ID: 1006159816

View in Genome Browser
Species Human (GRCh38)
Location 6:32034518-32034540
Sequence CTTCTCGGAGAACCTTAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006159816 Original CRISPR CTTCTCGGAGAACCTTAACC TGG (reversed) Exonic
900766268 1:4507910-4507932 CTCCTCGGAGCCCCTTAACATGG + Intergenic
905108223 1:35576653-35576675 TTCCTCTGAGCACCTTAACCCGG + Intronic
907688828 1:56642351-56642373 CTTCTTGGTGAACCCTACCCTGG - Intronic
909503652 1:76363017-76363039 CCTCATGGAGAACCTTTACCAGG - Intronic
914674114 1:149894911-149894933 CTTCTCTGTGAACCTTACCAGGG - Intronic
923785076 1:237058759-237058781 CATCTCTAAGCACCTTAACCAGG - Intronic
924422824 1:243925159-243925181 CTTCGCAGAGAACAATAACCTGG + Intergenic
1075018282 10:118927262-118927284 GGTCTGGGAGAAACTTAACCTGG + Intergenic
1075914450 10:126155453-126155475 CTCCCCGGAGAACCTAAACTGGG - Intronic
1081776853 11:45681585-45681607 CTTCTCACAGAACCTCAGCCAGG + Intergenic
1086798045 11:91133505-91133527 CTTCTGGGAAAACCCTATCCAGG + Intergenic
1090224470 11:125061899-125061921 CTTAAAGGAGTACCTTAACCTGG + Intergenic
1091267273 11:134281422-134281444 CTTCTCTGGGAACCTGGACCTGG + Exonic
1091275036 11:134344432-134344454 CTTCTCTGGGAACCTGGACCTGG + Exonic
1091994621 12:4983466-4983488 CTTCTCTGGGAACCTTTCCCTGG - Intergenic
1107703177 13:43070575-43070597 CTTCTTGGAGAAACCTTACCTGG - Intronic
1111427867 13:88112560-88112582 CTTCTCTGAGATCCTTTCCCTGG - Intergenic
1114140252 14:19901462-19901484 CTTCACAGGGAACCTTTACCGGG + Intergenic
1118736986 14:68708245-68708267 CCCCACGGAGAACCTTCACCAGG - Intronic
1120583240 14:86279931-86279953 CCTCATGGAGAACCTTTACCAGG + Intergenic
1121071835 14:91030375-91030397 CTTCTTGGGGAACATTAGCCTGG - Intronic
1124993164 15:34695887-34695909 CTTCTCTGAGAAACTCAAGCTGG - Intergenic
1127207041 15:56732409-56732431 CTCCACGCAGAAACTTAACCAGG - Intronic
1128674701 15:69600091-69600113 CTTCTGGGAGGACCAAAACCAGG + Intergenic
1134185493 16:12081828-12081850 CTACTCTGAGAACCTTAACTCGG - Intronic
1136009863 16:27356544-27356566 CTCCTTGGAGAGCCTTATCCTGG - Intronic
1142028230 16:87825653-87825675 CTTCCCGCAGGCCCTTAACCTGG + Intergenic
1149334081 17:55617632-55617654 CTTCTTGGACAAGCTTAAGCCGG + Intergenic
1149386321 17:56146424-56146446 CTTCATGGAGAACCTCCACCAGG - Intronic
1149460560 17:56826681-56826703 CTTCTCTGAGAACCTTGCCCTGG - Intronic
1149460635 17:56827497-56827519 CTTCTCTGAGAACCTTGCCCTGG - Intronic
1152151850 17:78606196-78606218 TTTCTAGGAGAACCGTGACCAGG - Intergenic
1163047041 19:14650823-14650845 CTTCTGGGTGAACCCAAACCGGG + Intronic
935324959 2:101927602-101927624 CCTCGTGGAGAACCTTTACCAGG + Intergenic
935738384 2:106125144-106125166 GTTCTGGAAGAACCTTAAGCAGG - Intronic
945924717 2:215791548-215791570 CTTCTCGGAGAACCTCTTGCTGG - Intergenic
946354480 2:219176538-219176560 CTTCTCGGAGAACTTCTCCCGGG - Intronic
