ID: 1006166857

View in Genome Browser
Species Human (GRCh38)
Location 6:32070359-32070381
Sequence CACCCACAGCTCCCCAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 16, 3: 48, 4: 728}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006166845_1006166857 26 Left 1006166845 6:32070310-32070332 CCTCAGGAACCGTCCAGGAGAGG 0: 1
1: 0
2: 6
3: 16
4: 179
Right 1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG 0: 1
1: 0
2: 16
3: 48
4: 728
1006166844_1006166857 27 Left 1006166844 6:32070309-32070331 CCCTCAGGAACCGTCCAGGAGAG 0: 1
1: 0
2: 5
3: 14
4: 117
Right 1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG 0: 1
1: 0
2: 16
3: 48
4: 728
1006166848_1006166857 13 Left 1006166848 6:32070323-32070345 CCAGGAGAGGCGCAGTGAGTCTG 0: 1
1: 0
2: 2
3: 22
4: 194
Right 1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG 0: 1
1: 0
2: 16
3: 48
4: 728
1006166847_1006166857 17 Left 1006166847 6:32070319-32070341 CCGTCCAGGAGAGGCGCAGTGAG 0: 1
1: 0
2: 2
3: 16
4: 184
Right 1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG 0: 1
1: 0
2: 16
3: 48
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006166857 Original CRISPR CACCCACAGCTCCCCAAGGC GGG Intronic
900612232 1:3549038-3549060 CGCCCGCAGGTACCCAAGGCGGG - Intronic
900675973 1:3886467-3886489 CACACACAGCTCAACAAGCCTGG - Intergenic
900708070 1:4093132-4093154 CAGCCACAGTTCCACATGGCTGG + Intergenic
900895242 1:5478746-5478768 CTCTGACAGCTCCCCACGGCTGG + Intergenic
901227570 1:7622986-7623008 CTCCCAGAGCTCCCCACAGCTGG + Intronic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG + Intronic
902625057 1:17671632-17671654 CCACCACAGCCCCTCAAGGCAGG - Intronic
903307632 1:22424401-22424423 CACTCACAGTTCCACATGGCTGG + Intergenic
904951015 1:34238829-34238851 CACTCACAGTTCCACATGGCTGG - Intergenic
905211368 1:36376559-36376581 CACACACATGCCCCCAAGGCAGG + Intronic
905749526 1:40450193-40450215 CTCGCCCAGCTCCCCAAGCCCGG - Intronic
906107523 1:43303867-43303889 CTCCCTGAGCTCCCCCAGGCTGG + Intronic
906314224 1:44775919-44775941 CACGCTCAGCTCTCCAAGGTTGG - Intronic
907284281 1:53370245-53370267 CTGCCACAGCCCCCCAAGTCAGG - Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908085851 1:60633105-60633127 GACTCACAGTTCCACAAGGCTGG + Intergenic
908272914 1:62437517-62437539 CACACACGGCTCCCCCTGGCAGG - Intronic
908373002 1:63502452-63502474 CACTTACAGTTCCACAAGGCTGG + Intronic
908435239 1:64099182-64099204 CACAAACAACTCCCCGAGGCAGG + Intronic
908712034 1:67026782-67026804 GACTCACAGCTCCGCATGGCTGG + Intronic
908901723 1:68963724-68963746 GACTCACAGTTCCACAAGGCTGG - Intergenic
909273513 1:73654793-73654815 GACCCACAGCTCCTCATGGCTGG - Intergenic
909542823 1:76809565-76809587 GACTCACAGCTCCACATGGCTGG - Intergenic
909567990 1:77077214-77077236 GACTCACAGCTCCACATGGCTGG + Intergenic
909741710 1:79037368-79037390 TTCCCACAGCTCCACTAGGCAGG - Intergenic
910115482 1:83727158-83727180 CTGCCTCAGCTTCCCAAGGCCGG + Intergenic
910293743 1:85623783-85623805 CACCCACAGCCTCCTAAGGTAGG - Intergenic
910417282 1:87014227-87014249 GACCCACAGTTCCACATGGCTGG + Intronic
910499819 1:87877356-87877378 CACAAACAGCTCTGCAAGGCAGG + Intergenic
910540841 1:88355225-88355247 CAGCCCCACCTTCCCAAGGCAGG + Intergenic
910792878 1:91069368-91069390 GACTCACAGTTCCACAAGGCTGG + Intergenic
911286237 1:95997112-95997134 GACTCACAGTTCCCCATGGCTGG + Intergenic
911812048 1:102295485-102295507 CATCCACAGATCTCTAAGGCAGG - Intergenic
911829722 1:102535699-102535721 GACCCACAGTTCCACATGGCTGG + Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
915058283 1:153157819-153157841 GACTCACAGTTCCCCATGGCTGG + Intergenic
915166262 1:153949309-153949331 CCCATACAGCTCCCCAAGTCTGG - Exonic
915588270 1:156856797-156856819 CACACCCAGGTCCCCAAGGAAGG - Intronic
915989391 1:160498404-160498426 GACTCACAGTTCCCCATGGCTGG + Intronic
916159108 1:161890868-161890890 CAAGCACAGCTGGCCAAGGCGGG + Intronic
916993103 1:170266170-170266192 GACCCACAGTTCCACAGGGCTGG + Intergenic
917433915 1:174999939-174999961 CACGCACAGCCCGCCAAGCCTGG - Exonic
918844219 1:189587611-189587633 GACTCACAGTTCCCCATGGCTGG - Intergenic
919396347 1:197053537-197053559 CACTCACAGTTCCACATGGCTGG - Intronic
919939497 1:202276506-202276528 CACTCACAGCACCACAAGGCTGG - Exonic
920030262 1:203033411-203033433 CTCCCAAAGCGCCTCAAGGCTGG - Intronic
920200694 1:204258040-204258062 CTCAAACAACTCCCCAAGGCTGG + Intronic
920324761 1:205154512-205154534 GACTCACAGTTCCGCAAGGCTGG - Intronic
920563035 1:206952655-206952677 CACTCCCCGCTCCCCACGGCAGG - Intergenic
921211189 1:212900092-212900114 CACCCCCATCTCCCTGAGGCTGG + Intergenic
921676709 1:217984191-217984213 GACCCACAGTTCCACATGGCTGG + Intergenic
922355895 1:224774642-224774664 CACCCACAGTTCCCCAGAGGAGG - Intergenic
922780369 1:228247696-228247718 GACTCACAGTTCCCCATGGCTGG + Intronic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923261957 1:232276142-232276164 CTCTCCCACCTCCCCAAGGCAGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923409997 1:233698686-233698708 GACTCACAGCTCTGCAAGGCTGG + Intergenic
923556965 1:235008806-235008828 GACTCACAGTTCCACAAGGCTGG + Intergenic
924550098 1:245067889-245067911 CTCCCCCATCTCCCAAAGGCAGG - Intronic
924570686 1:245235011-245235033 CACTCTCAGCTCCACCAGGCAGG - Intronic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1063154048 10:3362025-3362047 CACTCACAGTTCCACATGGCCGG - Intergenic
1063425477 10:5947012-5947034 AAACAAGAGCTCCCCAAGGCTGG - Intronic
1063769527 10:9182214-9182236 GACCCACAGATCCCCATGGCTGG + Intergenic
1064496415 10:15915170-15915192 GACCCACAGTTCCACATGGCTGG - Intergenic
1065326873 10:24557137-24557159 CACACAGAGGACCCCAAGGCAGG + Intergenic
1065455771 10:25905131-25905153 GACTCACAGTTCCCCATGGCTGG - Intergenic
1065471449 10:26086129-26086151 GACTCACAGCTCCACATGGCTGG + Intronic
1065654526 10:27934175-27934197 CACTCACAGTTCCACATGGCTGG - Intronic
1065749642 10:28874088-28874110 GACTCACAGCTCCACATGGCTGG + Intronic
1066052073 10:31645088-31645110 CACCCCCTGCCCGCCAAGGCTGG - Intergenic
1066267140 10:33787497-33787519 CACCCACCTCTTCCCAAGGCAGG - Intergenic
1066488750 10:35873800-35873822 GACTCACAGCTCCACATGGCTGG - Intergenic
1066756070 10:38714292-38714314 GACTCACAGCTCCACATGGCTGG + Intergenic
1067831585 10:49613982-49614004 CAGCAGCAGCACCCCAAGGCTGG + Intronic
1068912176 10:62389984-62390006 CAGCCACAGCTAGTCAAGGCTGG - Intronic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069890070 10:71647023-71647045 CACCCCCAGCTGCCCATGGCTGG + Intronic
1070090587 10:73281433-73281455 AACTCACAGGTCTCCAAGGCAGG - Intronic
1071932979 10:90495180-90495202 CACCTACATCTCTCCAAGACTGG + Intergenic
1071965869 10:90851957-90851979 GACTCACAGTTCCACAAGGCTGG - Intronic
1072015523 10:91342661-91342683 CACTCACAGTTCCACATGGCTGG + Intergenic
1074491382 10:113942321-113942343 GACTCACAGCTCCACATGGCTGG - Intergenic
