ID: 1006163747

View in Genome Browser
Species Human (GRCh38)
Location 6:32052832-32052854
Sequence GCACAGTGAAGGAGTCGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 4, 2: 3, 3: 12, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006163738_1006163747 10 Left 1006163738 6:32052799-32052821 CCACCTGGGGCCGCCCGTCCCTG 0: 4
1: 4
2: 3
3: 20
4: 298
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163736_1006163747 22 Left 1006163736 6:32052787-32052809 CCCTGACACGCACCACCTGGGGC 0: 2
1: 1
2: 4
3: 8
4: 136
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163744_1006163747 -9 Left 1006163744 6:32052818-32052840 CCTGTCCTTGTACTGCACAGTGA 0: 1
1: 6
2: 0
3: 4
4: 109
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163734_1006163747 23 Left 1006163734 6:32052786-32052808 CCCCTGACACGCACCACCTGGGG 0: 2
1: 1
2: 2
3: 12
4: 159
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163743_1006163747 -8 Left 1006163743 6:32052817-32052839 CCCTGTCCTTGTACTGCACAGTG 0: 1
1: 6
2: 1
3: 12
4: 178
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163731_1006163747 28 Left 1006163731 6:32052781-32052803 CCTCGCCCCTGACACGCACCACC 0: 2
1: 1
2: 5
3: 29
4: 346
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163739_1006163747 7 Left 1006163739 6:32052802-32052824 CCTGGGGCCGCCCGTCCCTGTCC 0: 5
1: 3
2: 6
3: 28
4: 296
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163740_1006163747 0 Left 1006163740 6:32052809-32052831 CCGCCCGTCCCTGTCCTTGTACT 0: 5
1: 1
2: 0
3: 20
4: 195
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163742_1006163747 -4 Left 1006163742 6:32052813-32052835 CCGTCCCTGTCCTTGTACTGCAC 0: 7
1: 1
2: 4
3: 27
4: 308
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163741_1006163747 -3 Left 1006163741 6:32052812-32052834 CCCGTCCCTGTCCTTGTACTGCA 0: 6
1: 2
2: 5
3: 21
4: 248
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165
1006163737_1006163747 21 Left 1006163737 6:32052788-32052810 CCTGACACGCACCACCTGGGGCC 0: 1
1: 4
2: 2
3: 16
4: 154
Right 1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG 0: 1
1: 4
2: 3
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006163747 Original CRISPR GCACAGTGAAGGAGTCGAAG CGG Intronic
903749438 1:25611652-25611674 CCTCAGTGAAGGAGCTGAAGGGG + Intergenic
905270778 1:36786156-36786178 GCCCAGAGAAGGATTCGAGGAGG - Intergenic
905878216 1:41447088-41447110 GCCCAGAGAAGGAGTCAAGGAGG - Intergenic
906515944 1:46438844-46438866 GCTCACAGAAGGAGTGGAAGTGG + Intergenic
907904093 1:58768476-58768498 GCACAGTGAAGGAAAAGATGTGG + Intergenic
908298284 1:62735438-62735460 GCAAAGAGGAGGAGTCCAAGTGG - Intergenic
913124335 1:115771491-115771513 TCACAGTGAAGGACTGGAAATGG - Intergenic
916780584 1:168023692-168023714 GCACAGAGAAGGATTAGTAGAGG + Intronic
917245021 1:172991368-172991390 GCAAAGGGAAGAAGTAGAAGTGG + Intergenic
917282599 1:173393043-173393065 GAACACTGAAGGAATCGAGGTGG + Intergenic
917485155 1:175448827-175448849 GCACAGGGAGGGAGTGGATGTGG + Intronic
