ID: 1006161585

View in Genome Browser
Species Human (GRCh38)
Location 6:32042904-32042926
Sequence TCCCCTCCCTGGGTGATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 241}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006161585_1006161592 -8 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161592 6:32042919-32042941 GGAGGGGAGTTGGGTCAGTGGGG 0: 2
1: 0
2: 4
3: 42
4: 498
1006161585_1006161600 21 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161600 6:32042948-32042970 CACCTGGTTCTGTCCACCAGGGG 0: 2
1: 0
2: 0
3: 12
4: 193
1006161585_1006161602 26 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161602 6:32042953-32042975 GGTTCTGTCCACCAGGGGTGTGG 0: 2
1: 0
2: 0
3: 23
4: 167
1006161585_1006161594 -3 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161594 6:32042924-32042946 GGAGTTGGGTCAGTGGGGCCGGG 0: 2
1: 0
2: 6
3: 42
4: 372
1006161585_1006161593 -4 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161593 6:32042923-32042945 GGGAGTTGGGTCAGTGGGGCCGG 0: 2
1: 0
2: 5
3: 46
4: 514
1006161585_1006161599 20 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161599 6:32042947-32042969 GCACCTGGTTCTGTCCACCAGGG 0: 2
1: 0
2: 0
3: 21
4: 166
1006161585_1006161595 -2 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161595 6:32042925-32042947 GAGTTGGGTCAGTGGGGCCGGGG 0: 2
1: 0
2: 1
3: 17
4: 210
1006161585_1006161598 19 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161598 6:32042946-32042968 GGCACCTGGTTCTGTCCACCAGG 0: 2
1: 0
2: 1
3: 32
4: 210
1006161585_1006161591 -9 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161591 6:32042918-32042940 GGGAGGGGAGTTGGGTCAGTGGG 0: 2
1: 0
2: 4
3: 29
4: 439
1006161585_1006161596 5 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161596 6:32042932-32042954 GTCAGTGGGGCCGGGGCACCTGG 0: 2
1: 0
2: 2
3: 28
4: 280
1006161585_1006161590 -10 Left 1006161585 6:32042904-32042926 CCTGGAATCACCCAGGGAGGGGA 0: 2
1: 0
2: 0
3: 25
4: 241
Right 1006161590 6:32042917-32042939 AGGGAGGGGAGTTGGGTCAGTGG 0: 2
1: 0
2: 2
3: 80
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006161585 Original CRISPR TCCCCTCCCTGGGTGATTCC AGG (reversed) Intronic