1075278996 10:121122649-121122671 CACCCACAGCCCCTGAAGGTTGG - Intergenic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075515925 10:123108113-123108135 GACTCACAGTTCCCCATGGCTGG - Intergenic
1076003079 10:126927849-126927871 CAGCCACAGCAACCCAAGGGTGG - Intronic
1076207416 10:128614219-128614241 CAGGCCCAGCTCTCCAAGGCTGG - Intergenic
1076251511 10:128987563-128987585 AACCCAAAGATCCCCATGGCTGG - Intergenic
1076271409 10:129155435-129155457 CACCCCCATCTACTCAAGGCAGG + Intergenic
1076281789 10:129252600-129252622 GACTCACAGCTCCACATGGCTGG + Intergenic
1076640840 10:131916203-131916225 CACACACAGCACCCAGAGGCGGG + Intronic
1077020474 11:415057-415079 CACCCACCCCTTCCCTAGGCGGG + Intronic
1077332748 11:1990554-1990576 GACACATAGCTCCCCCAGGCAGG + Intergenic
1077638548 11:3860550-3860572 CTCCCCCAGCTCTCCCAGGCAGG - Intronic
1078301579 11:10136018-10136040 GACTCACAGCTCCACATGGCTGG + Intronic
1078364000 11:10691938-10691960 CTCCCACAGCTCTACAAAGCAGG - Intronic
1078621081 11:12908474-12908496 CACTCAAAGGTCCCCAAGACAGG - Intronic
1078729928 11:13964533-13964555 CACCCGGAGCTACCCAAAGCCGG + Intronic
1079004757 11:16783747-16783769 CGCCTGCAGCTCCTCAAGGCTGG + Intronic
1079988896 11:27226582-27226604 CACTCACAGTTCCTCATGGCTGG + Intergenic
1080030735 11:27658145-27658167 CACGCTCAGCTCCCCTCGGCGGG + Exonic
1080285082 11:30601452-30601474 GACTCACAGTTCCACAAGGCTGG - Intergenic
1080401190 11:31937537-31937559 GACCCACAGCTCCACATAGCAGG + Intronic
1080425218 11:32148595-32148617 CACTCACAGTTCCACAAGGCTGG + Intergenic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1080740097 11:35055839-35055861 GACTCACAGCTCCGCAGGGCTGG - Intergenic
1082982122 11:59133275-59133297 CACTCACAGTTCCACATGGCTGG + Intergenic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083698058 11:64455823-64455845 CTCCCAAAGGTCCCCAAGGCAGG + Intergenic
1084218755 11:67665387-67665409 CCCCCAGAGCTCCCCAAACCTGG - Exonic
1084269559 11:68021747-68021769 CCCCCAGAGCTCCCCAAACCTGG + Exonic
1084453860 11:69256193-69256215 GACTCACAGTTCCCCATGGCTGG + Intergenic
1084591652 11:70094020-70094042 CACCCACCACTCCACAAGGAAGG - Intronic
1085187991 11:74592592-74592614 CAGCCACAGCTCCCGCCGGCGGG - Exonic
1085986167 11:81791435-81791457 CACTCACAGCTCCACATTGCTGG + Intergenic
1086243252 11:84720998-84721020 CACCAAGAGCGCCCAAAGGCAGG - Intronic
1086609619 11:88739771-88739793 GACCCACAGTTCCACATGGCTGG - Intronic
1087511448 11:99101026-99101048 GACTCACAGCTCCACATGGCTGG + Intronic
1087623730 11:100571687-100571709 CACCCACCGCTCCTCAAGAATGG + Intergenic
1087838447 11:102897915-102897937 GACCCACAGTTCCACATGGCTGG - Intergenic
1088482889 11:110312292-110312314 GACTCACAGCTCCGCATGGCTGG + Intergenic
1088742066 11:112775298-112775320 GACTCACAGCTCCACATGGCTGG - Intergenic
1090091323 11:123701042-123701064 CAGCCACAGCCTCACAAGGCCGG - Intergenic
1090113085 11:123937626-123937648 GACTCACAGTTCCACAAGGCTGG + Intergenic
1090521860 11:127488507-127488529 GACCCACAGTTCCACATGGCTGG + Intergenic
1090623008 11:128578191-128578213 CACCCAAAGCTTGCCAGGGCAGG + Intronic
1091165175 11:133469023-133469045 CAACCCCAGCTCCTCAGGGCAGG - Intronic
1202815731 11_KI270721v1_random:45730-45752 GACACATAGCTCCCCCAGGCAGG + Intergenic
1091656032 12:2347656-2347678 CTCCCACAAATCCCAAAGGCAGG - Intronic
1091793453 12:3284348-3284370 AACCCACAGCTGAGCAAGGCTGG - Exonic
1091991622 12:4960449-4960471 GGCCCACTGCTGCCCAAGGCAGG + Intergenic
1093447534 12:19277461-19277483 CACCAACAGCTTCTGAAGGCTGG + Intronic
1094044541 12:26153004-26153026 CCCCCACAGCATTCCAAGGCTGG + Intronic
1094308386 12:29048794-29048816 GACTCACAGTTCCACAAGGCTGG + Intergenic
1094682638 12:32679565-32679587 CTCCCACAGGCCCCAAAGGCTGG - Intronic
1094704244 12:32899011-32899033 GACTCACAGTTCCTCAAGGCTGG + Intergenic
1094736596 12:33241529-33241551 GACTCACAGTTCCACAAGGCTGG - Intergenic
1094738466 12:33261048-33261070 GACTCACAGTTCCACAAGGCTGG - Intergenic
1095527203 12:43141160-43141182 GACTCACAGCTCCACATGGCTGG - Intergenic
1095839195 12:46673358-46673380 GACTCACAGCTCCACATGGCTGG - Intergenic
1097277534 12:57823608-57823630 GGCCCGCAGCTGCCCAAGGCTGG + Exonic
1098140203 12:67443212-67443234 GACCCACAGTTCCACATGGCTGG - Intergenic
1099564312 12:84221742-84221764 GACTCACAGTTCCCCATGGCTGG - Intergenic
1100201854 12:92306995-92307017 AACCCACAGTTCCACATGGCTGG - Intergenic
1100565431 12:95790293-95790315 CGCGCGCAGCTCCCCATGGCCGG + Exonic
1101382200 12:104223816-104223838 CAGCCACTGGTCCCCAAAGCTGG - Intronic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1102553944 12:113713565-113713587 GACCCACAGTTCCACATGGCTGG + Intergenic
1103263657 12:119610723-119610745 GACTCACAGCTCCACATGGCTGG - Intronic
1103269131 12:119657609-119657631 GACTCACAGTTCCCCATGGCTGG + Intergenic
1103874423 12:124116208-124116230 CACCCCCAAGACCCCAAGGCTGG - Intronic
1104304822 12:127600144-127600166 GACTCACAGTTCCCCATGGCTGG - Intergenic
1104539159 12:129646170-129646192 AAGCCAAAGTTCCCCAAGGCTGG - Intronic
1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG + Intergenic
1104599487 12:130142824-130142846 CACCCTCAGCTACCCTGGGCCGG + Intergenic
1104599967 12:130146130-130146152 CACCCCAACCTCCCAAAGGCTGG - Intergenic
1104656052 12:130574800-130574822 CACCCACTGCTTGCCAAGCCTGG + Intronic
1104736046 12:131136565-131136587 GACCCACAGGCCCCCAAGGAAGG + Intronic
1105685771 13:22780067-22780089 CACTCACAGTTCACCATGGCTGG - Intergenic
1105858463 13:24390726-24390748 AACCCAGAGCATCCCAAGGCAGG - Intergenic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1106633673 13:31504493-31504515 GACTCACAGCTCCGCATGGCTGG - Intergenic
1106960097 13:34988420-34988442 CCACCACAGCTCAGCAAGGCCGG - Intronic
1107310261 13:39069812-39069834 GACTCACAGTTCCACAAGGCTGG - Intergenic
1108971633 13:56382784-56382806 CACTCACAGTTCCACATGGCTGG + Intergenic
1109859717 13:68180622-68180644 AACCCACAGCTCCACATGGTTGG - Intergenic
1110124999 13:71931678-71931700 GACTCACAGTTCCCCAGGGCTGG - Intergenic
1110832947 13:80052926-80052948 GACCCACAGTTCCACATGGCTGG + Intergenic
1111163034 13:84420476-84420498 CACTCACAGTTCCACATGGCTGG - Intergenic
1111411248 13:87880145-87880167 GACCCACAGTTCCACATGGCTGG + Intergenic
1111485786 13:88896491-88896513 GAACCACAGAGCCCCAAGGCTGG - Intergenic
1111909395 13:94293487-94293509 GACTCACAGTTCCCCATGGCTGG - Intronic
1112312889 13:98335283-98335305 GACCCACAGGTCCACATGGCTGG + Intronic
1112797577 13:103072892-103072914 GACTCACAGCTCCACATGGCTGG + Intergenic
1113087286 13:106581487-106581509 CACCCTGAGCTCACAAAGGCTGG - Intergenic
1113176787 13:107573878-107573900 GACTCACAGCTCCACATGGCTGG - Intronic
1113235726 13:108270476-108270498 CACCTCCAGCTCCCCCAGACTGG - Intronic
1113239005 13:108315498-108315520 CACTCACAGTTCCGCATGGCTGG - Intergenic
1113285100 13:108837298-108837320 CACTCACAGTTCCACATGGCTGG - Intronic
1114417354 14:22553708-22553730 CCCCCAGAGCTCCCCAAAGGTGG - Intergenic
1114548023 14:23516532-23516554 CACCCACAGATTCTGAAGGCTGG + Intergenic