917967979 1:180190519-180190541 GCACAGTCAAGAAGTGGAAGAGG - Exonic
920871328 1:209797584-209797606 CCAGAGAGAAGGAGTCGAAGTGG - Intronic
921371923 1:214432819-214432841 GCACAATGAAGGATTCTGAGTGG + Intronic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
922110242 1:222548693-222548715 ACACAGTGAAGGAAAAGAAGGGG + Intergenic
923121818 1:230999090-230999112 GCACAGTGAAGGGAAGGAAGAGG - Intronic
1063885740 10:10576682-10576704 GCACCCTGAAGGAGGTGAAGGGG - Intergenic
1064617683 10:17179056-17179078 GCACAGTGAAGGAATCTACAAGG + Intronic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1071361443 10:84850289-84850311 GGAAAGGGAAGGAGTCAAAGTGG + Intergenic
1073253963 10:102139234-102139256 GCGCAGTGATGGAGAAGAAGAGG + Exonic
1073289498 10:102406335-102406357 GGACAGTGAGGGAGTCTCAGTGG + Intronic
1073570227 10:104575197-104575219 GCACAGTGAGGGAGGAGAGGGGG - Intergenic
1077203554 11:1327322-1327344 GCACAGTGAAAGAGGAGCAGAGG + Intergenic
1078795443 11:14587504-14587526 GAGCAGTGAAGAAGTCGAAAAGG - Intronic
1079004506 11:16782531-16782553 ACACAGTGGAGGAGACCAAGGGG - Intronic
1080017294 11:27520970-27520992 GCACAGAAAAGGGGTGGAAGTGG - Intergenic
1080527113 11:33133837-33133859 CCACATTGAAGGAGACTAAGAGG + Intronic
1080930214 11:36802239-36802261 GCACAGAGCAGCAGTGGAAGTGG + Intergenic
1082773116 11:57224124-57224146 GCATAGGGAATGAGTTGAAGGGG - Intergenic
1082806829 11:57457176-57457198 ACACAGTGAAGGTGACAAAGAGG + Intergenic
1084632744 11:70365267-70365289 GCACAGAGAAGGGGCCGAGGAGG - Intronic
1085833022 11:79922021-79922043 GGACAGTAAAGGAGCCAAAGCGG + Intergenic
1090932159 11:131307683-131307705 GCACAATGAAGGACCCCAAGTGG - Intergenic
1092515182 12:9203764-9203786 TCACAGTGAAGGAGACACAGTGG + Exonic
1093501212 12:19814665-19814687 GCACCGTGCATGAGCCGAAGCGG + Intergenic
1095630003 12:44365222-44365244 GCAAAGTGAAGGAATGGAAGTGG - Intronic
1095895133 12:47272495-47272517 TCAGAGTGAAGCAGTAGAAGTGG + Intergenic
1100188971 12:92170362-92170384 GCCAAGTGAAGCAGTGGAAGTGG + Intergenic
1100803580 12:98258291-98258313 GAACAGTGAAGGAATAGAAAAGG + Intergenic
1102731940 12:115119180-115119202 GCACAGTGAGGGAGTGGAAGGGG + Intergenic
1103056012 12:117821008-117821030 TCACAGAGAAGGAGTGGCAGAGG - Intronic
1103526080 12:121569427-121569449 GCAGAAAGAGGGAGTCGAAGTGG + Intronic
1103688850 12:122753783-122753805 CCACAATAAAGGACTCGAAGTGG - Exonic
1103708247 12:122891999-122892021 GCACAGTGAAGTAATTCAAGAGG + Intronic
1107853517 13:44592530-44592552 GAAGGGTGAAGGAGACGAAGAGG - Intergenic
1108774536 13:53749476-53749498 GTACAGAGTAGGAGTCGGAGGGG - Intergenic
1109210476 13:59529634-59529656 GCACAGTGAAGGATAAGGAGTGG - Intergenic
1112900018 13:104346329-104346351 GCACCGTGCATGAGCCGAAGCGG - Intergenic
1115348159 14:32365083-32365105 GAACAGTGAGGGAGTCCAGGTGG - Intronic
1119897257 14:78230725-78230747 GCACAGTGAACAAGGGGAAGAGG + Intergenic
1120028140 14:79609111-79609133 TCACAGTGAAGGAGACCTAGGGG - Intronic
1120154400 14:81076640-81076662 ACATGGTGAAGGAGTAGAAGTGG - Intronic
