ID: 1006160082

View in Genome Browser
Species Human (GRCh38)
Location 6:32035902-32035924
Sequence ACCTGAGGATTGCACAACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006160082_1006160086 4 Left 1006160082 6:32035902-32035924 CCGGAGTTGTGCAATCCTCAGGT No data
Right 1006160086 6:32035929-32035951 CAGTGTCTTCTTCCAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006160082 Original CRISPR ACCTGAGGATTGCACAACTC CGG (reversed) Intergenic
No off target data available for this crispr