1115669388 14:35592020-35592042 GACTCACAGTTCCACAAGGCTGG - Intronic
1116098058 14:40397065-40397087 GACTCACAGTTCCCCATGGCTGG - Intergenic
1116262492 14:42648597-42648619 CACTCACAGTTCCACATGGCTGG - Intergenic
1116375235 14:44190841-44190863 GACTCACAGTTCCACAAGGCTGG - Intergenic
1116414610 14:44665532-44665554 GACTCACAGCTCCGCGAGGCTGG + Intergenic
1116428192 14:44815916-44815938 GACCCACAGCTCTGCATGGCTGG + Intergenic
1117338864 14:54777206-54777228 CACCCCCACTGCCCCAAGGCAGG + Intronic
1117871938 14:60210428-60210450 GACTCACAGTTCCACAAGGCTGG + Intergenic
1118621650 14:67619769-67619791 CGCCCACCGCTCTGCAAGGCTGG - Intergenic
1118881515 14:69830478-69830500 GACTCACAGTTCCCCATGGCTGG + Intergenic
1119426153 14:74535790-74535812 CCCCCACCACTCCCCAAAGCTGG + Intronic
1119766871 14:77195905-77195927 CCATCACAGCTCCCCAAGGCAGG + Intronic
1119871742 14:78023645-78023667 CCCCCACTGCTACCCAGGGCAGG - Intergenic
1121377335 14:93425115-93425137 GACTCACAGCTCCACATGGCTGG + Intronic
1121499220 14:94420162-94420184 GACTCACAGTTCCACAAGGCTGG - Intergenic
1122649960 14:103220768-103220790 CGCGCAGAGCTCCCCAAGCCTGG - Intergenic
1122893268 14:104742734-104742756 CTCCCCCAGCTGCCCATGGCAGG + Intronic
1123056933 14:105575154-105575176 CGCCCACCCCTCCCCCAGGCAGG + Intergenic
1123081277 14:105696631-105696653 CGCCCACCCCTCCCCCAGGCAGG - Intergenic
1123147923 14:106151728-106151750 GATCCACAGTTCCACAAGGCTGG - Intergenic
1123440327 15:20286351-20286373 GACTCACAGCTCCACATGGCTGG + Intergenic
1124637542 15:31374634-31374656 CGTCCACCGTTCCCCAAGGCAGG + Exonic
1125444972 15:39744804-39744826 CACACACAGTTCCCCACAGCTGG + Intronic
1125476975 15:40054303-40054325 AAACCCCAGCTCACCAAGGCTGG - Intergenic
1125491041 15:40148638-40148660 CACACACTGCTCTCCAAGGTGGG + Intergenic
1125581336 15:40788140-40788162 CAGCCACGTCTCCCCAAGCCCGG + Intronic
1125723361 15:41855732-41855754 CACCCCCAGCTCCTGGAGGCGGG - Exonic
1126941996 15:53778087-53778109 GACTCACAGCTCCACATGGCTGG + Intergenic
1127041672 15:54983940-54983962 CCCCCAGATCTCCCCATGGCTGG + Intergenic
1127043463 15:55002009-55002031 CAGCCAAAGCTTCACAAGGCAGG + Intergenic
1127746925 15:61987356-61987378 GACCCACAGTTCCACACGGCTGG + Intronic
1128482866 15:68054688-68054710 CAGCCCCAGCTCCCCATGGGGGG - Intronic
1129160849 15:73746872-73746894 CACCAGAAGCTCCCAAAGGCAGG - Intronic
1130888692 15:88115242-88115264 CACACACAGCTCCCTCAGGTTGG + Intronic
1130900128 15:88200687-88200709 GACCCACAGTTCCACATGGCTGG - Intronic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1131456254 15:92584810-92584832 CACCCACACCTCCAAATGGCTGG + Intergenic
1131793919 15:95994011-95994033 GACTCACAGCTCCACATGGCTGG + Intergenic
1132349993 15:101133552-101133574 CTCACACAGCCCCCCATGGCTGG - Intergenic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1132975972 16:2711425-2711447 CACCCAGGGCTCTCCGAGGCTGG + Intergenic
1133033446 16:3022288-3022310 CCCCCCCAACTCCCCAAAGCGGG + Exonic
1133394915 16:5439117-5439139 TTCCCAAATCTCCCCAAGGCTGG - Intergenic
1133470643 16:6072052-6072074 GACTCACAGCTCCACAGGGCTGG + Intronic
1133536591 16:6708131-6708153 CATCCCCCGCTCCCCAAGCCAGG - Intronic
1133659704 16:7904306-7904328 CACTCACAGTTCCACATGGCTGG - Intergenic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1134294344 16:12932133-12932155 GACTCACAGCTCCACATGGCTGG - Intronic
1134583107 16:15388350-15388372 TACTCACAGTTCCACAAGGCTGG - Intergenic
1134612625 16:15622129-15622151 CACACACAGGTTTCCAAGGCAGG + Intronic
1134801728 16:17090814-17090836 GACTCACAGCTCCACACGGCTGG - Intergenic
1135314604 16:21433891-21433913 TACTCACAGTTCCACAAGGCTGG - Intronic
1135323798 16:21513341-21513363 CACCCACAGCCCCCCGACCCTGG + Intergenic
1135367527 16:21866171-21866193 TACTCACAGTTCCACAAGGCTGG - Intronic
1135444287 16:22504991-22505013 TACTCACAGTTCCACAAGGCTGG + Intronic
1136003687 16:27314241-27314263 CACCCAGCGCTCCCCAAAGCCGG + Intronic
1136034105 16:27525677-27525699 GACCCACAGCACCCCCAGGGCGG - Intronic
1136193181 16:28631027-28631049 TACTCACAGTTCCACAAGGCTGG + Intergenic
1136311270 16:29412572-29412594 TACTCACAGTTCCACAAGGCTGG - Intergenic
1136324717 16:29514365-29514387 TACTCACAGTTCCACAAGGCTGG - Intergenic
1136335281 16:29606606-29606628 CACCCACAGCCCCCCGACCCTGG + Intergenic
1136417769 16:30113989-30114011 CACTCCCAGCTGCCCAGGGCTGG - Intergenic
1136439402 16:30254350-30254372 TACTCACAGTTCCACAAGGCTGG - Intronic
1136551755 16:30985759-30985781 GACCCGCAGCTCCCCGAGCCGGG - Exonic
1136726610 16:32362576-32362598 GACTCACAGCTCCACATGGCTGG - Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1136844843 16:33568089-33568111 GACTCACAGCTCCACATGGCTGG - Intergenic
1137840045 16:51632423-51632445 GACCCACAGTTCTGCAAGGCTGG + Intergenic
1138270678 16:55693782-55693804 CACTCACGACTACCCAAGGCTGG + Intronic
1139366602 16:66437530-66437552 CACCCACAGCCCCTGCAGGCTGG - Intronic
1139739467 16:69022921-69022943 CTGGCACAGCTCCCCAAGGTTGG - Exonic
1139845426 16:69917717-69917739 AACGCACAGATCCCCGAGGCAGG + Exonic
1139858791 16:70003502-70003524 TACTCACAGTTCCACAAGGCTGG - Intergenic
1139885909 16:70206650-70206672 TACTCACAGTTCCACAAGGCTGG - Intergenic
1140457558 16:75113952-75113974 CATCCTCAGCTCACCAATGCGGG + Exonic
1140813466 16:78599994-78600016 GACTCACAGCTCCACATGGCTGG + Intronic
1142114308 16:88348442-88348464 CACCAACAGGTCCCCAGGGTTGG + Intergenic
1142169203 16:88611688-88611710 AACCCAGAGCTCTCCAACGCAGG + Intronic
1142215945 16:88829888-88829910 CACCCCCTGCTCACCCAGGCTGG - Intronic
1142396314 16:89833739-89833761 CACGTGCTGCTCCCCAAGGCAGG - Intronic
1202999824 16_KI270728v1_random:155182-155204 GACTCACAGCTCCACATGGCTGG + Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1203131422 16_KI270728v1_random:1691582-1691604 GACTCACAGCTCCACATGGCTGG + Intergenic
1203155011 16_KI270728v1_random:1868387-1868409 GACTCACAGCTCCACATGGCTGG - Intergenic
1142630595 17:1223674-1223696 GACTCACAGTTCCCCAAGGCTGG + Intronic
1143558124 17:7675171-7675193 AACCCACAGCTGCACAGGGCAGG + Exonic
1144257162 17:13480446-13480468 GTTCCACAGCTCCCTAAGGCAGG - Intergenic
1144323279 17:14152247-14152269 CACCTACAGTTCCACATGGCTGG + Intronic
1144577296 17:16437155-16437177 CACCCCCACATCCCCAAGTCTGG + Intergenic
1144661241 17:17072324-17072346 CACCCACTGCTGGCCTAGGCCGG + Intronic
1144837317 17:18163436-18163458 CTCCCACAGCCCCACAAGGCAGG + Intronic
1146448526 17:32952795-32952817 GACTCACAGCTCCACATGGCTGG - Intergenic
1146556024 17:33824837-33824859 GACTCACAGCTCCACATGGCTGG - Intronic
1146571541 17:33957447-33957469 CACTCACAGTTCCACATGGCTGG + Intronic
1146854525 17:36251944-36251966 CCCCCACACCTCCCCTCGGCCGG + Intronic
1146866094 17:36336432-36336454 CCCCCACACCTCCCCTCGGCCGG - Intronic
1146877783 17:36426917-36426939 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147073309 17:37976460-37976482 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147080488 17:38016581-38016603 CCCCCACACCTCCCCTCGGCCGG - Intronic