1121693570 14:95894818-95894840 GCACAGGGAAGGTGTAGATGCGG + Intergenic
1122598448 14:102909066-102909088 GCTCAGTGAGGGTGTGGAAGTGG + Exonic
1123108842 14:105855860-105855882 GGACAGAGAGGGAGCCGAAGGGG - Intergenic
1124013496 15:25858433-25858455 GCACGGAGAAGGAGTAGGAGAGG + Intronic
1124388712 15:29233032-29233054 GCACAGAGAAGGATTAGCAGAGG - Intronic
1126130384 15:45335305-45335327 GTACAGTGAAGGAGTTGAGTAGG + Intergenic
1126538508 15:49795559-49795581 GCAGAGTCACGGAGTGGAAGAGG + Intergenic
1128452332 15:67812832-67812854 GCACAATGAACGAGTCGATGGGG + Intergenic
1132379430 15:101356290-101356312 GCACAGTGTGGGTGTGGAAGAGG - Intronic
1135327579 16:21536811-21536833 GCAGAGCGGAGGGGTCGAAGGGG + Intergenic
1135905852 16:26511160-26511182 GCACAGTGCAGGGGACCAAGAGG + Intergenic
1136316755 16:29459055-29459077 GCAGAGTGAAGGGGCAGAAGTGG - Intergenic
1136337929 16:29622831-29622853 GCAGAGCGGAGGGGTCGAAGGGG + Intergenic
1136431330 16:30198397-30198419 GCAGAGTGAAGGGGCAGAAGTGG - Intronic
1138261139 16:55623537-55623559 GCACAGTGAAGGTGTGGAATGGG - Intergenic
1140187457 16:72787901-72787923 GAACAATGAAGGGGTCGTAGAGG + Exonic
1142040692 16:87891912-87891934 GCAGAGTGGAGGGGTCGAAGGGG + Exonic
1143165106 17:4893633-4893655 GCACAGGGAGGGAGGGGAAGTGG + Intronic
1144680148 17:17187753-17187775 GAACAGTGAAGAAGTAGAACTGG + Exonic
1146503417 17:33383877-33383899 GCACAGGGAGGGATTGGAAGGGG + Intronic
1147588891 17:41668520-41668542 GCACAGCGCAGCAGCCGAAGCGG + Intergenic
1150809683 17:68346791-68346813 GCAAAGTGAAGGAGCCCATGTGG + Intronic
1151121385 17:71796887-71796909 GGACAGGGAAGGAGGGGAAGAGG + Intergenic
1152113391 17:78369888-78369910 CCACAGTGAAGTAGAGGAAGAGG - Intergenic
1152315059 17:79575327-79575349 GCAGAGTGAGGGAGACAAAGGGG + Intergenic
1154271181 18:12921141-12921163 TCACTGTGAAGGAGGCTAAGTGG - Intronic
1155453369 18:25986149-25986171 GCATACTGAAGGACTTGAAGAGG - Intergenic
1157112546 18:44834562-44834584 GCACAGAGCAGGAGAAGAAGGGG + Intronic
1160044310 18:75372548-75372570 GCACAGCAAAGGAGATGAAGTGG - Intergenic
1162583852 19:11547048-11547070 GCCCAGTGAAGGTGGCGGAGCGG + Intronic
1164329934 19:24244508-24244530 GGACATTGAAGGAGTAAAAGAGG - Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167450665 19:49566741-49566763 GTCAAGTGAAGGAGTGGAAGTGG - Intronic
925854316 2:8115316-8115338 GCACAGGTAAGGATTGGAAGGGG + Intergenic
926146298 2:10398908-10398930 GGAGAATGAAGGAGTGGAAGTGG - Intronic
927076936 2:19588266-19588288 GCAAAGTGAAGGAGTAGAGAGGG + Intergenic
927339654 2:21967993-21968015 GCACACTGAAGGAGGAGAATAGG - Intergenic
927882720 2:26699964-26699986 TCACATGGAAGGAGTCGCAGAGG - Intronic
931390696 2:61841063-61841085 GTAAAATGAAGGAGTCAAAGTGG - Intronic
932835835 2:75036080-75036102 GCACAGTGAAGGTGTCCAACAGG + Intergenic
933068084 2:77823686-77823708 GAACAGTTTAGGAGTAGAAGTGG - Intergenic
933185684 2:79276858-79276880 CCACAGTGAAGAAGTAGAAATGG - Intronic
938303166 2:130230282-130230304 GCACAGGGAAGGAGTCCCTGCGG + Intergenic
940419606 2:153464275-153464297 GCACAGTGATGGGGTGGGAGAGG - Intergenic
