ID: 1006161358

View in Genome Browser
Species Human (GRCh38)
Location 6:32042105-32042127
Sequence GCGCGTGGACCTGCGGGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006161358_1006161367 13 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161367 6:32042141-32042163 CTGCCTGTGTCAGGCTGTGCAGG 0: 2
1: 0
2: 6
3: 27
4: 362
1006161358_1006161372 29 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161372 6:32042157-32042179 GTGCAGGGCCTCATTGCCTGGGG 0: 2
1: 0
2: 0
3: 18
4: 201
1006161358_1006161373 30 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161373 6:32042158-32042180 TGCAGGGCCTCATTGCCTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 237
1006161358_1006161371 28 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161371 6:32042156-32042178 TGTGCAGGGCCTCATTGCCTGGG 0: 2
1: 0
2: 1
3: 15
4: 176
1006161358_1006161368 14 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161368 6:32042142-32042164 TGCCTGTGTCAGGCTGTGCAGGG 0: 2
1: 0
2: 3
3: 40
4: 357
1006161358_1006161370 27 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161370 6:32042155-32042177 CTGTGCAGGGCCTCATTGCCTGG 0: 2
1: 0
2: 3
3: 19
4: 239
1006161358_1006161365 4 Left 1006161358 6:32042105-32042127 CCCCAGCCCGCAGGTCCACGCGC 0: 2
1: 0
2: 1
3: 15
4: 133
Right 1006161365 6:32042132-32042154 AGTAGTCACCTGCCTGTGTCAGG 0: 2
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006161358 Original CRISPR GCGCGTGGACCTGCGGGCTG GGG (reversed) Exonic
900086426 1:900012-900034 GGGGGTGGTCCTGCTGGCTGAGG + Intergenic
900126042 1:1069362-1069384 GGGCGTGGCCCTGCGGGGCGTGG + Intergenic
903181794 1:21608584-21608606 GGGGGTGGACCTGGGGGGTGGGG - Intronic
904291535 1:29488980-29489002 GAGTGTGGTCCTGGGGGCTGGGG - Intergenic
904826381 1:33276272-33276294 GCGGGTGGACCAGCGGGCCTGGG + Intronic
905995874 1:42380528-42380550 GGACGTGGCGCTGCGGGCTGGGG - Intergenic
906206941 1:43991983-43992005 GAGCCTGGAGCTGCGGGCGGAGG + Exonic
906669633 1:47645149-47645171 GCCCGTGGCCCTGCGGGGTGGGG + Intergenic
914702794 1:150149881-150149903 GCGGATGGAGCTGCGGGGTGCGG + Intronic
914875590 1:151511193-151511215 TCACGTGGACCCACGGGCTGCGG - Intronic
919910875 1:202109987-202110009 GCCTGTGGCCTTGCGGGCTGAGG - Intergenic
920333503 1:205228651-205228673 GGGCGCGGACCTCCGGCCTGGGG + Exonic
920381318 1:205536164-205536186 GTGCGGGGTCTTGCGGGCTGTGG + Intergenic
922567409 1:226609995-226610017 GCACGAGGAGCTGCAGGCTGGGG + Intergenic
1067713853 10:48671908-48671930 GCTCGTGGACCTGCGAGCTTGGG - Intergenic
1069930527 10:71878584-71878606 GCCCGGGGACCTGGGGGGTGGGG + Intergenic
1072190873 10:93075198-93075220 GCGCCAAGATCTGCGGGCTGCGG + Exonic
1076306223 10:129467254-129467276 CCGCGAGGACCTGCGGGCGTCGG - Exonic
1076581365 10:131514066-131514088 GCACGGGGAGCTGCGGGGTGAGG - Intergenic
1076758688 10:132589265-132589287 GCACGTGGCCCTGCAGGGTGTGG - Intronic
1076875068 10:133211729-133211751 GGGCATGGACCGGCGGGCCGAGG + Exonic