1147084830 17:38055998-38056020 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147100778 17:38179964-38179986 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147557458 17:41488566-41488588 CATCACCAGCTCCCAAAGGCAGG + Intronic
1147741243 17:42672111-42672133 CCCGCACAGCTCCCCCAGGTCGG + Exonic
1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG + Intronic
1148747668 17:49927579-49927601 GACCCACACCTCCCCACTGCAGG + Intergenic
1148838531 17:50479479-50479501 GCCACACAACTCCCCAAGGCAGG - Intronic
1148908446 17:50926621-50926643 CATCCCCAGCTCCTCAAAGCTGG + Intergenic
1149101080 17:52908044-52908066 GACTCACAGTTCCACAAGGCTGG - Intergenic
1149122475 17:53186183-53186205 CTCCCAATGCTCCCCCAGGCTGG + Intergenic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1149593596 17:57849934-57849956 CACCCTCAGCCCACCACGGCTGG + Intronic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1150083711 17:62263011-62263033 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1150216670 17:63475355-63475377 CACCCACAGCCCTCAAAGCCTGG + Intergenic
1150459158 17:65332868-65332890 GACTCACAGTTCCCCATGGCTGG + Intergenic
1150593400 17:66582593-66582615 GACTCACAGTTCCACAAGGCTGG - Intronic
1150826377 17:68479804-68479826 TACCCACAGTTCCACATGGCTGG + Intergenic
1151060382 17:71085174-71085196 GACTCACAGCTCCACATGGCTGG - Intergenic
1151686564 17:75650637-75650659 CACTCACAGCTCCGCATGCCTGG + Intronic
1151876937 17:76872167-76872189 AACACACATCTCCCCTAGGCAGG - Intronic
1152020643 17:77778641-77778663 CACCCACTCCTCCCCACAGCAGG - Intergenic
1152230217 17:79110601-79110623 CACCAGCGGCTCACCAAGGCAGG - Intronic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152546129 17:81000879-81000901 CACCTGCAGCTTCCCAACGCAGG - Intronic
1155617345 18:27737598-27737620 GACCCACAGTTCCACATGGCTGG + Intergenic
1155748680 18:29392089-29392111 GACTCACAGTTCACCAAGGCTGG - Intergenic
1156568362 18:38222138-38222160 CACCCTCAAGTCCTCAAGGCTGG - Intergenic
1158198778 18:54917012-54917034 CACTCACAGTTCCACATGGCTGG - Intronic
1158770953 18:60516261-60516283 GACCCACAGTTCCTCATGGCTGG + Intergenic
1158879958 18:61768553-61768575 GACTCACAGCTCCACATGGCTGG - Intergenic
1159671662 18:71227736-71227758 CACTCACAGTTCCACATGGCTGG + Intergenic
1159674194 18:71261162-71261184 GACTCACAGTTCCACAAGGCTGG - Intergenic
1159939350 18:74394799-74394821 GACTCACAGCTCCACATGGCTGG + Intergenic
1160153093 18:76410079-76410101 GACTCATAGCTCCCCATGGCTGG - Intronic
1160294799 18:77628169-77628191 GACTCACAGCTCCACATGGCTGG + Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160342033 18:78097577-78097599 GACTCACAGCTCCACATGGCTGG + Intergenic
1160571269 18:79819159-79819181 CTCTCACTGCTCACCAAGGCCGG + Intergenic
1161284847 19:3463752-3463774 CACCCAGAGCTCCCCGAGTTGGG + Intronic
1161295322 19:3516753-3516775 CACTCAACGCTGCCCAAGGCTGG - Intronic
1161399860 19:4062434-4062456 CACCCACAGCGCTGGAAGGCAGG + Intronic
1161619965 19:5292779-5292801 CAGTCACAGCTCCCCCGGGCTGG + Intronic
1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG + Intergenic
1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG + Intergenic
1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG + Intergenic
1162167969 19:8767175-8767197 CACCCACACATCCCACAGGCAGG + Intergenic
1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG + Intergenic
1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG + Intergenic
1162299112 19:9834416-9834438 TACCCACAGTTCCCCAACTCTGG + Intergenic
1162450420 19:10750990-10751012 CACACACAGCTCCCCAAGGTGGG - Intronic
1162848347 19:13411534-13411556 CACTCACAGTTCCACATGGCTGG - Intronic
1163180157 19:15593668-15593690 GACTCACAGTTCCACAAGGCTGG - Intergenic
1163297864 19:16424090-16424112 CAGCCACAGGTCCCAAAGGAAGG + Intronic
1163451439 19:17379557-17379579 CACCCAGAGCCCCCCAGAGCTGG + Intergenic
1164136505 19:22421856-22421878 CACCCCCAGCACCCCGAGTCAGG + Intronic
1164608854 19:29618677-29618699 CACCCACAGCTGCCTAGAGCCGG - Intergenic
1164616235 19:29668308-29668330 CACCAACATCTTCCCGAGGCAGG + Intronic
1165581876 19:36872412-36872434 CACCCACTGCCCCCCAGGGAGGG - Intronic
1165725365 19:38109190-38109212 GACTCACAGCTCCACATGGCTGG + Intronic
1166090921 19:40508357-40508379 GCCCCACAGCTCCCCATGGTGGG - Intronic
1166633279 19:44426946-44426968 CACACACAGTTCCACATGGCTGG + Exonic
1167563347 19:50239927-50239949 CTCCCAAAACTCCCCCAGGCTGG - Intronic
1168130065 19:54312259-54312281 CACCCCCAGCTGCCCATGGGTGG + Intronic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
924972996 2:147891-147913 CACTCACAGCTCCACATGGCTGG + Intergenic
925036104 2:687021-687043 GACCCACAGTTCCACATGGCTGG - Intergenic
925179553 2:1808096-1808118 AACTCACAGCTCCACATGGCTGG - Intronic
925225143 2:2177577-2177599 GACTCACAGCTCCACATGGCTGG + Intronic
925689791 2:6510003-6510025 CACTCACAGTTCCACATGGCTGG - Intergenic
925963116 2:9037599-9037621 GACTCACAGCTCCACATGGCTGG + Intergenic
926008002 2:9387821-9387843 CACTCACACCTCCACATGGCTGG + Intronic
926826528 2:16911817-16911839 GACTCACAGCTCCACATGGCTGG + Intergenic
926949682 2:18227847-18227869 GACTCACAGTTCCACAAGGCTGG - Intronic
926974194 2:18496943-18496965 GACTCATAGTTCCCCAAGGCCGG + Intergenic
927175593 2:20404670-20404692 GACTCACAGCTCCACATGGCTGG + Intergenic
927651764 2:24917746-24917768 CACCCCGAGCTCCCGGAGGCAGG + Intronic
927660924 2:24991994-24992016 GACTCACAGTTCCCCATGGCTGG - Intergenic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
928387753 2:30884456-30884478 GACCCACAGCTCTGCAGGGCTGG - Intergenic
929109069 2:38391227-38391249 CAGACACTGCTCCCCCAGGCTGG - Intergenic
929427336 2:41856573-41856595 CACCCACAGTTTCACATGGCTGG - Intergenic
929807960 2:45163678-45163700 GACCAACAGCTCCTGAAGGCCGG + Intergenic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
930227674 2:48811357-48811379 GACCCACAGTACCCCATGGCTGG + Intergenic
930436963 2:51356532-51356554 GACTCACAGCTCCACATGGCTGG - Intergenic
930473118 2:51845746-51845768 GACTCACAGTTCCCCATGGCTGG - Intergenic
930694172 2:54394490-54394512 GACTCACAGTTCCACAAGGCTGG + Intergenic
931813483 2:65877452-65877474 CACTCACTTTTCCCCAAGGCAGG - Intergenic
932492048 2:72128447-72128469 CACCCACAGCCCCTCAATCCCGG + Intergenic
932494491 2:72139729-72139751 CATCCACAGCTTTCTAAGGCGGG - Intronic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
932960386 2:76406483-76406505 CAACCACAGAGCCCCAAGGCAGG - Intergenic
933798823 2:85943454-85943476 CACTCACAGTTCCACATGGCTGG + Intergenic
934468423 2:94288011-94288033 CACGCACAGTTCCACATGGCTGG - Intergenic
934742970 2:96739384-96739406 CACCAACAGGGCCCCTAGGCTGG + Intronic
935189891 2:100768624-100768646 CAGCCACAGCCACCCAAGACTGG + Intergenic
935344236 2:102090214-102090236 CACCCAAAACTCCCCATGGTAGG - Intronic
935680830 2:105635707-105635729 CTCCTACAGCTCGCCAAGCCAGG - Intergenic
935886225 2:107622845-107622867 CACTCACAGCTCACCTAGGAAGG - Intergenic