1178167693 21:29999487-29999509 CTTGTAGGAGAACATTAAACTGG - Intergenic
1183695094 22:39417223-39417245 TTTCTGGAAGAACCTTAGCCTGG + Intronic
952070907 3:29634735-29634757 TTTCTGGGGGAACCATAACCAGG + Intronic
953344630 3:42165174-42165196 GTTCTCGGGGAACCTAAACCTGG - Intronic
954543148 3:51409441-51409463 CTTCTCTGGGAACCATCACCTGG - Intronic
959508197 3:107178042-107178064 CTTCATGGAGAACCTTTACTAGG - Intergenic
963362632 3:144295237-144295259 CTTCTCTGAGAACCTGTACAGGG + Intergenic
964448309 3:156784264-156784286 CCTCTTGGAGAACATTAAACAGG - Intergenic
965039124 3:163483455-163483477 CTTCTGGAAGAACCTCATCCAGG - Intergenic
972029254 4:34432103-34432125 CTTCTAGGAGAGCTTTACCCAGG - Intergenic
980448584 4:132943047-132943069 CCTCATGGAGAACCTTCACCAGG - Intergenic
983347823 4:166549039-166549061 CTTCTAGGAGCACCTTTCCCAGG + Intergenic
984845717 4:184106495-184106517 CTTCTTGAAGAACCTGAGCCAGG - Intronic
989807848 5:45633026-45633048 CTTGTAGGAGACTCTTAACCAGG - Intronic
990308969 5:54519404-54519426 CTTCTCGGTGGGCCTGAACCAGG + Exonic
998036657 5:138922872-138922894 CTTCTAGATGAACCTAAACCAGG - Intronic
999699621 5:154216683-154216705 CTTCTCAGAGAACATGAAACTGG + Intronic
1001525649 5:172426749-172426771 CTGCTGGGAGAACCTACACCAGG + Intronic
1002794016 6:456313-456335 CTTCACAGAGAACCTCTACCAGG - Intergenic
1006153508 6:32001781-32001803 CTTCTCGGAGAACCTTAACCTGG - Exonic
1006159816 6:32034518-32034540 CTTCTCGGAGAACCTTAACCTGG - Exonic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1016992014 6:149936841-149936863 CTTCTCGGAGGACCTGGACTAGG - Intergenic
1025271723 7:57527030-57527052 CTTCTAGGAGAGCGTTACCCAGG + Intergenic
1037415830 8:18649026-18649048 CCTCTTGGAGAACCTTTACTAGG + Intronic
1037746589 8:21650300-21650322 CTTCACAGAGAACCTCTACCAGG - Intergenic
1052017241 9:23483228-23483250 CTTCTCGGATCACCTCAACAGGG - Intergenic
1052689265 9:31795867-31795889 TTCCTGGGAGAACCATAACCTGG - Intergenic
1053666042 9:40318244-40318266 CCTCTTGGAGAACCTCTACCAGG - Intronic
1053915622 9:42943289-42943311 CCTCTTGGAGAACCTCTACCAGG - Intergenic
1054377197 9:64458272-64458294 CCTCTTGGAGAACCTCTACCAGG - Intergenic
1054518568 9:66058039-66058061 CCTCTTGGAGAACCTCTACCAGG + Intergenic
1060029681 9:120203492-120203514 CTTCTCTGGGAAGCTAAACCAGG - Intergenic
1060164594 9:121399802-121399824 CTTCTGGGATAACCATGACCTGG + Intergenic
1186586137 X:10875099-10875121 CTTCTGGGAGGACCAGAACCTGG - Intergenic
1189728138 X:43989586-43989608 TTTCTAGGAGAATCTTAGCCTGG + Intergenic
1189728459 X:43993338-43993360 TTTCTAGGAGAATCTTAGCCTGG - Intergenic
1195397228 X:104424780-104424802 CTTCTGGTAGAACAGTAACCTGG + Intergenic
1198941999 X:141966170-141966192 CTTCACGGAGAACCTCTACCAGG + Intergenic
1199384599 X:147208777-147208799 CTTCATGGAGAACCTTTACTAGG + Intergenic