1077298848 11:1838116-1838138 GGGCGGGGGCCTGGGGGCTGGGG + Intergenic
1077405121 11:2379271-2379293 GGGTGTGGACCTGGGGGCAGGGG + Intronic
1077405194 11:2379460-2379482 GGGTGTGGACCTGGGGGCAGGGG + Intronic
1078474669 11:11620714-11620736 GGTCCTGGACCCGCGGGCTGTGG + Intronic
1079076239 11:17386985-17387007 GCGCAGGGGCCCGCGGGCTGAGG + Exonic
1083267911 11:61555397-61555419 GCTCGGGGAGCTGTGGGCTGCGG + Intronic
1083317843 11:61827629-61827651 GCGGGTGGACCGGCGGGCTGCGG - Intronic
1083743639 11:64723521-64723543 GCGCGAAGACCTGCTGGCCGTGG - Intergenic
1084428612 11:69099292-69099314 ACGCGTGGAGATGCCGGCTGTGG + Intergenic
1092258012 12:6937492-6937514 GGGCGAGGGGCTGCGGGCTGGGG - Exonic
1095465569 12:42484356-42484378 GCGCGTGCACCTGCGGGAGGGGG - Intronic
1095957827 12:47816899-47816921 GAGCATGGACTCGCGGGCTGGGG - Intronic
1104448798 12:128853429-128853451 GCGCCGGAACCTGCGAGCTGGGG + Intronic
1104602641 12:130163464-130163486 GCGGGTGCTCCTGCGCGCTGTGG - Exonic
1105900124 13:24746220-24746242 ACGCGCGGAGCTGCGGGCCGGGG - Intergenic
1108446356 13:50512651-50512673 TCGGGGGGACCTGCAGGCTGGGG + Intronic
1110706122 13:78603088-78603110 GTGCGGGGAACTGCGGGCAGGGG - Intronic
1114669055 14:24399158-24399180 GCGCCTGGGGCTGGGGGCTGGGG + Intronic
1118220859 14:63853443-63853465 CCGGGCGGACCGGCGGGCTGGGG - Intronic
1119485065 14:74981605-74981627 GCACGTGGCCCTCCAGGCTGTGG + Intergenic
1119746514 14:77048530-77048552 GCACGTGGAACTGAGGGGTGTGG - Intergenic
1122153251 14:99735845-99735867 GCGGGTGGAGCAGCGTGCTGGGG - Intergenic
1122798600 14:104218585-104218607 CCGCGTTGTCCTGCTGGCTGGGG + Intergenic
1124109421 15:26772852-26772874 GCGGGTGGGCCGGCGGGCGGCGG - Intronic
1128160937 15:65422627-65422649 GCGCGGGGGTCTGCGAGCTGCGG - Intronic
1130102821 15:80906700-80906722 CGGCGTGGACATGCGGGCGGAGG + Exonic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1132547784 16:541165-541187 GGGCGTGGAGCTGCAGGCAGTGG + Intronic
1132585700 16:705099-705121 TCGCGTGGATGTGCGGCCTGAGG - Intronic
1132595419 16:746881-746903 GAGGGTGGCCCTGCGGGGTGGGG - Intronic
1132731965 16:1367097-1367119 GCGCCTGGACCTGGAGGCGGTGG - Intronic
1132843679 16:1990379-1990401 GCGCGCCCACCTGCGGGCGGAGG + Intronic
1134024289 16:10942378-10942400 GCGCGAGGACCTGCGGGGCGGGG - Exonic
1139283343 16:65788538-65788560 GCACATGGACCTGGGTGCTGAGG - Intergenic
1139433862 16:66925312-66925334 GCGCCGCGACCTGGGGGCTGGGG - Intronic
1141682772 16:85553973-85553995 CCGTGTGTACCTGCGGGCTCAGG + Intergenic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1144781918 17:17812723-17812745 GCGCGTGGGCATGCTGGCTGAGG - Exonic
1144940641 17:18937580-18937602 GCCCGTGGTCCTGGGGGTTGGGG + Intergenic
1147357549 17:39909690-39909712 TCGCCTTGACCTGCGGGGTGTGG + Intronic
1147612784 17:41811604-41811626 ACGAGTGGGCCTGCGAGCTGCGG - Exonic
1148863905 17:50618858-50618880 GCGAGTGGGGCTGGGGGCTGAGG - Exonic
1152357723 17:79814852-79814874 GCGCGGGCACCTGGGGGATGGGG + Intergenic