936009721 2:108917810-108917832 CACCCATTGCTGCCCAAGGTTGG - Intronic
937434730 2:121871018-121871040 CAACCACATCTCCAAAAGGCAGG - Intergenic
937677327 2:124606628-124606650 GACTCACAGTTCCCCATGGCTGG + Intronic
938307497 2:130265521-130265543 CAGCCCAGGCTCCCCAAGGCTGG + Intergenic
938447835 2:131391321-131391343 CAGCCCAGGCTCCCCAAGGCTGG - Intergenic
939740591 2:145901387-145901409 GACCCACAGTTCCACACGGCTGG - Intergenic
940462023 2:153977350-153977372 GACTCACAGTTCCTCAAGGCTGG + Intronic
940699658 2:157024704-157024726 CACTCACAGTTCCACATGGCTGG - Intergenic
941121032 2:161530439-161530461 GACTCACAGCTCCACATGGCTGG - Intronic
943438122 2:187892517-187892539 GACTCACAGTTCCACAAGGCTGG - Intergenic
944878091 2:203983386-203983408 CAGCCACAGCATCCCAGGGCAGG - Intergenic
945234943 2:207625214-207625236 CACCCAGGGCTCGCCCAGGCCGG + Exonic
945898759 2:215514748-215514770 CACGCACAGCCACCCACGGCGGG - Intergenic
945898766 2:215514778-215514800 CACGCACAGCCACCCACGGCAGG - Intergenic
945922514 2:215770201-215770223 CTGCCACAGCACCCCAAGGAAGG + Intergenic
946404871 2:219486904-219486926 ACCCCACTGCTCCCCAAGGAGGG - Intronic
946709431 2:222491397-222491419 GACCCACAGCTCTGCATGGCTGG + Intronic
947101982 2:226630726-226630748 GACTCACAGTTCCACAAGGCTGG - Intergenic
947161230 2:227217064-227217086 GACTCACAGCTCCACATGGCTGG + Intronic
947177500 2:227382572-227382594 GACTCACAGTTCCACAAGGCTGG - Intergenic
947605771 2:231484142-231484164 CACCCACAGCGCCCCCACGCTGG - Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
947888713 2:233596624-233596646 TACTCACAGCTCCACATGGCTGG - Intergenic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948825990 2:240573662-240573684 CACCCACACCTCACCCAGCCTGG - Intronic
948981471 2:241496967-241496989 CAGCCACAGCCCCCCGAGGGTGG - Intronic
949039079 2:241837605-241837627 AACTCACAGTTCCCCATGGCTGG - Intergenic
1169391880 20:5197348-5197370 CACAGACAGCTCCCCAAAGCAGG - Exonic
1170508711 20:17055174-17055196 CACTCACAGCTTCCCTGGGCAGG + Intergenic
1170963135 20:21043167-21043189 GACTCACAGTTCCCCATGGCTGG - Intergenic
1171050515 20:21853931-21853953 CCACCACAGCTCAACAAGGCTGG + Intergenic
1171191028 20:23159580-23159602 CACCCACCCCACCCCCAGGCTGG - Intergenic
1171421497 20:25020732-25020754 CACACCCAGCCCCCAAAGGCAGG + Intronic
1172634299 20:36399537-36399559 CACCCATAGCTCCCCAGTGCTGG - Intronic
1172979248 20:38928413-38928435 CACCCAAAGCACCTCAGGGCTGG - Intronic
1173008825 20:39162318-39162340 GACTCACAGCTCCACATGGCTGG - Intergenic
1173075719 20:39817588-39817610 GACTCACAGCTCCACATGGCTGG + Intergenic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1174108437 20:48179986-48180008 GACCCACAGTTCCACATGGCTGG - Intergenic
1174568196 20:51482117-51482139 CACCCCCAGCCCCCCAAGTCTGG + Intronic
1174668500 20:52283259-52283281 GACCCACAGTTCCTCATGGCTGG - Intergenic
1175222724 20:57426626-57426648 CTCCCACAGCACCCCCAGGAGGG + Intergenic
1175371556 20:58496184-58496206 CTCCCACAGCTGACCCAGGCTGG - Intronic
1175477813 20:59289138-59289160 GGCACACAGATCCCCAAGGCAGG + Intergenic
1177208773 21:18043792-18043814 GACCCACAGTTCCACAGGGCTGG + Intronic
1177217289 21:18146603-18146625 GACCCACAGTTCCACATGGCTGG - Intronic
1177627234 21:23678481-23678503 GACTCACAGCTCCACATGGCTGG + Intergenic
1177632684 21:23747407-23747429 GACTCACAGCTCCACATGGCAGG + Intergenic
1177653618 21:23987947-23987969 GACTCACAGTTCCACAAGGCTGG - Intergenic
1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG + Intergenic
1177906431 21:26976819-26976841 GACTCACAGCTCCGCATGGCTGG - Intergenic
1178013600 21:28317003-28317025 TACCCACAGTTCCACATGGCTGG - Intergenic
1178041397 21:28644134-28644156 GACCCACAGTTCCACATGGCTGG + Intergenic
1178486051 21:33020748-33020770 CATCCAGAGCTCCCCCACGCAGG - Intergenic
1178784486 21:35640373-35640395 AACCCACAGAACCCCAAGGATGG - Intronic
1179126989 21:38599354-38599376 GCCCCACAGCTCTCCATGGCAGG - Intronic
1179181943 21:39053263-39053285 CACCCAAAGGTCCTCAAGCCAGG + Intergenic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1179508590 21:41857912-41857934 CACCCAGAGCACACCATGGCGGG + Intronic
1179573325 21:42291333-42291355 CCGCCACAGCTCCCGAAGTCAGG - Intronic
1179668895 21:42931725-42931747 GACCCACAGATCCGCATGGCAGG + Intergenic
1179722603 21:43324152-43324174 CACCCTCAGCTCCCCATCCCAGG + Intergenic
1179821681 21:43940662-43940684 CTCCCACTGCCCCCCAAGGCAGG + Intronic
1179899030 21:44379419-44379441 CACCCGCAGCACACCAGGGCGGG + Intronic
1179902743 21:44402400-44402422 CACCCACACCTCCACAGGGAGGG - Intronic
1179978339 21:44883482-44883504 GAGCCTCAGTTCCCCAAGGCTGG - Intergenic
1180154556 21:45971664-45971686 CAGCCACAGCTCCGTAAGGTGGG + Intergenic
1180307558 22:11142178-11142200 GACTCACAGCTCCACATGGCTGG + Intergenic
1180546078 22:16504401-16504423 GACTCACAGCTCCACATGGCTGG + Intergenic
1180857725 22:19058921-19058943 CACCAGCAGCTCCCCTGGGCAGG - Intronic
1181144500 22:20834896-20834918 GACCCTCAGCTCCAGAAGGCAGG - Intronic
1181183538 22:21084717-21084739 GACTCACAGTTCCACAAGGCTGG + Intergenic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1182361564 22:29749473-29749495 CACCCAAGGCTCCCCAGGGAGGG + Intronic
1182973484 22:34599786-34599808 CAGACACAGCTCACCCAGGCTGG + Intergenic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1183264930 22:36819197-36819219 CACCCACCGCCCCCCGTGGCTGG - Intronic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1183392175 22:37552042-37552064 CCCCCACAGCCCACCCAGGCAGG + Intergenic
1184130991 22:42516248-42516270 CAGCCACATCTGCCCAAGCCGGG + Intronic
1184141161 22:42578073-42578095 CAGCCACATCTGCCCAAGCCGGG + Intergenic
1184451375 22:44584695-44584717 CACTCACAGCTCTACATGGCAGG - Intergenic
1184686204 22:46097507-46097529 CACCCACTGTTCCCGAGGGCTGG - Intronic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
1185101074 22:48841148-48841170 AACCCACAGTTCAGCAAGGCTGG + Intronic
1185365717 22:50435810-50435832 CAGGGACAGCTCCCCAGGGCAGG + Intronic
949796733 3:7859809-7859831 GACTCACAGCTCCACATGGCTGG + Intergenic
949947642 3:9202945-9202967 CAGCCACTTCTCCCCAAGCCAGG + Intronic
950098284 3:10342715-10342737 CACCCACGCCTCTCCCAGGCGGG - Intronic
950432042 3:12956379-12956401 CTCCCACAGCTCTGCATGGCTGG + Intronic
951134957 3:19094540-19094562 GACTCACAGCTCCACATGGCTGG - Intergenic
951395476 3:22160140-22160162 CACTCACAGTTCCACATGGCTGG - Intronic
951426169 3:22547377-22547399 GACTCACAGTTCCCCATGGCTGG - Intergenic
951454329 3:22873654-22873676 GACTCACAGCTCCACATGGCTGG + Intergenic
952022354 3:29039301-29039323 GACCCACAGTTCCTCATGGCTGG - Intergenic
952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG + Intronic
952965936 3:38621278-38621300 CATGCACAGCCCCCCAGGGCTGG - Intronic
953653093 3:44823638-44823660 CCACCACAGCTCAGCAAGGCCGG - Intronic
953903942 3:46858826-46858848 CACCCGCTGCTCCCCAAGTCTGG + Intronic
953985528 3:47439583-47439605 CACCCACTGCTTACCAGGGCAGG + Intronic
