGACATAGAATGAAGAAGG - Intronic
1059287099 9:113183505-113183527 CCAGAGCCACAGAATGAATGAGG + Intronic
1059314926 9:113416084-113416106 CAAGACACACTGAAGGAAGAAGG - Intronic
1059512523 9:114862715-114862737 AAAGAGACAGAGAATGCAGGCGG - Intergenic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1059972837 9:119685179-119685201 GAAGAGACACAGGAAGAAGATGG - Intergenic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1061628945 9:131859415-131859437 AAAGAGCCAGAGAATGGAGAGGG - Intergenic
1062349062 9:136130275-136130297 CAAGAGAGGCAGGATGAATAAGG - Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186751997 X:12630970-12630992 TAAGAGCCATAAAATGAAGAAGG - Intronic
1186969105 X:14820540-14820562 TAGGAGACACAGAATAAAAATGG + Intergenic
1187843369 X:23511141-23511163 ACACAGACACAGAAGGAAGAAGG - Intergenic
1188483985 X:30662498-30662520 GAAGAGACACAGAAAACAGAAGG - Intronic
1189578194 X:42377657-42377679 CAAGGGAAGCAGAATGAAAAAGG - Intergenic
1189892794 X:45622972-45622994 CAAAAGAAAAAGAATGGAGAGGG + Intergenic
1190323017 X:49189292-49189314 CAAAAGACACAGAAAGGAGAGGG + Intronic
1192381214 X:70618543-70618565 AAAGAGACAGAGACTTAAGATGG + Intronic
1193517521 X:82487109-82487131 CATGAGACACAGCAAGAACAAGG - Intergenic
1193907516 X:87261178-87261200 CAAGAGACAGTGGATTAAGAGGG + Intergenic
1194044007 X:88979262-88979284 CCAGAGAAACAGAATAAATAGGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194907741 X:99598875-99598897 AAAAAGACTCAGAATTAAGAAGG - Intergenic
1195143438 X:101987531-101987553 GAAGAGACACAGAGAGAAGATGG + Intergenic
1195981502 X:110583009-110583031 CAAGAGACACAGCATTAATCAGG - Intergenic
1196223418 X:113138476-113138498 CAAGAGAGAGAGAAAGAAGGGGG + Intergenic
1197806129 X:130400275-130400297 GAACAGACACAGAATGAATGAGG + Intergenic
1198213652 X:134537362-134537384 CAAAAGCCACAGAATATAGATGG - Intergenic
1198317633 X:135485148-135485170 CAAGAGATAAAAAATGACGATGG - Intergenic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1198706080 X:139449679-139449701 TAAGTGATAAAGAATGAAGAGGG + Intergenic
1198824341 X:140683405-140683427 AAAGAGAGACAGTATAAAGAGGG - Intergenic
1199108017 X:143895117-143895139 GAAGAGACAGAGAATGAAAGGGG + Intergenic
1199754868 X:150854665-150854687 GAAGAGACACAGAGAGAAGATGG + Intronic
1200275156 X:154725067-154725089 GAAAAGACACAGAGAGAAGATGG + Intronic
1200305521 X:155022511-155022533 CAAAAGGCACAGAAAGAAGCAGG + Exonic
1201347593 Y:13001728-13001750 GAAGAGACAGAGAGTGAAGGGGG - Intergenic
1201678858 Y:16620007-16620029 TAAGACACACAGAGGGAAGATGG + Intergenic
1202037871 Y:20653418-20653440 TAAGAGACATAGAAAGAAGGGGG - Intergenic