1152829197 17:82486691-82486713 GCGGGTGGAGCTGGGGCCTGAGG + Intronic
1152904247 17:82961637-82961659 GCGTGTGGGGCTGCGGGCAGGGG + Intronic
1154241352 18:12657259-12657281 GGGCCTGGGCCTGCGGGCCGCGG - Intronic
1158323146 18:56285322-56285344 GCCTCAGGACCTGCGGGCTGGGG - Intergenic
1160732377 19:647115-647137 GCGTGGGGACCTGCGGGCTCAGG - Intergenic
1160785320 19:897684-897706 GCTCCCGGACCTGCGGGCTTAGG - Intronic
1160863794 19:1248672-1248694 GGGGGGGGACCTGCGGGCCGAGG + Intronic
1160978603 19:1806322-1806344 GAGCGTGGACCCGCGGGGAGTGG - Intronic
1161610604 19:5240300-5240322 GCCCATGAACCTGCGGGCCGAGG - Exonic
1163366575 19:16878965-16878987 GCGGGTGGACGTGCTGGCCGAGG + Exonic
1166215369 19:41331201-41331223 GGGCCAGGACCTGCGGGCGGCGG + Exonic
926131244 2:10304185-10304207 GCGCGGGAGCCTGGGGGCTGGGG - Intronic
931867319 2:66426506-66426528 GCGCGAGGACCCGCGGACTGGGG - Intergenic
933791729 2:85888774-85888796 TCGCGGGGGCCCGCGGGCTGGGG - Intronic
934754630 2:96816580-96816602 GCGCTTGCGCCTGCGGGCCGAGG + Exonic
936141796 2:109947620-109947642 GCGGGTGGGCCTGCGGGCGGAGG - Intergenic
936178484 2:110245568-110245590 GCGGGTGGGCCTGCGGGCGGAGG - Intergenic
936202894 2:110423864-110423886 GCGGGTGGGCCTGCGGGCGGAGG + Exonic
942346126 2:175004927-175004949 GCGCCTGGACTCGCGGGCGGCGG - Exonic
946028804 2:216689287-216689309 GCGCATGGACCTGAAAGCTGGGG + Intronic
946419822 2:219558373-219558395 GCGCGTGGAGCTGCGCTGTGAGG - Exonic
946422004 2:219570578-219570600 GCGCGTGGCCGTGCGCGTTGCGG + Exonic
948348156 2:237316644-237316666 ACGCGGGAACCTGAGGGCTGTGG - Intergenic
948463411 2:238140970-238140992 GCGCGTGGAGCTGCGGGACGTGG + Exonic
1168800932 20:642733-642755 GCGCGTGGGCCGGCGGGGTGCGG + Intergenic
1169197531 20:3691591-3691613 ACGCGTGCACCTGCGGGCGGAGG + Exonic
1175108486 20:56630315-56630337 GCGCCCGGGCCTGCGGGCAGGGG - Intronic
1176045122 20:63088544-63088566 GCGGGAGCACCTGCAGGCTGGGG + Intergenic
1177834142 21:26170907-26170929 GCGCGTGCACCTGTGGGCGCGGG - Intronic
1178498879 21:33109772-33109794 GAGCGAGGACCTGCGGGCGCCGG - Intergenic
1178864985 21:36320023-36320045 GCGCGGGGCCCTGCGGGCCTAGG - Intergenic
1179953574 21:44725222-44725244 TCGCGGGGACCTGGGGCCTGGGG + Intergenic
1180074423 21:45455499-45455521 GCGGCTGGAGCTGCGGGCGGCGG - Exonic
1180156812 21:45982029-45982051 ACGCGTGGAACTGCAGACTGGGG + Intronic
1180189297 21:46154936-46154958 GAGCCTGGACCTCAGGGCTGTGG + Intronic
1180675084 22:17581241-17581263 GCGCGTGAGCCTGGGGGCTGGGG + Intronic
1180961673 22:19765201-19765223 CCGCTTAGACCTGCAGGCTGTGG + Intronic
1181463596 22:23099140-23099162 GCGGGTGGGCCGGGGGGCTGTGG - Intronic
1182577488 22:31282916-31282938 GCAGGTGGCCCTGTGGGCTGAGG - Exonic
1183441433 22:37825218-37825240 GCGCGTAGACGAGCGGGTTGAGG - Exonic
1185095000 22:48801345-48801367 GGGCGTGGAGTTGGGGGCTGTGG - Intronic
1185171872 22:49299062-49299084 GCGTGAGGAGCTGCGGGCGGTGG - Intergenic
1185268589 22:49918131-49918153 ACGCGTGGACATGCGCGGTGAGG + Intronic