954043504 3:47909008-47909030 CACACACATTTCCCCATGGCAGG + Intronic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
955154333 3:56401906-56401928 GACCCACAGTTCCACATGGCTGG + Intronic
956389716 3:68758547-68758569 GACTCACAGTTCCACAAGGCTGG - Intronic
956746981 3:72318129-72318151 CATCCCCAGTGCCCCAAGGCAGG - Intergenic
957212416 3:77276776-77276798 GACCCACAGTTCCACATGGCTGG + Intronic
958507940 3:95005565-95005587 GACTCACAGCTCCACATGGCTGG + Intergenic
958557875 3:95703658-95703680 GACCCACAGTTCCACATGGCTGG + Intergenic
959141178 3:102487942-102487964 GACTCACAGTTCCACAAGGCTGG - Intergenic
959214669 3:103436662-103436684 CACTCACAGCTCTGCATGGCTGG + Intergenic
959310465 3:104729574-104729596 TGCCCGCAGCTCACCAAGGCTGG + Intergenic
959719504 3:109470773-109470795 CACCCACAGTTCGACATGGCTGG - Intergenic
959879616 3:111428584-111428606 CTTCCACAGATCCCTAAGGCAGG - Intronic
959985949 3:112571610-112571632 GACGCACAGTTCCACAAGGCTGG + Intronic
960109678 3:113833486-113833508 CACCAACACCTGCCCAAGGCAGG + Intronic
960126647 3:114005910-114005932 CAACCACTGCTTCCCAAGGGAGG + Exonic
960559093 3:119062838-119062860 CACCCTCTGCTTCTCAAGGCAGG + Intronic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961646329 3:128394712-128394734 CTCAGACAGCCCCCCAAGGCTGG - Intronic
961741194 3:129034084-129034106 CACCACCACCTCTCCAAGGCTGG + Intronic
962206579 3:133440039-133440061 AACCCACAGTTCCCCACGGCTGG + Intronic
962281241 3:134053543-134053565 GACTCACAGCTCCACATGGCTGG - Intergenic
962318019 3:134370872-134370894 CTCCCACAGCTTCCCACAGCTGG - Exonic
962718865 3:138153675-138153697 GACTCACAGTTCCCCAAGACTGG + Intergenic
962981853 3:140497903-140497925 CACTCACAGCTTCCCTTGGCTGG + Intronic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
963134498 3:141888971-141888993 CACTCACAGTTCCACATGGCTGG + Intronic
963306569 3:143660046-143660068 GACTCACAGCTCCACATGGCTGG - Intronic
963351743 3:144160186-144160208 GACCCACAGTTCCACATGGCTGG + Intergenic
963522956 3:146378962-146378984 AACTCACAGCTCCTCATGGCAGG - Intergenic
963855577 3:150249927-150249949 TACCCACAGCACCACAATGCTGG - Intergenic
964025949 3:152074608-152074630 GACCCACAGTTCCACATGGCTGG + Intergenic
965264779 3:166529243-166529265 GACTCACAGCTCCGCATGGCTGG + Intergenic
966828834 3:183988533-183988555 CACCCTCATCTCCCCCATGCCGG - Intronic
966840638 3:184084158-184084180 CACCCACAGCTCCACTAGCTGGG - Intergenic
967615543 3:191560956-191560978 GACTCACAGCTCCACATGGCTGG + Intergenic
967789064 3:193527727-193527749 GACTCACAGCTCCACATGGCTGG - Intronic
968123607 3:196143039-196143061 CCTCCGCAGCTCCCCAGGGCGGG + Intergenic
968234687 3:197024550-197024572 CTCCCACAGCCCGCCCAGGCAGG - Intronic
968280732 3:197474772-197474794 GACTCACAGTTCCCCACGGCTGG - Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968482852 4:844389-844411 GACTCACAGTTCCCCATGGCTGG + Intergenic
968982331 4:3856995-3857017 GGCCCACAGCTCTCCCAGGCAGG + Intergenic
969174552 4:5388587-5388609 GACCCTGAGCTCCCCAAGGCTGG - Intronic
969375690 4:6761852-6761874 CACCCTCAGCGCCCTAAGGTGGG - Intergenic
969852311 4:9969638-9969660 GACTCACAGTTCCCCATGGCTGG + Intronic
970046084 4:11856096-11856118 CACCTACAGCCCCCCAAATCAGG + Intergenic
970047688 4:11875082-11875104 GACTCACAGTTCCACAAGGCTGG + Intergenic
970343191 4:15128223-15128245 GACTCACAGCTCCACATGGCTGG + Intergenic
971008080 4:22397826-22397848 GACCCACAGTTCCACATGGCTGG - Intronic
971467142 4:26975957-26975979 CACACACCCCTCCCCAAGCCAGG + Intronic
971493288 4:27237220-27237242 GACTCACAGTTCCCCATGGCTGG + Intergenic
972201769 4:36721133-36721155 GACTCACAGTTCCACAAGGCTGG - Intergenic
972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG + Intergenic
973334977 4:48947063-48947085 GACTCACAGCTCCTCATGGCTGG + Intergenic
973747180 4:53975240-53975262 GACTCACAGTTCCCCAGGGCTGG - Intronic
974328303 4:60444095-60444117 CCCACACAGCTCCCCAATTCAGG - Intergenic
974557167 4:63465833-63465855 AACCCACAGTTCCACATGGCTGG + Intergenic
974617860 4:64313008-64313030 GACTCACAGTTCCGCAAGGCTGG - Intronic
975419041 4:74140670-74140692 GACCCACAGTTCCACAGGGCCGG + Intronic
976560114 4:86491248-86491270 CACAGACAGCTCCACAGGGCAGG + Intronic
976906620 4:90244534-90244556 GACTCACAGCTCCACATGGCTGG + Intronic
977171307 4:93766271-93766293 GACTCACAGTTCCCCATGGCTGG + Intronic
979174252 4:117642825-117642847 TACTCACAGTTCCCCATGGCTGG + Intergenic
980746238 4:137020317-137020339 CACTCACAGTTCCACATGGCTGG - Intergenic
981834248 4:149036720-149036742 GACTCACAGTTCCGCAAGGCTGG - Intergenic
982795097 4:159635027-159635049 GACTCACAGCTCCACATGGCTGG + Intergenic
982843397 4:160220564-160220586 GATCCACAGATCCCTAAGGCAGG + Intergenic
983015456 4:162607345-162607367 CTTCCACAGATCCCCAGGGCAGG - Intergenic
983786050 4:171730268-171730290 GACTCACAGCTCCACATGGCTGG - Intergenic
984565795 4:181328646-181328668 GACTCACAGCTCCACAGGGCTGG - Intergenic
985023342 4:185714617-185714639 GACTCACAGCTCCACATGGCTGG + Intronic
985220149 4:187695730-187695752 GACTCACAGCTCCACATGGCTGG - Intergenic
985220469 4:187698051-187698073 CACACACAGTTCCACATGGCTGG - Intergenic
985703506 5:1387465-1387487 TTCCCCCAGCTCCCCAAGTCAGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985842794 5:2321232-2321254 GACACACAGCTCCACATGGCTGG - Intergenic
986029653 5:3882409-3882431 GACTCACAGCTCCACATGGCTGG - Intergenic
986871202 5:12048832-12048854 GACCCACAGTTCCCCAAGGCTGG - Intergenic
986885933 5:12235823-12235845 GACCCACAGTTCCACATGGCTGG - Intergenic
986950678 5:13080775-13080797 CACCCACAGCTCCAGTAAGCAGG - Intergenic
987103299 5:14612204-14612226 CAGCCACAGCAGCCCATGGCAGG - Exonic
987384152 5:17313219-17313241 CACCCACAGTTCCTCTAGGTAGG - Intergenic
987940644 5:24531496-24531518 GACTCACAGCTCCACATGGCTGG + Intronic
988004935 5:25397469-25397491 CACTCACAGTTCCACATGGCTGG + Intergenic
988864338 5:35318017-35318039 GACTCACAGCTCCGCATGGCTGG - Intergenic
989731536 5:44655406-44655428 GACTCACAGTTCCCCATGGCTGG - Intergenic
989782868 5:45290211-45290233 GACTCACAGCTCCACATGGCTGG - Intronic
990336366 5:54776635-54776657 GACTCACAGCTCCACATGGCTGG + Intergenic
990459295 5:56016131-56016153 CACTCACAGTTCCACAAGCCTGG - Intergenic
990999969 5:61772707-61772729 GACTCACAGCTCCACATGGCTGG - Intergenic
993226776 5:85176614-85176636 GACTCACAGTTCCCCATGGCTGG + Intergenic
993262800 5:85681919-85681941 GACCCACAGTTCCACATGGCTGG + Intergenic
994813604 5:104556059-104556081 CACTCACAGTTCCCCTTGGCTGG + Intergenic
995027889 5:107445667-107445689 CACCCAGACCTCTCCAAGGATGG + Intronic
995405150 5:111786302-111786324 GACTCACAGCTCCACATGGCTGG - Intronic
996611249 5:125382795-125382817 CACCTTCAGCTCTCCCAGGCTGG - Intergenic
996871552 5:128198660-128198682 GACCCACAGTTCCACATGGCTGG - Intergenic
997208804 5:132065980-132066002 CCTCCACGGCTCCCCCAGGCTGG + Intergenic
999159283 5:149482005-149482027 CAGACAAAGCTCCCCAAGGCCGG - Intergenic
999314334 5:150574405-150574427 CACTCTCTGCTCCCCCAGGCAGG + Intergenic
1000111729 5:158114431-158114453 GACTCACAGTTCCCCATGGCTGG - Intergenic