940737492 2:157469972-157469994 GCACAGTGATGGAATCAGAGAGG - Intronic
945422448 2:209656085-209656107 GAACATTGAAGGAGTGGATGAGG - Intronic
946745106 2:222837654-222837676 GCACAGTGAGGGTGGAGAAGAGG - Intergenic
948705518 2:239789915-239789937 GGAAAGTGAAGGAGTGGAACAGG + Intronic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1170581565 20:17703335-17703357 GCACAGAGATGGAGTGGGAGAGG - Intronic
1170675912 20:18480879-18480901 TCACAGTGAAGAAATCAAAGTGG + Intronic
1172351516 20:34246440-34246462 CCACAATAAAGGACTCGAAGTGG + Intronic
1173066894 20:39721752-39721774 GTACAGTGAAGTAATAGAAGAGG + Intergenic
1174483990 20:50850053-50850075 CCACAGTGGAGGGGACGAAGAGG - Intronic
1176991389 21:15501256-15501278 GAACAGTGAAGAAATTGAAGAGG + Intergenic
1177026900 21:15931916-15931938 CCACAGGGCAGGAGTGGAAGTGG + Intergenic
1179488685 21:41726947-41726969 ACAAAGTGCAGGAGTAGAAGAGG + Intergenic
1181689683 22:24551719-24551741 GCACTGTGAAGGAAACGAATAGG - Intronic
1181876322 22:25943542-25943564 GCACAGAGAAGGAGAGGAGGAGG - Intronic
1182388780 22:29971915-29971937 GCACAGAGAAGGAATTGAAAAGG + Intronic
1183324251 22:37182961-37182983 ACACAGTGCAGGAGCAGAAGAGG + Intronic
1183361694 22:37386312-37386334 GCAGAGTGAGGGAGTCCATGGGG - Intronic
1184510523 22:44930640-44930662 GGACAGTGAAGGAGGAGAGGAGG + Intronic
949478418 3:4470731-4470753 TCACAGTGAAGGAGGTGCAGGGG - Intergenic
949796885 3:7861037-7861059 TCACAGTGAAGGAGCAGCAGGGG + Intergenic
953128166 3:40111608-40111630 GGACAGTGCAGGAGTCCCAGGGG + Intronic
955037272 3:55281293-55281315 GCAGAATGAAGGAATAGAAGGGG + Intergenic
959494242 3:107030733-107030755 GCACAGTGGTGCAGTTGAAGAGG + Intergenic
961517380 3:127446365-127446387 CCAGAGTGAAGGAGCAGAAGTGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965078921 3:164012869-164012891 GTACAGTGTAGGAGTGGAGGTGG - Intergenic
965196955 3:165611705-165611727 GCACAATGTAGGATTAGAAGAGG + Intergenic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
970509924 4:16771746-16771768 GCACAGAGAAGGGGTGGCAGTGG - Intronic
975230471 4:71926811-71926833 GCACAGTGAAGGAGGGGTATGGG - Intergenic
976773342 4:88679263-88679285 GCTCTGTGAGGGAGTGGAAGTGG - Intronic
981259752 4:142705654-142705676 GCACCGTGAATGAGTGGCAGAGG - Intronic
985333236 4:188864315-188864337 GCACAGGGAAGAAGACGATGGGG - Intergenic
985333257 4:188864397-188864419 GCACAGGGAAGGAGAAGATGGGG - Intergenic
985333279 4:188864479-188864501 GCACAGGGAAGGAGAAGATGGGG - Intergenic
985824792 5:2184154-2184176 GGACAGTGAAGGGGAGGAAGCGG - Intergenic
989366154 5:40658275-40658297 GCCCTGTGGAGGAGTCCAAGTGG + Intergenic
991187639 5:63828895-63828917 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
994309129 5:98246113-98246135 GAAGTGTGAAGGAGTAGAAGTGG - Intergenic
996002667 5:118383125-118383147 GCACCGTGCACGAGCCGAAGTGG + Intergenic
1001125689 5:169017330-169017352 GCATTGGGAAGGAGTCGAAGGGG - Intronic
1002613914 5:180438584-180438606 GGACAGTGAAAAAGTCAAAGGGG - Intergenic
1006163106 6:32049432-32049454 GCACGGTGAAGGAGTCGAAGCGG + Intronic