1185296723 22:50058338-50058360 GCGCGGGGAGCTGCGGCGTGCGG + Intergenic
950046026 3:9949133-9949155 GCGGGTGGATCCGTGGGCTGGGG + Exonic
950508544 3:13411597-13411619 GCCTCTGGACCTGCAGGCTGTGG + Intronic
960441844 3:117698140-117698162 GGGCGTGGACCAGCGGTCAGAGG - Intergenic
961603275 3:128076558-128076580 GCTGGTGGACCTGGTGGCTGAGG + Intronic
968453720 4:686947-686969 GCTCGTGGTCCTGTGGGCTCTGG - Intronic
968640426 4:1711974-1711996 GCGCGGGGGACGGCGGGCTGCGG + Exonic
968956275 4:3721396-3721418 GGGCTGGGACCTGGGGGCTGGGG + Intergenic
985487048 5:157891-157913 GCGCATGGACCTGAAGGCCGGGG - Intronic
991351252 5:65722323-65722345 GCGCGTGGTCCTTCGGCGTGGGG - Exonic
992754239 5:79889207-79889229 GAGCCTGGACCTGCAGCCTGGGG + Intergenic
995462726 5:112419924-112419946 AGGCGGGGACCTGCGGGCGGAGG + Intergenic
997453882 5:134004141-134004163 GCGCGTGGGCCTGGGGACTCGGG + Intronic
999202331 5:149825170-149825192 GCGTGGGGGCCTGTGGGCTGGGG + Intronic
1001293504 5:170483113-170483135 GTGTGTGCACCTGCAGGCTGTGG + Intronic
1002888144 6:1313355-1313377 GCGCGGGGACCGGCGCGCGGTGG - Exonic
1006155047 6:32009370-32009392 GCGCGTGGACCTGCGGGCTGGGG - Intergenic
1006161358 6:32042105-32042127 GCGCGTGGACCTGCGGGCTGGGG - Exonic
1007111089 6:39313898-39313920 GCGCGGGGACCAGAGGGTTGGGG - Intronic
1018720094 6:166565720-166565742 GAGCCTGGACCTGGGGCCTGTGG + Intronic
1019738033 7:2660058-2660080 GCGGGTGGCCGTGCGGGATGGGG - Intronic
1020279437 7:6642903-6642925 GCTCCTGGCCCTGCAGGCTGGGG + Intronic
1022739694 7:33109333-33109355 GCGCGAGGACGTGGGGGCTGCGG - Exonic
1023902180 7:44490381-44490403 GCGGGCGGGCCTGCGGTCTGGGG - Intronic
1027424906 7:78052467-78052489 GCTCGTGGTTCTGCAGGCTGTGG - Intronic
1033237420 7:139649281-139649303 GCGCGTGTACCTGGGGGAAGGGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036664516 8:10730165-10730187 GCGCGCGGCCGAGCGGGCTGGGG - Intronic
1037902479 8:22695705-22695727 GCGCGTGCACCCGGAGGCTGCGG + Intergenic
1047262542 8:123275016-123275038 GCGGGTGGAGCTGCGGCCCGCGG - Intronic
1049724196 8:144137934-144137956 GCGGGCGGACCTGCAGGCGGCGG + Exonic
1053003195 9:34589242-34589264 GCGCGTGCAGCTGAGGGGTGGGG + Intronic
1053239921 9:36487362-36487384 GCCCGTGGCCCGGAGGGCTGAGG + Intronic
1056621842 9:88221277-88221299 GTGCGGGGAGCTGCGGGCGGGGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058486646 9:105448298-105448320 GCGCCTGGGCCCGTGGGCTGTGG + Intronic
1060528656 9:124334731-124334753 GCGAGTGGAAAAGCGGGCTGGGG + Intronic
1062554335 9:137107184-137107206 GCCCGTGCAGCTGCAGGCTGAGG + Intronic
1062556248 9:137114560-137114582 GTCCGGGGCCCTGCGGGCTGTGG + Exonic
1185778802 X:2828819-2828841 GCGCGCGGGCTTGCGGGCAGGGG + Exonic
1187563176 X:20421766-20421788 GCACGGGAACCTGGGGGCTGAGG + Intergenic
1191866359 X:65706883-65706905 GAGCATGGACCTCCGAGCTGAGG - Intronic
1200148953 X:153942142-153942164 GCCCCTGGACCTGCTGGCTTGGG + Intronic
1201291217 Y:12421686-12421708 GCGCGCGGGCTTGCGGGCAGGGG - Intergenic