1000115581 5:158150431-158150453 CTGCCACAGCTTCCCAAGGTTGG + Intergenic
1002460391 5:179370385-179370407 CCCCCAAAGTCCCCCAAGGCAGG - Intergenic
1002575726 5:180172690-180172712 CACGCCCAGCTCCCCAAGAGGGG + Intronic
1003027534 6:2569529-2569551 GACTCACAGTTCCCCATGGCTGG + Intergenic
1003148852 6:3531605-3531627 CACACCGAGCTCCCCCAGGCCGG - Intergenic
1003498541 6:6685733-6685755 CACCTACAGGCTCCCAAGGCAGG + Intergenic
1004375877 6:15090248-15090270 CACCCACAAGTCCCGAGGGCAGG + Intergenic
1005783552 6:29218637-29218659 GACTCACAGTTCCGCAAGGCTGG - Intergenic
1006162800 6:32047969-32047991 CACAGTCAGCTCCCCCAGGCGGG + Intronic
1006162955 6:32048598-32048620 CACCGCCAGCTCCCCCAGGCGGG + Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006375257 6:33668349-33668371 GACTCCCAGCTCCCCAAGGAGGG - Intronic
1006377527 6:33679873-33679895 CACCCGCAGCTGACCAATGCAGG + Exonic
1006428207 6:33979209-33979231 CAGGCCCTGCTCCCCAAGGCAGG - Intergenic
1006881677 6:37345396-37345418 CCCCCACACCACCCCACGGCAGG + Intergenic
1007498226 6:42276512-42276534 CACTCCCAGCTCCCCTAAGCAGG + Intronic
1007507495 6:42347240-42347262 CACCCACCTCTCCCAAAGGCAGG + Intronic
1007631340 6:43275177-43275199 CCCCCGCAGGTCCCCAAGCCAGG + Intronic
1008283784 6:49625814-49625836 GACTCACAGTTCCACAAGGCTGG + Intronic
1008966987 6:57322629-57322651 GACTCACAGTTCCCCAGGGCTGG - Intronic
1009377666 6:62991826-62991848 GACTCACAGTTCCGCAAGGCTGG + Intergenic
1009763408 6:68037977-68037999 GACTCACAGTTCCCCATGGCTGG + Intergenic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1010630051 6:78188722-78188744 GACTCACAGCTCCACATGGCTGG + Intergenic
1011347840 6:86390832-86390854 GACTCACAGCTCCACATGGCTGG - Intergenic
1012202391 6:96423208-96423230 CACTCACAGTTCCACATGGCTGG + Intergenic
1013819405 6:114136428-114136450 GACTCACAGCTCCACATGGCTGG - Intronic
1014719974 6:124904190-124904212 CACTCACAGTTCCACATGGCTGG - Intergenic
1015044162 6:128759405-128759427 CAGCCCCATCTCCCCAAGCCTGG + Intergenic
1015249255 6:131109472-131109494 GACTCACAGTTCCCCATGGCTGG - Intergenic
1015683454 6:135833518-135833540 CAACCCCTGCTCTCCAAGGCAGG + Intergenic
1016270041 6:142278195-142278217 CACTCACAGTTCCACATGGCTGG + Intergenic
1016304180 6:142666164-142666186 AACTCACAGCTCCACATGGCTGG + Intergenic
1016474593 6:144413380-144413402 GACCCACAGTTCCACATGGCTGG + Intronic
1016683085 6:146852918-146852940 GACCCACAGTTCCACATGGCTGG - Intergenic
1016879884 6:148900559-148900581 GACTCACAGTTCCACAAGGCTGG - Intronic
1018523417 6:164679176-164679198 GACTCACAGTTCCCCATGGCTGG + Intergenic
1018745391 6:166757741-166757763 CAGCCACAGATTCCCAAGCCGGG + Intronic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019490532 7:1311192-1311214 CACTCACAGTTCCCCGAGGAGGG - Intergenic
1019527606 7:1487708-1487730 CACCCACAGGTCCCGACGGCAGG + Intronic
1019707061 7:2501954-2501976 CACCCACTGCACCCCAAGGCTGG - Intergenic
1019711760 7:2521164-2521186 CACCCACAGTGCCCCAAAACAGG - Intronic
1020257254 7:6509116-6509138 CCCCGACAGCCCCCCAAGCCCGG - Exonic
1021092167 7:16496615-16496637 CACTCACAGTTCCACATGGCTGG + Intronic
1021847833 7:24779809-24779831 CACCAACAGCATCCCTAGGCTGG + Intergenic
1021849938 7:24797519-24797541 GCCCCAAAGCACCCCAAGGCTGG - Exonic
1021927291 7:25545832-25545854 AGCCCTCAGCTGCCCAAGGCTGG - Intergenic
1022241060 7:28513030-28513052 CAGCCTCAGCTCCGCAAAGCAGG + Intronic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1024533560 7:50411771-50411793 CACCCGCAGCTCCTCCAGGGTGG - Intergenic
1024576258 7:50767230-50767252 CCCGCACAGATGCCCAAGGCAGG + Intronic
1025199076 7:56950691-56950713 CACTCGCAGCCCCCCAGGGCTGG - Intergenic
1025480407 7:60976188-60976210 CACGCACAGTTCCACATGGCTGG + Intergenic
1025672871 7:63626242-63626264 CACTCGCAGCCCCCCAGGGCTGG + Intergenic
1026297661 7:69069053-69069075 GACTCACAGTTCCACAAGGCTGG - Intergenic
1026536566 7:71243258-71243280 GACTCACAGCTCCACATGGCTGG - Intronic
1026549155 7:71352275-71352297 GACTCACAGCTCCACATGGCTGG - Intronic
1026567291 7:71500039-71500061 GACTCACAGCTCCGCATGGCTGG - Intronic
1027604407 7:80283161-80283183 GACTCACAGCTCCACATGGCTGG - Intergenic
1027782474 7:82536625-82536647 GACTCACAGATCCCCATGGCTGG - Intergenic
1028613997 7:92744228-92744250 GACTCACAGCTCCACATGGCTGG + Intronic
1029272300 7:99384565-99384587 CTCCTTCAGTTCCCCAAGGCTGG + Intronic
1030563403 7:111120280-111120302 GACTCACAGCTCCACATGGCTGG + Intronic
1030754790 7:113274086-113274108 CACTCACAGTTCCACATGGCTGG + Intergenic
1031230042 7:119094931-119094953 GACTCACAGCTCCACATGGCTGG + Intergenic
1031249322 7:119359234-119359256 GACTCACAGTTCCACAAGGCTGG + Intergenic
1031287386 7:119886940-119886962 CACTCACAGTTCCACATGGCTGG + Intergenic
1031764667 7:125763001-125763023 CACTCACAGTTCCACATGGCTGG - Intergenic
1032440241 7:131937188-131937210 GACCCACAGTTCCACATGGCTGG - Intergenic
1032823845 7:135550385-135550407 CACACACTGCTGCCCAGGGCCGG + Intergenic
1032892047 7:136207396-136207418 GACTCACAGCTCCACATGGCTGG - Intergenic
1032977130 7:137238311-137238333 AACCCAGAGCTCTCCCAGGCTGG - Intronic
1034405792 7:150901667-150901689 CCTCCACAGTTCCCCAAGCCTGG - Intergenic
1035380662 7:158438517-158438539 CCTCCGCAGCTCCCCAAAGCAGG + Intronic
1035392631 7:158515574-158515596 CACCCACTGCTCCCAATGGGAGG + Intronic
1035625225 8:1066442-1066464 CACCCAGACCTGCCCAAGGTGGG - Intergenic
1035817239 8:2554134-2554156 GACCCACAGTTCCGCATGGCTGG - Intergenic
1036030980 8:4972543-4972565 GACTCACAGTTCCCCATGGCTGG - Intronic
1036125809 8:6061205-6061227 GACTCACAGTTCCCCATGGCTGG + Intergenic
1036358543 8:8061858-8061880 GACCCACAGCTCCTCATGGAGGG + Intergenic
1037252151 8:16908361-16908383 GACTCACAGCTCCACAAGGCTGG + Intergenic
1037263579 8:17035170-17035192 GACTCACAGTTCCACAAGGCTGG - Intronic
1037303581 8:17480932-17480954 TTCCCACAGCTCTCCAACGCAGG - Intergenic
1037477900 8:19275724-19275746 GACTCACAGCTCCACATGGCTGG + Intergenic
1037500871 8:19484462-19484484 CACTCACAGTTCCACATGGCTGG + Intronic
1037642011 8:20753412-20753434 CACTCACAGTTCCACATGGCTGG - Intergenic
1038251384 8:25908178-25908200 CACACACAGCTGCCCACAGCAGG - Intronic
1038813524 8:30877038-30877060 GACTCACAGTTCCCCATGGCTGG - Intronic
1039438885 8:37580903-37580925 GACTCACAGCTCCACATGGCTGG - Intergenic
1039796302 8:40918420-40918442 ACCCCACAGGTCCCTAAGGCGGG + Intergenic
1039956703 8:42213000-42213022 GACTCACAGTTCCCCATGGCTGG - Intergenic
1040298233 8:46174347-46174369 CCCCCACAGCTGTCCCAGGCAGG + Intergenic
1041021668 8:53644150-53644172 CGCGCACAGCTCTCCCAGGCAGG - Intergenic
1041338730 8:56818159-56818181 GACTCACAGCTCCACATGGCTGG - Intergenic
1041593637 8:59620720-59620742 GACTCACAGCTCCACATGGCTGG + Intergenic
1042650424 8:71034394-71034416 GACTCACAGCTCCACATGGCTGG - Intergenic
1042773073 8:72399855-72399877 CACTCACAGTTCCACATGGCTGG + Intergenic
1043059941 8:75487831-75487853 GACTCACAGTTCCTCAAGGCTGG + Intronic