1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG + Intronic
1006164362 6:32056013-32056035 GCACGGTGAAGGAGTCGAAGTGG + Intronic
1006164866 6:32058220-32058242 GCACGGTGAAGGAGTCAAAGCGG + Intronic
1006165359 6:32061559-32061581 GCACGGTGAAGGAGTCGAAGCGG + Intronic
1006166317 6:32067823-32067845 GCACGGTGAAGGAGTCGAAGCGG + Intronic
1006168825 6:32081530-32081552 GGACCATGAATGAGTCGAAGGGG + Intronic
1007065555 6:38987307-38987329 GTACAGGGAAGAAGTAGAAGAGG - Intronic
1010378904 6:75205130-75205152 GCACCGGGAGGGAGTCGGAGAGG + Intronic
1013436534 6:110115561-110115583 TCACACTGAAGGTGTCAAAGTGG + Intronic
1018431361 6:163725375-163725397 CCACAGTGGAGGAGACGCAGTGG - Intergenic
1019183015 6:170204093-170204115 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
1019376146 7:693318-693340 GCACGGTGAATGTGTCGACGTGG - Intronic
1019894422 7:3972621-3972643 GCACAGTGCATGAGTCGAATGGG + Intronic
1021592622 7:22280329-22280351 GCACAGTGAAGCAGAGGAGGAGG + Intronic
1022500215 7:30878056-30878078 GGACATAGAAGGAGTCCAAGGGG + Intronic
1022780190 7:33574014-33574036 GCACAATGGAGAAGTTGAAGTGG - Intronic
1027015874 7:74779366-74779388 GCACCTTGAAGAAGTCGAGGAGG - Exonic
1027072155 7:75166571-75166593 GCACCTTGAAGAAGTCGAGGAGG + Intergenic
1027219536 7:76205056-76205078 GCTCAGTGAAGGAGTTGCGGAGG - Intronic
1029550571 7:101235158-101235180 GGACAGTGAAGGACTTGGAGTGG - Intronic
1030065590 7:105656432-105656454 GGACAGTGAACCAGTGGAAGGGG + Intronic
1030724972 7:112916610-112916632 GCACCGTGTGGGAGCCGAAGTGG + Intronic
1031146615 7:118003914-118003936 GCACAGTGGAGGAAGCAAAGAGG - Intergenic
1033038497 7:137896791-137896813 GTACAGGGAAGGAGGCCAAGGGG + Intronic
1034029132 7:147740836-147740858 GGACAGGGAAGGAGTCGAAGGGG + Intronic
1037015560 8:13901985-13902007 TGACAGTGAAGCACTCGAAGGGG - Intergenic
1041897882 8:62947248-62947270 CCTCAGTGAAGGAGGGGAAGGGG - Intronic
1042128276 8:65560535-65560557 GCACCGTGGAGGAATCGAAGAGG + Intergenic
1048962267 8:139590416-139590438 ACACAGTGAAGGTGACAAAGAGG - Intergenic
1049033971 8:140060470-140060492 GCAGAGTGCAGGAGGCCAAGGGG - Intronic
1055030127 9:71765827-71765849 GTAAAGAGAAGGAGTTGAAGTGG - Intronic
1055766251 9:79666867-79666889 GGACAGTGAAAGAGTCCAAATGG + Intronic
1055828523 9:80355139-80355161 GCACATTCAAGGAGGAGAAGGGG - Intergenic
1056622795 9:88228354-88228376 GCACAGCGAAGGAGTCAGATGGG - Intergenic
1057826877 9:98378312-98378334 GCAGAGTGAAGAGGCCGAAGGGG + Intronic
1186200786 X:7153284-7153306 AGAGAGGGAAGGAGTCGAAGAGG - Intergenic
1188624930 X:32272229-32272251 GAACAGAGAAGGATTCCAAGAGG + Intronic
1190545181 X:51518170-51518192 GCACTGTGAGCGAGCCGAAGAGG - Intergenic
1192815915 X:74591975-74591997 GCAGAGTCACGGAGTGGAAGAGG - Exonic
1196025934 X:111041454-111041476 GCACAGTGAAGGAGTGTTTGGGG - Intronic
1196626614 X:117884456-117884478 GCACAGTGGAGGAGCTGACGGGG + Intergenic
1197125611 X:122942436-122942458 GAACAGAAAAGGAGTCGCAGTGG - Intergenic
1199783930 X:151087238-151087260 ACCCAGTGATGGAGTCAAAGAGG - Intergenic