1043364269 8:79513453-79513475 GACTCACGGCTCCCCACGGCTGG - Intergenic
1043376153 8:79652032-79652054 CAGCCACAGCTGCTAAAGGCAGG - Intronic
1043774943 8:84254772-84254794 GACTCACAGCTCACCATGGCTGG + Intronic
1044192080 8:89331186-89331208 GACTCACAGCTCCTCATGGCTGG + Intergenic
1044562121 8:93622630-93622652 GACCCACAGTTCGCCATGGCTGG - Intergenic
1045079113 8:98604930-98604952 GATCCACAGATCCCCAGGGCAGG + Intronic
1046146719 8:110170929-110170951 CACTCACAGTTCCACATGGCTGG - Intergenic
1046887499 8:119383675-119383697 CACTCTCAGCTCCTCAAGGCTGG - Intergenic
1046917544 8:119693053-119693075 GACTCACAGTTCCGCAAGGCTGG - Intergenic
1047678414 8:127227857-127227879 CACTCACTTCTCCCCAAGGGAGG - Intergenic
1048700428 8:137082432-137082454 GACTCACAGCTCCACATGGCTGG - Intergenic
1048818569 8:138357986-138358008 AACTCACAGCTCCACATGGCTGG + Intronic
1049184253 8:141241018-141241040 GGCCCACAGCGCCCCAAAGCGGG - Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049480065 8:142818365-142818387 TGCCCACTGCTCCCCAATGCTGG + Intergenic
1049615044 8:143572367-143572389 CATCCACAGGACCCCCAGGCCGG + Intronic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1050222239 9:3405915-3405937 TACCCACAGTTCCCCAAACCTGG + Intronic
1051371659 9:16364399-16364421 CAGCCACAGGCCCCCAGGGCTGG + Intergenic
1051658095 9:19401684-19401706 GACCCACAGTTCCACATGGCTGG - Intergenic
1051979623 9:22998234-22998256 GACCCACAGTTCCACATGGCTGG + Intergenic
1052387606 9:27840048-27840070 GACTCACAGCTCCACATGGCTGG - Intergenic
1052737425 9:32357069-32357091 CACTCACAGTTCCACATGGCTGG + Intergenic
1053571876 9:39318335-39318357 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1053944832 9:43296268-43296290 CACTCACAGTTCCACATGGCTGG - Intergenic
1054093430 9:60877046-60877068 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054114913 9:61152966-61152988 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054125269 9:61300676-61300698 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1054592843 9:67029568-67029590 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1054885694 9:70195992-70196014 GACTCACAGTTCCACAAGGCTGG + Intronic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1055360987 9:75489899-75489921 CACTCACAGTTCCACATGGCAGG - Intergenic
1055534741 9:77228764-77228786 GACCAACAGCTCCACATGGCTGG + Intronic
1056963863 9:91149882-91149904 CACCCACTGCACTCCAAGCCTGG - Intergenic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057037848 9:91824748-91824770 CACACACAGCTCTCCCAGGCGGG + Intronic
1057251687 9:93508403-93508425 CCCTGACAGGTCCCCAAGGCTGG + Intronic
1057488726 9:95506411-95506433 CACCCACAGCTCCTCCACGTTGG + Exonic
1058568297 9:106310865-106310887 GACTCACAGCTCCACATGGCTGG - Intergenic
1058618228 9:106858951-106858973 CACCCAAATCTCCCAAAGGAAGG - Intergenic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1058906587 9:109486971-109486993 GACTCACAGTTCCGCAAGGCTGG - Intronic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1059675054 9:116529862-116529884 TACTCACAGTTCCCCATGGCTGG - Intronic
1059702321 9:116787041-116787063 GACTCACAGTTCCCCATGGCTGG - Intronic
1059826066 9:118030314-118030336 GACCCACAGTTCCACATGGCTGG + Intergenic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1060153265 9:121301984-121302006 CACCCCGAGTTCCTCAAGGCAGG + Exonic
1060934535 9:127507521-127507543 CAACCACAGACCCCCAAGGCGGG - Intronic
1060982889 9:127803662-127803684 CACCCTCAGGACCTCAAGGCTGG - Intronic
1061151921 9:128833688-128833710 CTCACAGAGCTTCCCAAGGCCGG - Intronic
1061226574 9:129284107-129284129 CACACACAGCCCTGCAAGGCGGG + Intergenic
1061893260 9:133633827-133633849 CACACCCAGCCACCCAAGGCTGG + Intergenic
1061977936 9:134081522-134081544 CACTCACAGTTCCACATGGCTGG - Intergenic
1062020454 9:134316918-134316940 CAGCCACCCCTCCCCCAGGCAGG - Intergenic
1062045047 9:134421100-134421122 CTCCCACAGCTCTGGAAGGCAGG - Intronic
1062378178 9:136274360-136274382 CTGACTCAGCTCCCCAAGGCTGG + Intergenic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1203786050 EBV:128135-128157 CTCCCACAACTCTCTAAGGCTGG + Intergenic
1203587967 Un_KI270747v1:24846-24868 CACTCACAGTTCCACATGGCTGG - Intergenic
1185886240 X:3785822-3785844 GACTCACAGTTCCTCAAGGCTGG - Intergenic
1185992976 X:4912562-4912584 GACTCACAGTTCCCCATGGCTGG - Intergenic
1186069909 X:5808429-5808451 GACTCACAGCTCCCCATGGCTGG + Intergenic
1186196062 X:7111191-7111213 GACCCACAGTTCCACATGGCTGG - Intronic
1186233161 X:7478154-7478176 GACTCACAGTTCCCCATGGCTGG + Intergenic
1187505536 X:19875542-19875564 CACCCACTCCTCCACAGGGCAGG + Intronic
1188048905 X:25460507-25460529 GACTCACAGCTCCACATGGCTGG + Intergenic
1188051852 X:25497411-25497433 GACTCACAGCTCCACATGGCTGG - Intergenic
1188095342 X:26014481-26014503 GACTCACAGTTCCACAAGGCTGG + Intergenic
1189423600 X:40879257-40879279 GACCCACAGTTCCACATGGCTGG + Intergenic
1190485056 X:50915874-50915896 CACCCAGGGCTCCACATGGCAGG - Exonic
1190542718 X:51495637-51495659 CACACACACCTCCCAAAAGCAGG + Intronic
1192277574 X:69648972-69648994 CACTCACAGCTTCCCTTGGCTGG + Intronic
1192841769 X:74864644-74864666 GACTCACAGTTCCCCATGGCTGG - Intronic
1192923888 X:75735523-75735545 CACTCACTGCTTCCCTAGGCAGG + Intergenic
1193277544 X:79606596-79606618 GACTCACAGTTCCCCACGGCTGG - Intergenic
1193889445 X:87026837-87026859 GACTCACAGCTCCACATGGCTGG + Intergenic
1194049500 X:89052216-89052238 GACTCACAGTTCCACAAGGCTGG + Intergenic
1194127211 X:90034393-90034415 GACCCACAGTTCCACATGGCTGG - Intergenic
1194736798 X:97521744-97521766 GATTCACAGTTCCCCAAGGCTGG - Intronic
1194745949 X:97628372-97628394 GACCCACAGTTCCACACGGCTGG - Intergenic
1195816649 X:108895833-108895855 GACTCACAGCTCCACATGGCTGG - Intergenic
1196993419 X:121353808-121353830 GACCCACAGTTCCGCATGGCTGG - Intergenic
1196995343 X:121376886-121376908 GACTCACAGCTCCACATGGCTGG + Intergenic
1197484852 X:127036399-127036421 GACTCACAGCTCCACATGGCTGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1197995357 X:132366944-132366966 GACTCACAGTTCCCCATGGCTGG + Intergenic
1198860180 X:141060636-141060658 GACTCACAGCTCCACATGGCTGG - Intergenic
1198902511 X:141526754-141526776 GACTCACAGCTCCACATGGCTGG + Intergenic
1198948283 X:142039960-142039982 GACTCACAGCTCCACACGGCTGG - Intergenic
1199112014 X:143946382-143946404 AACTTACAGCTCCACAAGGCTGG - Intergenic
1199329624 X:146543573-146543595 CTTCCACAGATCCCCAGGGCAGG + Intergenic
1199585572 X:149412727-149412749 TTCCCACAGCTTCACAAGGCAGG - Intergenic
1200000065 X:153055848-153055870 CACGCACACCACCCCAAGGAGGG - Intergenic
1200480908 Y:3701484-3701506 GACTCACAGTTCCCCATGGCTGG - Intergenic
1200742650 Y:6870861-6870883 CAACCAGAGTTCCACAAGGCAGG - Intronic
1201186901 Y:11413645-11413667 GACTCACAGCTCCACATGGCTGG + Intergenic
1201509022 Y:14736817-14736839 AACCCACAGTTCCACAGGGCTGG - Intronic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic
1201674475 Y:16563921-16563943 CACTCACAGTTCCACATGGCTGG + Intergenic